2′-Lipid-modified oligonucleotides via a 'Staudinger-Vilarrasa' reaction

Article abstract of DOI:10.1016/j.tetlet.2008.09.078

We report a new access to 2′-amido-2′-deoxyuridine via a Staudinger-Vilarrasa coupling reaction for the preparation of lipid-modified oligonucleotides. One or two lipidic moieties were inserted within the oligonucleotidic sequence (LONs) leading to a repertoire of original antagomir-like molecules targeting micro RNA (miRNA or miR). Melting temperature (Tm) experiments revealed that the stability of the duplexes depends on the lipid position and the number of lipid moieties inserted within the oligonucleotide sequence. Single lipid conjugations of positions 11 and 19 of LONs targeting miR-122 do not destabilize the duplexes.

Full text of DOI:10.1016/j.tetlet.2008.09.078

Tetrahedron Letters 49 (2008) 6838–6840
Contents lists available at ScienceDirect
Tetrahedron Letters
journal homepage: www.elsevier.com/locate/tetlet
20-Lipid-modified oligonucleotides via a ‘Staudinger–Vilarrasa’ reaction
Hubert Chapuis a,b, Laurent Bui a,b, Isabelle Bestel a,b, Philippe Barthélémy a,b,
*
a Université Victor Segalen Bordeaux 2, 146 rue léo Saignat, F-33076, Bordeaux Cedex, France
b Inserm, U869, Bordeaux, F-33076, France
a r t i c l e i n f o
a b s t r a c t
We report a new access to 20-amido-20-deoxyuridine via a Staudinger–Vilarrasa coupling reaction for the
preparation of lipid-modified oligonucleotides. One or two lipidic moieties were inserted within the oli-
gonucleotidic sequence (LONs) leading to a repertoire of original antagomir-like molecules targeting
micro RNA (miRNA or miR). Melting temperature (Tm) experiments revealed that the stability of the
duplexes depends on the lipid position and the number of lipid moieties inserted within the oligonucleo-
tide sequence. Single lipid conjugations of positions 11 and 19 of LONs targeting miR-122 do not desta-
bilize the duplexes.
Article history:
Received 9 July 2008
Revised 10 September 2008
Accepted 12 September 2008
Available online 18 September 2008
Ó 2008 Elsevier Ltd. All rights reserved.
Recently, much attention has been given to the design of hybrid
molecules with a bi-functionality based upon the combination of
nucleic acids and amphiphile features.1 Of the many possible com-
binations, lipid-oligonucleotide conjugates (LONs) nicely illustrate
the interest in developing hybrid structures. Interestingly, lipid
conjugation of oligonucleotides (ONs) has been used to facilitate
the cellular uptake.2–5 With regard to LONs conjugates, two ON-
based antisense therapeutic strategies have been investigated.
The first one involves LON antisense sequences that have been se-
lected to bind to messenger RNA (mRNA) and block the genetic
expression at the translational step.5 Previously, a second approach
had been developed.6 This second strategy take advantage of cho-
lesterol-based oligonucleotide conjugates, called antagomirs,
which are specific inhibitors of non-coding RNA (micro RNAs) in-
volved in the regulation of gene expression.7 Antagomirs, which
are very attractive and promising therapeutic material to target
miRNAs via complementary hybridization, can be tuned to modu-
late their cellular uptake and biological activity.
phosphoramidite via a Staudinger–Vilarrasa reaction (Scheme 1)
is developed. The lipid phosphoramidite is further coupled to the
oligonucleotides by using a solid supported synthesis, in which
the ON is elongated in the 30–50 direction. The first series of LONs
proposed show a complementary sequence to miR-122, which is a
micro RNA involved in the control of the replication of HCV and in
the regulation of lipid metabolism, conjugated with either one or
two lipid moieties covalently attached at the 20 position. Indeed,
specific silencing of miRNAs such as miR-122 could become a ther-
apeutic strategy against HCV infections or metabolic diseases.8–10
A usual strategy for synthesizing LONs is the preparation of
modified nucleoside followed by conversion to the corresponding
phosphoramidite suitable for automated ON synthesis. Different
approaches have been investigated for preparing hydrophobic
phosphoramidite building blocks including sugar11 and bases12
modifications or inter-nucleoside phosphate functionalization.13
The antisense activity of antagomirs or antagomir-like mole-
cules requires the high specificity of Watson and Cricks hybrid-
ization between antagomir and miRNA complementary
sequences. Hence, the lipid conjugation of the ONs must pre-
serve the duplex stability. Several groups have reported that
the modifications of the carbohydrate moiety interfere less with
base pairing than those on backbone14,15 or base sites.16,17 Inter-
estingly, the 20-modification of the ribose, which is compatible
with the 30–50 solid-phase synthesis, is known to induce minimal
distortions in ON structures and enhances ON resistance against
nucleases.18
A motivator of this research is to expand the repertoire of the
chemical structure of antagomirs reported recently. To the best
of our knowledge, there is no previous example of modified antag-
omirs featuring lipid moieties inserted within the sequence.
