- Copper(II)nitrate catalyzed regioselective protection of primary alcohols with 4,4′-dimethoxytrityl and 2,7-dimethyl-9-phenyl xanthen-9-yl groups in nucleosides and carbohydrates
-
Regioselective protection of primary hydroxyl group in nucleoside and carbohydrate analogs was accomplished using dimethoxytrityl alcohol (DMTr-OH) or dimethylpixyl alcohol (DMPx-OH) in presence of copper(II)nitrate as a Lewis acid catalyst. Excellent selectivity was observed for the protection of primary hydroxyl group over secondary while glycosidic bond remain unaffected. Utility of this methodology was further exemplified via DMTr- and DMPx-protection of alipahtic acyclic and cyclic diols.
- Penjarla, Srishylam,Prasad, S. Rajendra,Reddy, Dhande Sudhakar,Banerjee, Shyamapada,Penta, Santhosh,Sanghvi, Yogesh S.
-
p. 232 - 247
(2018/05/14)
-
- Renewable amberlyst-15 catalyzed highly regioselective tritylation and deprotection of sugar-based diols
-
Amberlyst-15 catalyzed highly regioselective tritylation of sugar-based diols was achieved under mild condition using 4,4′-dimethoxytrityl alcohol (DMTrOH). Deprotection of the corresponding DMTr group was also established by the variation to protic solvent. Meanwhile, the heterogeneous catalyst Amberlyst-15 was recycled 3 times with satisfactory retention of catalytic activity and proved its potential application in industry.
- Valeru, Anil,Luo, Zhibin,Penjarla, Srishylum,Khan, Imran,Liu, Bin,Sngepu, Bhavanarushi,Xu, Yin,Xie, Jimin
-
p. 318 - 326
(2018/10/15)
-
- EFFECTS OF APOLIPOPROTEIN B INHIBITION ON GENE EXPRESSION PROFILES IN ANIMALS
-
Antisense compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for treatment of diseases associated with expression of apolipoprotein B are provided. Methods are provided for modulating the expression of genes involved in lipid metabolism, useful in the treatment of conditions associated with cardiovascular risk. Antisense oligonucleotides targeted to apolipoprotein B reduce the level of apolipoprotein B mRNA, lower serum cholesterol and shift liver gene expression profiles from those of an obese animal towards those of a lean animal. Further provided are methods for improving the cardiovascular risk of a subject through antisense inhibition of apolipoprotein B. Also provided are methods for employing antisense oligonucleotides targeted to apolipoprotein B to modulate a cellular pathway or metabolic process.
- -
-
Paragraph 0248
(2015/11/17)
-
- Antisense modulation of CD40 ligand expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of CD40 ligand. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding CD40 ligand. Methods of using these compounds for modulation of CD40 ligand expression and for treatment of diseases associated with expression of CD40 ligand are provided.
- -
-
Page/Page column 19
(2008/06/13)
-
- Antisense modulation of PTP1B expression
-
Compositions and methods are provided for decreasing blood glucose levels in an animal or for preventing or delaying the onset of a rise in blood glucose levels in an animal, comprising administering to said animal an antisense inhibitor of PTP1B expression in combination with at least one glucose-lowering drug. The present invention is also directed to compositions and methods for improving insulin sensitivity in an animal or for preventing or delaying the onset of insulin resistance in an animal. Also provided are compositions and methods for treating or preventing a metabolic condition in an animal. The metabolic condition may be, e.g., diabetes or obesity.
- -
-
Page/Page column 14-15
(2008/06/13)
-
- Antisense modulation of wrn espression
-
Antisense compounds, compositions and methods are provided for modulating the expression of WRN. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding WRN. Methods of using these compounds for modulation of WRN expression and for treatment of diseases associated with expression of WRN are provided.
- -
-
-
- Antisense modulation of stearoyl-CoA desaturase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
-
- Antisense modulation of connective tissue growth factor expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of connective tissue growth factor. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding connective tissue growth factor. Methods of using these compounds for modulation of connective tissue growth factor expression and for treatment of diseases associated with expression of connective tissue growth factor are provided.
- -
-
-
- Antisense modulation of interferon gamma receptor 2
-
Antisense compounds, compositions and methods are provided for modulating the expression of Interferon gamma receptor 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Interferon gamma receptor 2. Methods of using these compounds for modulation of Interferon gamma receptor 2 expression and for treatment of diseases associated with expression of Interferon gamma receptor 2 are provided.
- -
-
-
- Antisense modulation of EIF2C1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of EIF2C1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EIF2C1. Methods of using these compounds for modulation of EIF2C1 expression and for treatment of diseases associated with expression of EIF2C1 are provided.
- -
-
-
- Antisense modulation of dual specific phosphatase 5 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of dual specific phosphatase 5. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding dual specific phosphatase 5. Methods of using these compounds for modulation of dual specific phosphatase 5 expression and for treatment of diseases associated with expression of dual specific phosphatase 5 are provided.
