Dihydrochelerythrine and its derivatives: Synthesis and their application as potential G-quadruplex DNA stabilizing agents

Article abstract of DOI:10.1016/j.bmc.2016.04.059

A convenient route was envisaged toward the synthesis of dihydrochelerythrine (DHCHL), 4 by intramolecular Suzuki coupling of 2-bromo-N-(2-bromobenzyl)-naphthalen-1-amine derivative 5 via in situ generated arylborane. This compound was converted to (±)-6-acetonyldihydrochelerythrine (ADC), 3 which was then resolved by chiral prep-HPLC. Efficiency of DHCHL for the stabilization of promoter quadruplex DNA structures and a comparison study with the parent natural alkaloid chelerythrine (CHL), 1 was performed. A thorough investigation was carried out to assess the quadruplex binding affinity by using various biophysical and biochemical studies and the binding mode was explained by using molecular modeling and dynamics studies. Results clearly indicate that DHCHL is a strong G-quadruplex stabilizer with affinity similar to that of the parent alkaloid CHL. Compounds ADC and DHCHL were also screened against different human cancer cell lines. Among the cancer cells, (±)-ADC and its enantiomers showed varied (15-48%) inhibition against human colorectal cell line HCT116 and breast cancer cell line MDA-MB-231 albeit low enantio-specificity in the inhibitory effect; whereas DHCHL showed 30% inhibition against A431 cell line only, suggesting the compounds are indeed cancer tissue specific.

Full text of DOI:10.1016/j.bmc.2016.04.059

Bioorganic & Medicinal Chemistry xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Dihydrochelerythrine and its derivatives: Synthesis and their
application as potential G-quadruplex DNA stabilizing agents
Rajesh Malhotra a,y, Chhanda Rarhi a,b,y, K. V. Diveshkumar c,y, Rajib Barik b, Ruhee D’cunha c, Pranab Dhar b,
Mrinalkanti Kundu b, , Subrata Chattopadhyay b, Subho Roy b, Sourav Basu b, P. I. Pradeepkumar c,
⇑
⇑
,
Saumen Hajra d,
⇑
a Department of Chemistry, Guru Jambheshwar University of Science and Technology, Hisar, Haryana 125001, India
b TCG Lifesciences Pvt. Ltd., BN-7, Salt Lake, Kolkata 700091, India
c Department of Chemistry, Indian Institute of Technology Bombay, Mumbai 400076, India
d Centre of Biomedical Research, SGPGIMS Campus, Lucknow 226014, India
a r t i c l e i n f o
a b s t r a c t
Article history:
A convenient route was envisaged toward the synthesis of dihydrochelerythrine (DHCHL), 4 by
intramolecular Suzuki coupling of 2-bromo-N-(2-bromobenzyl)-naphthalen-1-amine derivative 5 via
in situ generated arylborane. This compound was converted to ( )-6-acetonyldihydrochelerythrine
(ADC), 3 which was then resolved by chiral prep-HPLC. Efficiency of DHCHL for the stabilization of pro-
moter quadruplex DNA structures and a comparison study with the parent natural alkaloid chelerythrine
(CHL), 1 was performed. A thorough investigation was carried out to assess the quadruplex binding affin-
ity by using various biophysical and biochemical studies and the binding mode was explained by using
molecular modeling and dynamics studies. Results clearly indicate that DHCHL is a strong G-quadruplex
stabilizer with affinity similar to that of the parent alkaloid CHL. Compounds ADC and DHCHL were also
screened against different human cancer cell lines. Among the cancer cells, ( )-ADC and its enantiomers
showed varied (15–48%) inhibition against human colorectal cell line HCT116 and breast cancer cell line
MDA-MB-231 albeit low enantio-specificity in the inhibitory effect; whereas DHCHL showed 30% inhibi-
tion against A431 cell line only, suggesting the compounds are indeed cancer tissue specific.
Ó 2016 Elsevier Ltd. All rights reserved.