Here in, we describe an efficient and versatile access to a series of
antagomir analogues. The synthesis of a 20-lipid-amido uridine
Abbreviations: CH2Cl2, dichloromethane; DIEA, diisopropyl ethylamine; DMF,
dimethylformamide; DMAP, 4-(dimethylamino)pyridine; DMTr–Cl, 4,4’-dime-
thoxytrityl chloride; h, hour(s); HOSu, N-hydroxy succinimide; o/n, overnight; LiF,
lithium fluoride; PnBu3, tri-n-butylphosphine; Py, pyridine; RT, room temperature;
SiO2, silicium dioxide; TEA, triethylamine; THF, tetrahydrofuran; RNA, ribonucleic
acid; TMEDA, N,N,N’,N’-tetramethylethylene diamine; TMS–N3, trimethylsilyl azide.
* Corresponding author. Address: Inserm, U869, Bordeaux, F-33076, France. Tel.:
+33 5 57 57 10 14; fax: +33 5 5 7 57 10 15.
A
large number of ON derivatives bearing 20-O-tethered
modifications have been reported.19–23 Less described are those
involving 20-carbamate,24 20-ureido, or 20-amido modifications.25,26
Concerning the later, they usually result from N-acylation of
the corresponding 20-amino-20-deoxyribonucleoside, which is
previously prepared in five steps through the reduction of the
E-mail address: philippe.barthelemy@inserm.fr (P. Barthélémy).
0040-4039/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.tetlet.2008.09.078

H. Chapuis et al. / Tetrahedron Letters 49 (2008) 6838–6840
6839
Briefly stated, uridine was reacted with diphenyl carbonate and
sodium bicarbonate in DMF to provide cyclic anhydro intermedi-
ate 1. The five-membered ring cycle of the anhydrouridine 1 was
then opened in the presence of trimethyl silyl azide (Scheme
1).29 The 50 hydroxyl position of the resulting azido derivative 2,
which was first described in 1971 by Moffat and co-workers30
was reacted with dimethoxytritylchloride in the presence of DMAP
to give the key precursor 50-(dimethoxytrityl)-20-azido-20-deoxy-
uridine 3.
O
N
O
N
NH
N
O
O
HO
HO
O
O
i
ii
OH N3
OH
1
2
In order to introduce the lipid part to the ribose 20 position
through an amide linker, a Staudinger-based reaction was per-
formed. The classical Staudinger transformation is a potentially
biorthogonal reaction, which occurs between a phosphine and an
organic azide. It produces an aza-ylide intermediate that hydro-
lyzes spontaneously in aqueous conditions to yield the correspond-
ing phosphine oxide and primary amine which can be later
N-acylated.28 The Staudinger–Vilarrasa variant added an activated
carboxylic acid to the organic azide and the phosphine, leading in
one step to the corresponding carboxamide under very mild
conditions.28
O
N
O
NH
NH
O
N
O
DMTrO
DMTrO
O
O
iii
OH N3
HO HN
O
3
4
In this work, lauric acid was used as hydrophobic segment
for the carboxamide synthesis. Preliminary to the coupling reac-
tion, the carboxylic acid was converted into its N-hydroxy-
succinimide ester derivative. The optimized protocol of this
coupling step consisted in mixing the activated fatty acid and 3
at 0 °C. The coupling begins with a dropwise addition of freshly dis-
tilled nBu3P to the reaction mixture, and then rising the tempera-
ture to ambience within approximately 30 min. Thanks to this
quick temperature increase, we did not observe any trace of the
acyltriazene byproduct.31,32 As confirmed by COSY NMR and MS
analysis, this reaction provides the expected amide derivative 4
(Scheme 1).
