- CHIRAL CONTROL
-
The present invention relates to chirally controlled oligonucleotides, chirally controlled oligonucleotide compositions, and the method of making and using the same.
- -
-
Paragraph 00126
(2014/02/15)
-
- Antisense modulation of CD40 ligand expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of CD40 ligand. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding CD40 ligand. Methods of using these compounds for modulation of CD40 ligand expression and for treatment of diseases associated with expression of CD40 ligand are provided.
- -
-
Page/Page column 19
(2008/06/13)
-
- ANTISENSE MODULATION OF LFA-3
-
Compositions and methods for the treatment and diagnosis of diseases or disorders amenable to treatment through modulation of expression of a nucleic acid encoding a lymphocyte function associated antigen 3 (LFA-3; also known as CD58) protein are provided.
- -
-
-
- Kilo-scale synthesis process for 2′-O-(2-methoxyethyl)-pyrimidine derivatives
-
We describe an improved process to produce 2′-O-(2-methoxyethyl)- pyrimidines. Starting with commercially available O-2,2′-anhydro-5- methyluridine and tris-(2-methoxyethyl)borate, we modified the ring-opening reaction conditions and changed to a continuous extraction purification method to give 2′-O-(2-methoxyethyl)-5-methyluridine. The dimethoxytritylation 5′/3′ ratios and yield were improved by the use of 2,6-lutidine as the base. Conditions to convert to the 5-methylcytidine analog and its isolation by crystallization were optimized. Final benzoylation was improved by developing a method to selectively hydrolyze benzoyl ester impurities. Copyright Taylor & Francis, Inc.
- Ross, Bruce S.,Song, Quanlai,Han, Mingming
-
p. 815 - 818
(2007/10/03)
-
- Modulation of aminopeptidase N expression
-
Compounds, compositions and methods are provided for modulating the expression of aminopeptidase N. The compositions comprise oligonucleotides, targeted to nucleic acid encoding aminopeptidase N. Methods of using these compounds for modulation of aminopeptidase N expression and for diagnosis and treatment of disease associated with expression of aminopeptidase N are provided.
- -
-
-
- Antisense modulation of inducible nitric oxide synthase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of inducible nitric oxide synthase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding inducible nitric oxide synthase. Methods of using these compounds for modulation of inducible nitric oxide synthase expression and for treatment of diseases associated with expression of inducible nitric oxide synthase are provided.
- -
-
-
- Antisense modulation of TFAP2C expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of TFAP2C. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding TFAP2C. Methods of using these compounds for modulation of TFAP2C expression and for treatment of diseases associated with expression of TFAP2C are provided.
- -
-
-
- Antisense modulation of polo-like kinase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of polo-like kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding polo-like kinase. Methods of using these compounds for modulation of polo-like kinase expression and for treatment of diseases associated with expression of polo-like kinase are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Modulation of CEACAM1 expression
-
Compounds, compositions and methods are provided for modulating the expression of CEACAM1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding CEACAM1. Methods of using these compounds for modulation of CEACAM1 expression and for diagnosis and treatment of disease associated with expression of CEACAM1 are provided.
- -
-
Page/Page column 27
(2010/02/11)
-
- Modulation of DC-SIGN expression
-
Compounds, compositions and methods are provided for modulating the expression of DC-SIGN. The compositions comprise oligonucleotides, targeted to nucleic acid encoding DC-SIGN. Methods of using these compounds for modulation of DC-SIGN expression and for diagnosis and treatment of diseases and conditions associated with expression of DC-SIGN are provided.
- -
-
Page/Page column 12
(2008/06/13)
-
- Antisense oligonucleotide modulation of tumor necrosis factor-alpha (TNF-alpha) expression
-
Compositions and methods are provided for inhibiting the expression of human tumor necrosis factor-α (TNF-α). Antisense oligonucleotides targeted to nucleic acids encoding TNF-α are preferred. Methods of using these oligonucleotides for inhibition of TNF-α expression and for treatment of diseases, particularly inflammatory and autoimmune diseases, associated with overexpression of TNF-α are provided.