Received 20 January 2016
Revised 25 April 2016
Accepted 28 April 2016
Available online xxxx
Keywords:
Dihydrochelerythrine
6-Acetonyldihydrochelerythrine
Suzuki coupling
G-quadruplex
Anti-cancer
1. Introduction
duplex DNAs.5 Recently, it was reported that CHL stabilizes c-MYC
and c-KIT quadruplex DNAs as well.6 Overexpression of c-MYC and
Benzo[c]phenanthridines are fused tetracyclic skeletons, which
constitute a small class of isoquinoline alkaloids. These are widely
distributed in the higher plant families and used as a traditional
medicine for the treatment of fever, pain, diarrhea and cancer.1
Among these alkaloids, CHL and sanguinarine 2 are the most com-
mon and have received extensive attention due to their important
biological properties (Fig. 1). Sanguinarine shows the inhibition of
lipoxygenase and mediates chemical defence against virus and
microorganisms in plants.2 CHL is known to inhibit protein kinase
C and DNA topoisomerase I.3 Since, stabilization of G-quadruplex
DNAs in the genome has become an attractive strategy for anti-
cancer drug development,4 CHL was also reported to bind selec-
tively with human telomeric DNA and RNA G-quadruplexes over
c-KIT genes has been associated with numerous cancers.7
6-Substituted dihydro-derivatives of CHL are also known to
exhibit important biological activities.8 Among these, ADC is a nat-
ural product (Fig. 1). Significant anti-HIV activity of ( )-ADC (iso-
lated from Argemone Mexicana) in H9 lymphocytes with EC50 of
1.77 l
g/mL is reported by Chang et al.9 During our investigation,
Ferreira et al. reported ADC (isolated from methanol extract of Zan-
thoxylumcapense) as a potent inducer of apoptosis in HCT116 and
SW620 colon cancers cells.10 Most of the biological studies were
done with isolated ADC from natural source. The aim of the present
investigation is the synthesis of DHCHL and ADC via a convenient
route, to investigate the G-quadruplex binding activity and anti-
cancer studies.
Several synthetic routes to benzo[c]phenanthridine alkaloids
have earlier been reported and most of the syntheses utilize linear
approaches.11 Recently, some elegant convergent routes are
reported based on (i) intramolecular Suzuki coupling of in situ
generated imines of 2-bromo-1-naphthyl amines and 2-formyl
⇑
Corresponding authors.
E-mail addresses: mrinal.kundu@tcgls.com (M. Kundu), pradeep@chem.iitb.ac.in
(P.I. Pradeepkumar), saumen.hajra@cbmr.res.in (S. Hajra).
y
R.M., C.R. and K.V.D. equally contributed to this work.
http://dx.doi.org/10.1016/j.bmc.2016.04.059
0968-0896/Ó 2016 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

2
R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
O
O
O
O
O
O
N
N
O
N
MeO
MeO
RO
OMe
OMe
OR
1: R = Me; chelerythrine (CHL)
2: R = -CH2-; sanguinarine
4
3
6-actonyl dihydrochelerythrine (ADC)
dihydrochelerythrine (DHCHL)
Figure 1.
arylboronic acid;12 (ii) palladium catalyzed ring-opening coupling
of azabicyclic alkenes with 2-iodobenzoates, followed by tandem
cyclization;13 (iii) nickel-catalyzed annulation of o-haloben-
zaldimine with alkyne;14 (iv) base mediated addition-annulation
of electron-rich benzaldhyde and o-methyl benzonitriles;15 (v)
tert-BuOK mediated intramolecular biaryl coupling;16 and (vi)
aryne aza-Diels–Alder reaction.17 Herein, we report an efficient
synthesis of DHCHL followed by ( )-ADC utilizing intramolecular
Suzuki coupling reaction of dibromo amine 5 via in situ generated
organo-borane and their application as G-quadruplex stabilizing
ligands. Also, we report the anticancer activities of these com-
pounds in different cell lines.
O
O
O
O
N
MeO
N
MeO
OMe
O
OMe
CHL
3
1
ADC
O
O
O
O
Br
6
NH2
Br
Br
Br
N
Br
2. Results and discussion
OMe
OMe
OMe
2.1. Synthesis of DHCHL, CHL and ADC
5
7
OMe
Retrosynthetic analysis reveals that both ADC and CHL can be
synthesized from DHCHL, which might be obtained by intramolec-
ular Ullmann coupling of compound 5 or Suzuki coupling via
in situ generated boronic acid, similar to Geen’s approach12
Scheme 1. Retrosynthesis of DHCHL, CHL and ADC.