O
NH
N
O
DMTrO
O
iv
iPr
N
O
HN
O
i
Pr
P
O
This four-step procedure used readily available starting materi-
als and is an improvement over the N-acylation route to 20-amido-
20-deoxuridine;27 also, it is amenable to the preparation of a large
number of derivatives. The following step is the synthesis of the
requisite 30-phosphoramidite building block 5 suitable for auto-
mated oligonucleotide synthesis.
NC
5
Compound 5 was further coupled to the ON chain using a clas-
sical supported synthesis under standard conditions. The resulting
LONs feature either one or two lipid-modified nucleoside com-
bined with 20OMe nucleoside and phosphodiester backbones. LONs
were cleaved from solid support and deprotected after an over-
night treatment in 30% aqueous ammonia at 55 °C.
LONs were further purified by using Reverse Phase-HPLC (RP
C4) (Table 1). The retention times in HPLC analysis for the uncon-
jugated ON and LONs, respectively, gave an indication about the
lipophilic potentials of the compounds (see Supplementary data).
In an effort to realize drug-design around the promising thera-
peutic antagomir material, we prepared anti-miR-122 oligonucleo-
Scheme 1. Reagents and conditions: (i) LiF, TMS–N3, TMEDA, DMF, 105 °C, 48 h,
89%; (ii) DMTr–Cl, triethylamine, DMAP, Py, rt, o/n; SiO2, 51%; (iii) HOSu fatty ester
of dodecanoic acid 2 equiv, PnBu3 2 equiv, THF, 0 °C then rt in 30 min, 3 h, CH2Cl2/
NaHCO3 workup; SiO2, 90%; (iv) chloro(2-cyanoethoxy)(N,N-diisopropyl-
amino)phosphine, DIEA, dichloromethane, 1 h, 68% (taking into account the amount
of H-phoshonate in our sample).
20-azido analogue or through the intramolecular cyclization of a
trichloroacetamidate.27 Herein, we report a new synthetic pathway
for synthesizing a 20-amido-20-deoxyuridine based on a Staudinger–
Vilarrasa coupling reaction.28
tides featuring
a lipidic part within the sequence. Different
positions in the miR-122 complementary oligonucleotide were
Table 1
Characterization of LONs by RP-HPLC elution times and MALDI mass spectrometry
Entry
ON-1
Oligonucleotidea miR-122: (GUUUGUGGUAACAGUGUGAGGU) Elution time (min) Mass calculated (Da)b (M–H)ꢀ Mass found (Da) MALDI (M–H)ꢀ Tm (°C)
20OMe(CAAACACCAUUGUCACACUCCA) control
11.5c
7196
7196
61
LON-2 20OMe(CAAACACCAUU11GUCACACUCCA)
LON-3 20OMe(CAAACACCAUUGU13CACACUCCA)
LON-4 20OMe(CAAACACCAUUGUCACAC U19CCA)
LON-5 20OMe(CAAACACCAUU11GUCACAC U19CCA)
38.0
32.7
37.0
37.3
7359
7359
7359
7527
7369
7361
7362
7530d
61
56
61
56
a
Sequences are written from 50 to 30.
b
Calculations with all the phosphate groups protonated. Accuracy: +/ꢀ0.1%.
c
Conditions used for ON-1 and LONs purification are not the same (see Supplementary data).
Data obtained from ESI MS (see Supplementary data).
d

6840
H. Chapuis et al. / Tetrahedron Letters 49 (2008) 6838–6840
investigated (Table 1): u11 (LON-2), u13 (LON-3), u19 (LON-4), or
u11/u19 (LON-5).
Acknowledgments
To evaluate the effect of LONs on miR-122/anti-miR-122
duplexes, hybridization experiments were performed. Melting
temperatures (Tm) of the duplexes are listed in Table 1. For com-
parative analysis, Tm of anti-miR-122 lacking the hydrophobic part
was also determined. Hybridization of the 20-conjugated oligonu-
cleotides to their RNA complements, miR-122, reveals, firstly, that
large lipid modifications are well tolerated at the 20 position de-
spite the amido linker. Indeed, substitutions involving nitrogen,
like 20-amino, 20-carbamate, or 20-amido push the equilibrium of
the ribose from the 30-endo conformation toward a more DNA-like
20-endo (S-type) conformation.25 Depending on the structural con-
text, these shifts in sugar pucker can destabilize modified helices
compared to 20O-modified ONs, which favor the 30-endo (N-type)
conformation that is characteristic of RNA, leading to stabilizing
effects on RNA/RNA and DNA/RNA duplexes.