- -
-
-
- Antisense oligonucleotide modulation of STAT3 expression
-
Compounds, compositions and methods are provided for inhibiting the expression of human STAT3. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding STAT3. Methods of using these oligonucleotides for inhibition of STAT3 expression and for promotion of apoptosis are provided. Methods for treatment of diseases, particularly inflammatory diseases and cancers, associated with overexpression or constitutive activation of STAT3 or insufficient apoptosis are also provided.
- -
-
-
- Antisense modulation of superoxide dismutase 1, soluble expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of superoxide dismutase 1, soluble. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding superoxide dismutase 1, soluble. Methods of using these compounds for modulation of superoxide dismutase 1, soluble expression and for treatment of diseases associated with expression of superoxide dismutase 1, soluble are provided.
- -
-
-
- Antisense modulation of EIF2C1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of EIF2C1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EIF2C1. Methods of using these compounds for modulation of EIF2C1 expression and for treatment of diseases associated with expression of EIF2C1 are provided.
- -
-
-
- Antisense modulation of stearoyl-CoA desaturase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compounds for modulation of stearoyl-CoA desaturase expression and for treatment of diseases associated with expression of stearoyl-CoA desaturase are provided.
- -
-
-
- Antisense modulation of connective tissue growth factor expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of connective tissue growth factor. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding connective tissue growth factor. Methods of using these compounds for modulation of connective tissue growth factor expression and for treatment of diseases associated with expression of connective tissue growth factor are provided.
- -
-
-
- Antisense modulation of wrn espression
-
Antisense compounds, compositions and methods are provided for modulating the expression of WRN. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding WRN. Methods of using these compounds for modulation of WRN expression and for treatment of diseases associated with expression of WRN are provided.
- -
-
-
- Antisense modulation of interferon gamma receptor 2
-
Antisense compounds, compositions and methods are provided for modulating the expression of Interferon gamma receptor 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Interferon gamma receptor 2. Methods of using these compounds for modulation of Interferon gamma receptor 2 expression and for treatment of diseases associated with expression of Interferon gamma receptor 2 are provided.
- -
-
-
- Antisense modulation of dual specific phosphatase 5 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of dual specific phosphatase 5. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding dual specific phosphatase 5. Methods of using these compounds for modulation of dual specific phosphatase 5 expression and for treatment of diseases associated with expression of dual specific phosphatase 5 are provided.
- -
-
-
- Antisense modulation of thyroid hormone receptor interactor 6 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of thyroid hormone receptor interactor 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding thyroid hormone receptor interactor 6. Methods of using these compounds for modulation of thyroid hormone receptor interactor 6 expression and for treatment of diseases associated with expression of thyroid hormone receptor interactor 6 are provided.
- -
-
-
- Antisense modulation of p70 S6 kinase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of p70 S6 kinase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding p70 S6 kinase. Methods of using these compounds for modulation of p70 S6 kinase expression and for treatment of diseases associated with expression of p70 S6 kinase are provided.
- -
-
-
- Compositions and methods for the delivery of oligonucleotides via the alimentary canal
-
The present invention relates to compositions and methods which enhance the transport of nucleic acids, especially oligonucleotides at various sites in the alimentary canal of an animal. The methods and compositions enhance the transport of oligonucleotides across the mucosa of the alimentary canal via the use of one or more penetration enhancers. The invention features the use of various fatty acids, bile salts, chelating agents and other penetration enhancers, as well as carrier compounds, to enhance the stability of nucleic acids and/or their transport across and/or into cells of the alimentary canal. In one preferred embodiment, the compositions and methods of the invention are utilized to effect the oral delivery of an antisense oligonucleotide to an animal in order to modulate the expression of a gene in the animal for investigative, therapeutic or prophylactic purposes.