Br
Me
(Scheme 1). In turn, compound
5 could be obtained from
MeO
MeO
R
MeO
MeO
MeO
MeO
Br
a
2-bromo-1-naphthyl-amine and benzyl bromide 7. 2,3-
6
c
Dimethoxy-6-bromobenzyl bromide 7 was prepared from 1,2-
dimethoxy benzene 8 in three steps (Scheme 2). Regioselective
methylation of 1,2-dimethoxy benzene 8 via ortho-lithiation with
n-BuLi in diethylether produced 1,2-dimethoxy-3-methyl benzene
9 in very good yield. Successive regioselective aromatic ring
bromination of compound 9 and benzylic bromination gave 2,3-
dimethoxy-6-bromobenzyl bromide 7 in good yield.
73%
83%
8
7
9: R = H
80%
b
10: R = Br
Scheme 2. Reagents & conditions: (a) n-BuLi, Me2SO4, Et2O, 40 °C, 6 h; (b) NBS,
CH3CN, rt, 24 h; (c) NBS, AIBN, CH3CO2Et, reflux, 16 h.
2-Bromo-1-naphthylamine 6 was prepared from tetralone 11 in
five steps (Scheme 3).12 It was achieved with bromination of tetra-
lone 11 with bromine in CHCl3 at rt and gave 2,2-dibromo tetra-
lone 12. Reaction of dibromide 12 with DBU in warm acetonitrile
afforded the 2-bromo-1-naphthol 13. The bromo-naphthol 13 can
be transformed to 2-bromo-1-naphthyl amine 6 via Smiles rear-
rangement.18 For this purpose, ether 14 was prepared from
bromonaphthol 13 on alkylation with 2-bromo-2-methyl propana-
mide and sodium hydroxide in DMPU and gave ether 14 in 81%
yields. It underwent smooth Smiles rearrangement on heating with
NaH in DMF–DMPU (4:1) at 100 °C and gave N-acyl-2-bromo-1-
naphthyl amine 15 in very good yield. Alkaline hydrolysis of
compound 15 on prolong heating in 80% sodium hydroxide in
aqueous methanol yielded 6-bromo-2,3-methylenedioxy-5-
naphthyl amine 6.
N-Benzylation of bromonaphthyl amine 6 with 6-bromo-2,3-
dimetnoxybenzyl bromide 7 in presence of NaH in DMF gave
desired compound 16 (Scheme 4). Weaker bases like DIPEA and
K2CO3 with or without TBAI showed traces of product. Attempt
was made for the Ullman coupling of the dibromo amine 16 and
its N-methyl derivative 5. But, both did not give any desired Ull-
man product under different reaction conditions.19 Then
dibromo-substrate 5 was subjected to Pd-catalyzed cyclization in
presence of bispinacolatodiborane, where it was presumed that
one of the arene bromides would be transformed to arylborane
OH
O
O
Br
Br
Br
O
O
O
O
O
O
a
b
70%
71%
12
13
11
c
81%
O
O
CONH2
O
NH2
HN
OH
Br
Br
Br
O
O
O
d
81%
e
O
O
44%
6
15
14
Scheme 3. Reagents & conditions: (a) Br2, CHCl3, rt; (b) DBU, CH3CN, 45 °C, 30 min;
(c) Me2CBrCONH2, NaOH, DMPU, rt, 5 h; (d) NaH, DMF–DMPU (4:1), 100 °C, 2 h; (e)
80% aq NaOH, MeOH, reflux, 2 d.
and subsequently undergoes intramolecular Suzuki coupling. We
delighted to report that it provided desired DHCHL in 79% of yield.
DHCHL on refluxing with iodine and sodium acetate in ethanol
afforded CHL. Acetonylation of CHL on refluxing in aqueous ace-
tone in the presence of sodium carbonate accomplished the syn-
thesis of ADC. The racemic compound ADC was then resolved
with >99% ee by chiral prep-HPLC using Chiralpak AD-H column.
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
3
O
O
O
O
Br
Br
a
b
NMe
OMe
Br
NH
Br
6
+ 7
81%
62%
OMe
OMe
79%
OMe
16
5
c
O
O
O
O
d
N
N
MeO
Me
1 (CHL)
MeO
Me
OMe
OMe
4 (DHCHL)
e
60% for two steps
O
O
N
MeO
Me
OMe
O
3 (ADC)
Me
Scheme 4. Reagents & conditions: (a) NaH, DMF, 0 °C to rt, 5 h; (b) NaH, MeI, DMF,
0 °C to rt, 5 h; (c) Pd(dppf)2Cl2, BPDB, KOAc, DMSO, 110 °C, 16 h; (d) I2, AcONa,
EtOH, 2 h, reflux; (e) CH3COCH3, Na2CO3, H2O, reflux.