- -
-
-
- Antisense modulation of thyroid hormone receptor interactor 6 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of thyroid hormone receptor interactor 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding thyroid hormone receptor interactor 6. Methods of using these compounds for modulation of thyroid hormone receptor interactor 6 expression and for treatment of diseases associated with expression of thyroid hormone receptor interactor 6 are provided.
- -
-
-
- Antisense modulation of p70 S6 kinase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of p70 S6 kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding p70 S6 kinase. Methods of using these compounds for modulation of p70 S6 kinase expression and for treatment of diseases associated with expression of p70 S6 kinase are provided.
- -
-
-
- Antisense modulation of survivin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Survivin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Survivin. Methods of using these compounds for modulation of Survivin expression and for treatment of diseases associated with expression of Survivin are provided.
- -
-
-
- Compositions and their uses directed to cell growth and maintenance proteins
-
Antisense compounds, compositions and methods are provided for modulating the expression of G protein-coupled receptor kinase 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding G p
- -
-
-
- Antisense modulation of sterol regulatory element-binding protein-1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of sterol regulatory element-binding protein-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids enco
- -
-
-
- Modulation of DC-SIGN expression
-
Compounds, compositions and methods are provided for modulating the expression of DC-SIGN. The compositions comprise oligonucleotides, targeted to nucleic acid encoding DC-SIGN. Methods of using these compounds for modulation of DC-SIGN expression and for diagnosis and treatment of diseases and conditions associated with expression of DC-SIGN are provided.
- -
-
Page/Page column 12
(2008/06/13)
-
- Modulation of aminopeptidase N expression
-
Compounds, compositions and methods are provided for modulating the expression of aminopeptidase N. The compositions comprise oligonucleotides, targeted to nucleic acid encoding aminopeptidase N. Methods of using these compounds for modulation of aminopeptidase N expression and for diagnosis and treatment of disease associated with expression of aminopeptidase N are provided.
- -
-
-
- Antisense modulation of inducible nitric oxide synthase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of inducible nitric oxide synthase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding inducible nitric oxide synthase. Methods of using these compounds for modulation of inducible nitric oxide synthase expression and for treatment of diseases associated with expression of inducible nitric oxide synthase are provided.
- -
-
-
- Antisense modulation of TFAP2C expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of TFAP2C. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding TFAP2C. Methods of using these compounds for modulation of TFAP2C expression and for treatment of diseases associated with expression of TFAP2C are provided.
- -
-
-
- Antisense inhibition via RNAse H-independent reduction in mRNA
-
The present invention provides compositions and methods for reducing levels of a preselected mRNA, using antisense compounds targeted to a splice site or a region up to 50 nucleobases upstream of an exon/intron junction on said mRNA. Preferably, said antisense compounds do not elicit RNAse H cleavage of the mRNA.
- -
-
Page/Page column 19; 20
(2010/02/12)
-
- Antisense modulation of polo-like kinase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of polo-like kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding polo-like kinase. Methods of using these compounds for modulation of polo-like kinase expression and for treatment of diseases associated with expression of polo-like kinase are provided.
- -
-
Page/Page column 20
(2008/06/13)
-
- ANTISENSE MODULATION OF STEAROYL-COA DESATURASE EXPRESSION
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
Page/Page column 94
(2010/02/10)
-
- Modulation of CEACAM1 expression
-
Compounds, compositions and methods are provided for modulating the expression of CEACAM1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding CEACAM1. Methods of using these compounds for modulation of CEACAM1 expression and for diagnosis and treatment of disease associated with expression of CEACAM1 are provided.
- -
-
Page/Page column 27
(2010/02/11)
-
- Kilo-scale synthesis process for 2′-O-(2-methoxyethyl)-pyrimidine derivatives
-
We describe an improved process to produce 2′-O-(2-methoxyethyl)- pyrimidines. Starting with commercially available O-2,2′-anhydro-5- methyluridine and tris-(2-methoxyethyl)borate, we modified the ring-opening reaction conditions and changed to a continuous extraction purification method to give 2′-O-(2-methoxyethyl)-5-methyluridine. The dimethoxytritylation 5′/3′ ratios and yield were improved by the use of 2,6-lutidine as the base. Conditions to convert to the 5-methylcytidine analog and its isolation by crystallization were optimized. Final benzoylation was improved by developing a method to selectively hydrolyze benzoyl ester impurities. Copyright Taylor & Francis, Inc.
- Ross, Bruce S.,Song, Quanlai,Han, Mingming
-
p. 815 - 818
(2007/10/03)
-
- TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications
-
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
- -
-
-
- Modulation of PTEN expression via oligomeric compounds
-
Oligomeric compounds, compositions and methods are provided for modulating the expression of PTEN. The compositions comprise oligomeric compounds, particularly double stranded oligomeric compounds, targeted to nucleic acids encoding PTEN. Methods of using these compounds for modulation of PTEN expression and for treatment of diseases and conditions associated with expression of PTEN are provided. Such conditions include diabetes and hyperproliferative conditions. Methods for decreasing blood glucose levels, inhibiting PEPCK expression, decreasing blood insulin levels, decreasing insulin resistance, increasing insulin sensitivity, decreasing blood triglyceride levels or decreasing blood cholesterol levels in an animal, among others, using the compounds of the invention are also provided. The animal is preferably a human; also preferably the animal is a diabetic animal.