- -
-
-
- Antisense modulation of survivin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Survivin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Survivin. Methods of using these compounds for modulation of Survivin expression and for treatment of diseases associated with expression of Survivin are provided.
- -
-
-
- TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications
-
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides (nucleotides 5-17) are 2′-deoxynucleotides, and where the cytosines of nucleotides 1, 4 and 19 are 5-methylcytosines. The compound has increased stability in vivo and improved in vitro and in vivo antitumor activity.
- -
-
-
- Antisense inhibition via RNAse H-independent reduction in mRNA
-
The present invention provides compositions and methods for reducing levels of a preselected mRNA, using antisense compounds targeted to a splice site or a region up to 50 nucleobases upstream of an exon/intron junction on said mRNA. Preferably, said antisense compounds do not elicit RNAse H cleavage of the mRNA.
- -
-
Page/Page column 19
(2010/02/12)
-
- Antisense modulation of cyclin-dependent kinase 6 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of cyclin-dependent kinase 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding cyclin-dependent kinase 6. Methods of using these compounds for modulation of cyclin-dependent kinase 6 expression and for treatment of diseases associated with expression of cyclin-dependent kinase 6 are provided.
- -
-
Page/Page column 21-22
(2008/06/13)
-
- Antisense modulation of hypothetical protein LOC51249 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of hypothetical protein LOC51249. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding hypothetical protein LOC51249. Methods of using these compounds for modulation of hypothetical protein LOC51249 expression and for treatment of diseases associated with expression of hypothetical protein LOC51249 are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of selenophosphate synthetase 2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of selenophosphate synthetase 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding selenophosphate synthetase 2. Methods of using these compounds for modulation of selenophosphate synthetase 2 expression and for treatment of diseases associated with expression of selenophosphate synthetase 2 are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of ADAM12 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of ADAM12. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding ADAM12. Methods of using these compounds for modulation of ADAM12 expression and for treatment of diseases associated with expression of ADAM12 are provided.
- -
-
Page/Page column 20
(2008/06/13)
-
- Antisense modulation of SMRT expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of SMRT. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding SMRT. Methods of using these compounds for modulation of SMRT expression and for treatment of diseases associated with expression of SMRT are provided.
- -
-
Page/Page column 20-21
(2008/06/13)
-
- Antisense modulation of cyclin-dependent kinase 4 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of cyclin-dependent kinase 4. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding cyclin-dependent kinase 4. Methods of using these compounds for modulation of cyclin-dependent kinase 4 expression and for treatment of diseases associated with expression of cyclin-dependent kinase 4 are provided.
- -
-
Page/Page column 22-23
(2008/06/13)
-
- Antisense modulation of insulin-like growth factor 2 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of insulin-like growth factor 2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding insulin-like growth factor 2. Methods of using these compounds for modulation of insulin-like growth factor 2 expression and for treatment of diseases associated with expression of insulin-like growth factor 2 are provided.
- -
-
Page/Page column 22
(2008/06/13)
-
- Antisense modulation of PTPRM expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of PTPRM. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTPRM. Methods of using these compounds for modulation of PTPRM expression and for treatment of diseases associated with expression of PTPRM are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of HMG-CoA reductase expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of HMG-CoA reductase. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding HMG-CoA reductase. Methods of using these compounds for modulation of HMG-CoA reductase expression and for treatment of diseases associated with expression of HMG-CoA reductase are provided.
- -
-
Page/Page column 20-21
(2010/02/05)
-
- Antisense modulation of PTPRA expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of PTPRA. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTPRA. Methods of using these compounds for modulation of PTPRA expression and for treatment of diseases associated with expression of PTPRA are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of phosphotyrosyl phosphatase activator expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of phosphotyrosyl phosphatase activator. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding phosphotyrosyl phosphatase activator. Methods of using these compounds for modulation of phosphotyrosyl phosphatase activator expression and for treatment of diseases associated with expression of phosphotyrosyl phosphatase activator are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of Ran GTPase activating protein 1 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of Ran GTPase activating protein 1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding Ran GTPase activating protein 1. Methods of using these compounds for modulation of Ran GTPase activating protein 1 expression and for treatment of diseases associated with expression of Ran GTPase activating protein 1 are provided.