2.2. Biophysical studies with promoter quadruplex DNAs
2.2.1. Circular dichroism studies (CD spectroscopy)
CD spectroscopy can be wisely used to assess the efficiency of
the ligands to induce a particular topology of quadruplex DNAs.
G-quadruplex structures exhibits various topologies and those
can be well analyzed by using CD spectroscopy and can be con-
firmed with other spectroscopic techniques like NMR.20 CD titra-
tion spectra for the natural product CHL with telomeric DNA
were reported to show an induction of hybrid topologies under
K+ conditions.5 We have performed CD titration experiments with
promoter c-MYC and c-KIT1 quadruplex DNAs which are reported
to adopt parallel topologies (Fig. 2).
Figure 2. CD titration spectra of promoter quadruplex DNAs (12.5
Tris–HCl, pH 7.2) with compound DHCHL. (a) c-MYC DNA; (b) c-KIT1 DNA.
l
M in 50 mM
presence and absence of 5 equiv of ligands. For c-MYC DNA, melt-
ing experiment was performed with 1 mM KCl and yielded a melt-
ing temperature of 57 °C (Fig. 3). As expected, there was a
significant increase in the melting temperature with 5 equiv of
For the c-MYC DNA strong positive peak around 260 nm and a
negative peak around 240 nm indicating preformed parallel topol-
ogy of the quadruplex DNA was observed even in the absence of
any added monovalent cations (Fig. 2). Upon titration with DHCHL
as well as with CHL ellipticity for both the peaks were significantly
increased and saturation was attained after the addition of 5 equiv
of ligands (Figs. 2a and S1, Supporting information). Intense
increase in the ellipticity clearly indicates the strong induction
and stabilization of the existing preformed parallel topology for
c-MYC quadruplex DNAs. Similarly, CD spectra of c-KIT1 quadruplex
DNA with ligands showed moderate induction of the preformed
parallel topology (Figs. 2b and S1, Supporting information). CD
spectra of ADC with c-MYC DNA showed weak induction of the
pre-folded parallel topology of c-MYC DNA, whereas there was no
further induction of parallel topology for c-KIT1 DNA upon titration
with ADC (Fig. S1, Supporting information).
ligands,
D
Tm ꢀ 24 °C for DHCHL and
D
Tm ꢀ 19 °C for CHL, respec-
tively (Fig. 3a and Table 1). Similarly, melting experiment for c-
KIT1 quadruplex DNA was performed with 10 mM KCl giving a
melting temperature of 46 °C. Addition of 5 equiv of ligands
resulted in the increase of melting temperature of c-KIT1 DNA,
D
Tm ꢀ 17 °C for DHCHL and
D
Tm ꢀ 24 °C for CHL, respectively
(Fig. 3b and Table 1). For both the promoter quadruplex DNAs, very
high thermal stabilization was obtained with both CHL and
DHCHL. Thermal stabilization of DHCHL was slightly greater than
the CHL with c-MYC quadruplex DNA, whereas for c-KIT1 DNA it
was found to be in the reverse order. As expected, ligands were
not able to show any significant increase in the melting tempera-
ture of duplex DNA (Fig. S2, Supporting information and Table 1).
Moreover, we have performed CD melting experiment for the
ligand ADC with telomeric as well as with c-MYC quadruplex
DNA (Fig. S2, Supporting information). Surprisingly, there was no
considerable increase in the melting temperature for ADC
2.2.2. CD melting studies
with both the quadruplex DNAs (
Tm ꢀ 2.6 °C for c-MYC DNA).
D
Tm ꢀ 1 °C for telomeric and
Ligand induced thermal stabilization was studied by using CD
spectroscopy with c-MYC and c-KIT1 promoter quadruplex DNAs.
