- Deoxynucleic Guanidines (DNG)- Modified Oligonucleotides and Methods of Synthesizing Deoxynucleic Guanidine Strands
-
Disclosed herein are spherical nucleic acids (SNAs) comprising oligonucleotides comprising one or more modified oligonucleotides, and methods of use thereof. Also disclosed are methods of synthesizing modified oligonucleotides for use in therapeutics, inc
- -
-
-
- Mercury-Free Automated Synthesis of Guanidinium Backbone Oligonucleotides
-
A new method for synthesizing deoxynucleic guanidine (DNG) oligonucleotides that uses iodine as a mild and inexpensive coupling reagent is reported. This method eliminates the need for the toxic mercury salts and pungent thiophenol historically used in me
- Skakuj, Kacper,Bujold, Katherine E.,Mirkin, Chad A.
-
p. 20171 - 20176
(2020/01/02)
-
- Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue: Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding
-
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3′ → 5′ direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5′-terminus using PyBOP/HOBt chemistry. The stability of (DNA)2·DNG-H triplexes and DNA. DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5′-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3′, respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5′-terminus of the DNG enhances the (DNA)2·DNG-H triplex stability by a ΔTm of 13 °C. The fluorescence emission studies of (DNA)2·DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)2·DNG triplex stability by 11 °C, whereas (DNA)2·DNG-H triplex stability was decreased by 23 °C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 °C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA·DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA·DNG minor groove, and the duplex stability was enhanced by ΔTm of 7 °C. The stability of (DNA)2·DNG triplexes and DNA·DNG duplexes is independent of pH, whereas the stability of (DNA)2·DNG-H triplexes decreases with increase in pH.
- Reddy, Putta Mallikarjuna,Bruice, Thomas C.
-
p. 3736 - 3747
(2007/10/03)
-
- Deoxynucleic guanidine: Synthesis and incorporation of purine nucleosides into positively charged DNG oligonucleotides
-
The synthesis of purine nucleosides capable of making the guanidinium linkage is described for the first time starting from the corresponding 2′-deoxynucleosides. The positively charged mixed base DNG oligomer containing guanine was synthesized on solid-p
- Challa, Hemavathi,Bruice, Thomas C.
-
p. 1475 - 1481
(2007/10/03)
-
- Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) oligonucleotide mixed sequences
-
Positively charged DNG oligonucleotide mixed sequences containing A/T bases were prepared by solid-phase synthesis. Synthesis proceeds in 3′→5′ direction and involves coupling of 3′-Fmoc protected thiourea in the presence of HgCl2/TEA with the corresponding 5′-amine of the growing oligo chain. DNG binding characteristics with complementary DNA and with itself have been evaluated.
- Reddy, Putta Mallikarjuna,Bruice, Thomas C.
-
p. 1281 - 1285
(2007/10/03)
-