This work was supported by the Army Research Office, which
is greatly acknowledged. The authors thank N. Pierre for the
synthesis of the ONs.
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.tetlet.2008.09.078.
References and notes
1. Gissot, A.; Camplo, M.; Grinstaff, M. W.; Barthelemy, P. Org. Biomol. Chem. 2008,
6, 1324–1333.
2. Boutorine, A. S.; Kostina, E. V. Biochimie 1993, 75, 35–41.
3. Boutorine, A. S.; Gus’kova, L. V.; Ivanova, E. M.; Kobetz, N. D.; Zarytova, V. F.;
Ryte, A. S.; Yurchenko, L. V.; Vlassov, V. V. FEBS Lett. 1989, 254, 129–132.
4. Kim, S. J.; Bang, E. K.; Kwon, H. J.; Shim, J. S.; Kim, B. H. ChemBioChem. 2004, 5,
1517–1522.
5. Godeau, G.; Staedel, C.; Barthélémy, P. J. Med. Chem. 2008, 14, 4374–4376.
6. Krützfeldt, J.; Rajewsky, N.; Braich, R.; Rajeev, K. G.; Tuschl, T.; Manoharan, M.;
Stoffel, M. Nature 2005, 438, 685–689.
Secondly, it is noteworthy that, depending on its location, a
20-lipid modification incorporated within the oligonucleotide
sequence can be envisioned without destabilizing the anti-miR/
miR duplex.
7. O’Driscoll, L. Anticancer Res. 2006, 26, 4271–4278.
Interestingly, LON-2 possessing a lipid modified u11 has a
similar Tm as the unconjugated control indicating that the lipid
modification on this position does not destabilize the duplex. This
observation is in agreement with antagomir-122 mismatch
studies, which revealed that a single mismatch at position 11 did
not affect the inhibitory effect on miR-122.9 Accordingly, it is not
surprising that u11 lipidic modification does not affect the Tm. In
contrast, u13 modified oligonucleotide LON-3 decreases the anti-
miR122/miR-122 duplex stability, confirming the fact that
although anti-miR can exhibit high sequence specificity, discrimi-
nation at the single nucleotide level is position-dependent.
It is also interesting to note that while u11 and u19 20-modified
oligonucleotides (LON-2 and LON-4), taken separately, do not
affect the stability of anti-miR-122/miR-122 duplex, oligonucleo-
tide LON-5 featuring simultaneous lipid-modified u19 and u11 leads
to a destabilization of 6 °C. While we do not have any structural
data, one possible explanation is that the hydrophobic parts
attracted themselves introducing a kink in the helix, which gener-
ates steric distortions.
In conclusion, we have synthesized the first example of an
antagomir strand featuring a fatty acid in place of a cholesterol
moiety. Interestingly, this lipid modification is incorporated inter-
nally in the oligonucleotide sequence and not at the 30-end (up to
two modifications within the same strand). Lipid conjugation of
the 20 position was realized via a Staudinger–Vilarrasa reaction.
This straightforward procedure was used instead of a standard
coupling procedure as a key-step to functionalize our building
block with the fatty acid. Melting temperature (Tm) experiments
revealed that the stability of the duplexes depends on the lipid
position and the number of lipid moieties inserted within the
oligonucleotide sequence. For the targeted miRNA (miR-122) lipid
modifications of positions 11 and 19 do not destabilize the
duplexes, whereas the concomitant lipid conjugation on the same
position leads to decreases of 6 °C of the Tm. Such materials
being likely to be of interest for multiple applications ranging
from chemistry to medicine, biological assays are currently in
progress.
8. Shen, J. K.; Yang, X.; Xie, B.; Chen, Y.; Swaim, M.; Hackett, S. F.; Campochiaro, P.
A. Mol. Ther. 2008, 16, 1208–1216.
9. Krützfeld, J.; Kuwajima, S.; Braich, R.; Rajeev, G. K.; Pena, J.; Manoharan, M.;
Stoffel, M. Nucleic Acids Res. 2007, 35, 2885–2892.