- -
-
-
- Antisense modulation of clusterin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of clusterin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding clusterin. Methods of using these compounds for modulation of clusterin expression and for treatment of diseases associated with expression of clusterin are provided.
- -
-
-
- Antisense modulation of stearoyl-coa desaturase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
-
- Antisense modulation of tumor necrosis factor receptor 2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Tumor Necrosis Factor Receptor 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Tumor Necrosis Factor Receptor 2. Methods of using these compounds for modulation of Tumor Necrosis Factor Receptor 2 expression and for treatment of diseases associated with expression of Tumor Necrosis Factor Receptor 2 are provided.
- -
-
-
- Antisense modulation of src-c expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of src-c. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding src-c. Methods of using these compounds for modulation of src-c expression and for treatment of diseases associated with expression of src-c are provided.
- -
-
-
- Antisense modulation of mitoNEET expression
-
Antisense compounds, compositions, and methods are provided for modulating the expression of a family of polypeptides from mitochondrial membranes, which bind insulin sensitizing, antidiabetic thiazolodinediones (mitoNEET). The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding mitoNEET. Methods of using these compounds for modulation of mitoNEET expression and for treatment of diseases associated with expression of mitoNEET are provided.
- -
-
-
- Antisense modulation of TNFR1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of TNFR1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding TNFR1. Methods of using these compounds for modulation of TNFR1 expression and for treatment of diseases associated with expression of TNFR1 are provided.
- -
-
-
- Antisense modulation of cellular inhibitor of apoptosis-1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Cellular Inhibitor of Apoptosis-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Cellular Inhibitor of Apoptosis-1. Methods of using these compounds for induction of cellular apoptosis are provided.
- -
-
-
- Antisense modulation of c-reactive protein expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of C-reactive protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding C-reactive protein. Methods of using these compounds for modulation of C-reactive protein expression and for treatment of diseases associated with expression of C-reactive protein are provided.
- -
-
-
- Use of integrin-linked kinase inhibitors for treating insulin resistance, hyperglycemia and diabetes
-
The present invention features methods for treating conditions of insulin resistance, hyperglycemia and/or diabetes. In a broad embodiment, the methods comprise the step of administering to a mammal in need of treatment a therapeutically effective amount of an ILK inhibitor. ILK inhibitors in accordance with the present invention includes small molecules, antibodies, peptides, and antisense compounds. In one embodiment, antisense compounds in accordance with the present invention comprise antisense oligomers.
- -
-
-
- Antisense modulation of sap-1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of SAP-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding SAP-1. Methods of using these compounds for modulation of SAP-1 expression and for treatment of diseases associated with expression of SAP-1 are provided.
- -
-
-
- Antisense modulation of acyl coa cholesterol acyltransferase-2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of acyl CoA cholesterol acyltransferase-2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding acyl CoA cholesterol acyltransferase-2. Methods of using these compounds for modulation of acyl CoA cholesterol acyltransferase-2 expression and for treatment of diseases associated with expression of acyl CoA cholesterol acyltransferase-2 are provided.
- -
-
-
- Antisense modulation of integrin beta 5 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of integrin beta 5. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding integrin beta 5. Method
- -
-
-
- Antisense modulation of LIM domain kinase 1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of LIM domain kinase 1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding LIM domain kinase 1
- -
-
-
- Antisense modulation of p21-activated kinase 2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of p21-activated kinase 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding p21-activated ki
- -
-
-
- Antisense modulation of NF-kappa-B p50 subunit expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of NF-kappa-B p50 subunit. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding NF-kappa-B p50 s
- -
-
-
- Antisense modulation of cell division cycle 2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of cell division cycle 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding cell division cyc
- -
-
-
- Antisense modulation of geranylgeranyl diphosphate synthase 1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of geranylgeranyl diphosphate synthase 1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding g
- -
-
-
- Antisense modulation of TGF-beta 2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of TGF-beta 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding TGF-beta 2. Methods of using
- -
-
-
- Antisense modulation of protein kinase C-iota expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of protein kinase C-iota. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding protein kinase C-
- -
-
-
- Antisense modulation of livin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Livin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Livin. Methods of using these com
- -
-
-
- Antisense modulation of breast cancer-1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of breast cancer-1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding breast cancer-1. Method
- -
-
-
- Antisense modulation of PTPRK expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of PTPRK. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTPRK. Methods of using these com
- -
-
-
- Oligonucleotides having modified nucleoside units
-
Disclosed are oligonucleotides and oligonucleosides that include one or more modified nucleoside units. The oligonucleotides and oligonucleosides are particularly useful as antisense agents, ribozymes, aptamer, siRNA agents, probes and primers or, when hybridized to an RNA, as a substrate for RNA cleaving enzymes including RNase H and dsRNase.
- -
-
-