- -
-
Page/Page column 19-20
(2010/02/05)
-
- Antisense modulation of G protein-coupled receptor 6 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of G protein-coupled receptor 6. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding G protein-coupled receptor 6. Methods of using these compounds for modulation of G protein-coupled receptor 6 expression and for treatment of diseases associated with expression of G protein-coupled receptor 6 are provided.
- -
-
Page/Page column 19-20
(2010/02/05)
-
- Antisense modulation of PPP2R1A expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of PPP2R1A. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PPP2R1A. Methods of using these compounds for modulation of PPP2R1A expression and for treatment of diseases associated with expression of PPP2R1A are provided.
- -
-
Page/Page column 19-20
(2010/02/05)
-
- Antisense modulation of requiem expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of requiem. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding requiem. Methods of using these compounds for modulation of requiem expression and for treatment of diseases associated with expression of requiem are provided.
- -
-
Page/Page column 19-20
(2010/02/05)
-
- Antisense modulation of KIAA1531 protein expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of KIAA1531 protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding KIAA1531 protein. Methods of using these compounds for modulation of KIAA1531 protein expression and for treatment of diseases associated with expression of KIAA1531 protein are provided.
- -
-
Page/Page column 20
(2010/02/05)
-
- Antisense modulation of LAR expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of LAR. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding LAR. Methods of using these compounds for modulation of LAR expression and for treatment of diseases associated with expression of LAR are provided.
- -
-
Page/Page column 20
(2010/02/05)
-
- Antisense modulation of hepatoma-derived growth factor expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of hepatoma-derived growth factor. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding hepatoma-derived growth factor. Methods of using these compounds for modulation of hepatoma-derived growth factor expression and for treatment of diseases associated with expression of hepatoma-derived growth factor are provided.
- -
-
Page/Page column 19-20
(2010/11/30)
-
- Antisense modulation of P2X4 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of P2X4. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding P2X4. Methods of using these compounds for modulation of P2X4 expression and for treatment of diseases associated with expression of P2X4 are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of PPP3CB expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of PPP3CB. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PPP3CB. Methods of using these compounds for modulation of PPP3CB expression and for treatment of diseases associated with expression of PPP3CB are provided.
- -
-
Page/Page column 19;20
(2008/06/13)
-
- Antisense modulation of EDG5 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of EDG5. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EDG5. Methods of using these compounds for modulation of EDG5 expression and for treatment of diseases associated with expression of EDG5 are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- ANTISENSE MODULATION OF EDG1 EXPRESSION
-
Antisense compounds, compositions and methods are provided for modulating the expression of EDG1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding EDG1. Methods of using these compounds for modulation of EDG1 expression and for treatment of diseases associated with expression of EDG1 are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of perilipin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of perilipin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding perilipin. Methods of using these compounds for modulation of perilipin expression and for treatment of diseases associated with expression of perilipin are provided.
- -
-
Page/Page column 19-20
(2008/06/13)
-
- Antisense modulation of resistin expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of resistin. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding resistin. Methods of using these compounds for modulation of resistin expression and for treatment of diseases associated with expression of resistin are provided.
- -
-
Page/Page column 19-20
(2010/02/05)
-
- Antisense modulation of G protein-coupled receptor 12 expression
-
Antisense compounds, compositions and methods are provided for modulating the expression of G protein-coupled receptor 12. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding G protein-coupled receptor 12. Methods of using these compounds for modulation of G protein-coupled receptor 12 expression and for treatment of diseases associated with expression of G protein-coupled receptor 12 are provided.
- -
-
Page/Page column 20
(2010/11/30)
-