10. Esau, C.; Davis, S.; Murray, F. S.; Yu, X. Y.; Pandey, K. S.; Pear, M.; Watts, L.;
Booten, S. L.; Graham, M.; McKay, R.; Subramanian, A.; Propp, S.; Lollo, B. A.;
Freier, S.; Bennett, C. F.; Bhanot, S.; Monia, B. P. Cell Metab. 2006, 3, 87–98.
11. Manoharan, M.; Tivel, K. L.; Cook, P. D. Tetrahedron Lett. 1995, 36, 3651–3654.
12. Tomkins, J. M.; Barnes, K. J.; Blacker, A. J.; Watkins, W. J.; Abell, C. Tetrahedron
Lett. 1997, 38, 691–694.
13. Letsinger, R. L.; Zhang, G.; Sun, D. K.; Ikeuchi, T.; Sarin, P. S. Proc. Natl. Acad. Sci.
U.S.A. 1989, 86, 6553–6556.
14. Shea, R. G.; Marsters, J. C.; Bischofberger, N. Nucleic Acids Res. 1990, 18, 3777.
15. Alemdaroglu, F. E.; Ding, K.; Berger, R.; Herrmann, A. Angew. Chem., Int. Ed.
2006, 45, 4206–4210.
16. Kurz, A.; Bunge, A.; Windeck, A.-K.; Rost, M.; Flasche, W.; Arbuzova, A.;
Strohbach, D.; Müller, S.; Liebscher, J.; Huster, D.; Herrmann, A. Angew. Chem.,
Int. Ed. 2006, 45, 4440–4444.
17. Bunge, A.; Kurz, A.; Windeck, A.-K.; Korte, T.; Flasche, W.; Liebscher, J.;
Herrmann, A.; Huster, D. Langmuir 2007, 23, 4455–4464.
18. Morvan, F.; Porumb, H.; Degols, G.; Lefebvre, I.; Pompon, A.; Sproat, B. S.;
Rayner, B.; Malvy, C.; Lebleu, B.; Imbach, J. L. J Med. Chem. 1993, 36, 280–287.
19. Wagner, E.; Oberhauser, B.; Holzner, A.; Brunar, H.; Issakides, G.; Schaffner, G.;
Cotton, M.; Knollmüller, M.; Noe, C. R. Nucleic Acids Res. 1991, 19, 5965–5971.
20. Prakash, T. P.; Kawasaki, A. M.; Wancewicz, E. V.; Shen, L.; Monia, B. P.; Ross, B.
S.; Bhar, B.; Manoharan, M. J. Med. Chem. 2008, 51, 2766–2776.
21. Bobkov, G. V.; Mikhailov, S. N.; Aerschot, A. V.; Herdewijn, P. Tetrahedron 2008,
64, 6238–6251.
22. Odadzic, D.; Bramsen, J. B.; Smicius, R.; Bus, C.; Kjems, J.; Engels, J. W. Bioorg.
Med. Chem. 2007, 16, 518–529.
23. Freier, S. M.; Altmann, K. H. Nucleic Acids Res. 1997, 25, 4429–4443.
24. Prhavc, M.; Lesnik, E. A.; Mohan, V.; Manoharan, M. Tetrahedron Lett. 2001, 42,
8777–8780.
25. Pham, J. W.; Radhakrishnan, I.; Sontheimer, E. J. Nucleic Acids Res. 2004, 32,
3446–3455.
26. Hendrix, C.; Devreese, B.; Rozenski, J.; van Aerschot, A.; De Bruyn, A.; Van
Beeumen, J.; Herdewijn, P. Nucleic Acids Res. 1995, 23, 51–57.
27. McGee, D. P.; Vaughn-Settle, A.; Vargeese, C.; Zhai, Y. J. Org. Chem. 1996, 61,
781–785.
28. Chapuis, H.; Strazewski, P. Tetrahedron 2006, 62, 12108–12115.
29. Wnuk, S. F.; Chowdhury, S. F.; Garcia, P. I., Jr.; Robins, M. J. J. Org. Chem. 2002,
67, 1816–1819.
30. Verheyde, J. P.; Wagner, D.; Moffatt, J. G. J. Org. Chem. 1971, 36, 250–254.
31. Charafeddine, A.; Dayoub, W.; Chapuis, H.; Strazewski, P. Chem. Eur. J. 2007, 13,
5566–5584.
32. Shalev, D. E.; Chiacchiera, S. M.; Radkowsky, E. M.; Kosower, J. J. Org. Chem.
1996, 61, 1689–1701.