Salt and buffer conditions were adjusted according to the reported
procedure to get a melting temperature in the range of 40–60 °C.21
Melting experiments for the promoter quadruplex DNAs were
conducted by measuring the molar ellipticity at 263 nm in the
D
2.2.3. UV–Visible absorption spectroscopic studies
Determination of binding constants of the ligands with c-MYC
quadruplex DNA carried out by using UV–Visible absorption spec-
troscopy. Concentration dependent increase or decrease in the
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

4
R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
Figure 4. UV–Visible titration spectra and linear plots for DHCHL and c-MYC
quadruplex DNA. Pre-annealed DNA (100 mM KCl and 10 mM lithium cacodylate
buffer, pH 7.2) was titrated with DHCHL (30 in similar salt and buffer
conditions) and the data was fitted using half reciprocal equation. (a) UV absorption
spectrum; (b) linear fit. Binding constant values are reported as an average from 3
independent experiments.
Figure 3. CD melting curves for promoter quadruplex DNAs (10 lM in 10 mM
lithium cacodylate buffer, pH 7.2) with ligands. (a) c-MYC DNA (1 mM KCl and
99 mM LiCl); (b) c-KIT1 DNA (10 mM KCl, 90 mM LiCl).
l
M
ligand absorbance can be used to derive the binding constant for
the ligand–quadruplex interaction.22 Titration of pre-annealed c-
MYC quadruplex DNA with ligands under identical salt and buffer
conditions resulted in a decrease in the absorption intensity of
the ligands (Figs. 4 and S3, Supporting information). Hypochromic-
ity together with a red shift of 10 nm during titration is an indica-
tive of strong interaction of both the ligands with c-MYC
quadruplex DNA. Linear fit of the plot shown in Fig. 4b yielded
binding constant values, K = (5.5 0.7) ꢁ 105 Mꢂ1 for DHCHL and
K = (7.35 0) ꢁ 105 Mꢂ1 for CHL (Fig. 4). Binding constant values
for the ligands with c-MYC quadruplex DNA were similar to those
reported for the interaction between CHL with telomeric and c-
MYC quadruplex DNAs.6
2.2.4. Taq DNA polymerase stop assay
Efficiency of the ligands for the stabilization of promoter
quadruplex DNAs were further assessed with the aid of Taq DNA
polymerase stop assay by using c-MYC DNA as an example.
Concentration of the ligands needed for the formation of 50% stop
product is the IC50 value for the ligand. Extension reaction was
performed at 55 °C with increasing concentration of the ligands
up to 80
of stop products was increased in a concentration dependant
manner with the ligands yielding an IC50 value ꢀ5.8 M for DHCHL
and ꢀ6.6 M for CHL, respectively (Figs. 5b and S4, Supporting
information).
l
M (Figs. 5a and S4, Supporting information).23 Formation
l
l
Table 1
Thermal stabilization of ligands with promoter quadruplex and duplex DNAs
measured by CD melting experiments
Comparable IC50 values observed for both the ligands are in
good agreement with the results obtained from the biophysical
studies revealing their identical binding affinities. Control experi-
ments were performed under identical reaction conditions and
ligand concentrations using template containing mutated c-MYC
DNA that cannot form quadruplex structure. As expected, there
was no stop product with the mutated c-MYC DNA even after
Ligands
D
Tam (°C)
c-MYC DNA
c-KIT1 DNA
Duplex DNA
DHCHL
CHL
24.0 0.2
19.6 0.9
17.6 0.6
24.3 0.5
ꢂ1 0.2
0.1 0.1
D
Tam denotes the difference in melting temperature
[
D
Tm = Tm (DNA+5 molar
equivalent ligand) ꢂ Tm (DNA)]. Melting experiments were carried out with a DNA
incubating with 80 lM ligand concentrations (Figs. 5a and S4,
concentration of 10 M in 10 mM lithium cacodylate buffer, pH 7.2. Tm values in the
l
Supporting information). Absence of stop products with mutated
c-MYC DNA confirms that the formation of stop products in
the polymerase extension reaction is due to ligand induced
quadruplex stabilization.
absence of ligands are 57.1 0.4 °C (c-MYC DNA in 1 mM KCl and 99 mM LiCl);
46 0.1 °C (c-KIT1 DNA in 10 mM KCl and LiCl 90 mM) and 63.5 0.4 °C (Duplex
DNA in 10 mM KCl and LiCl 90 mM).
DTm values are reported as the average values
with standard deviations from 3 independent experiments.
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
5
throughout the simulation, indicating a stabilizing effect upon
ligand binding (Figs. S7–S9, Supporting information). The per-resi-
due RMSF values (Fig. S10, Supporting information) show peaks for
loops and flanking nucleotides and troughs for guanines in the G-
quartet, indicating that the loops and flanking residues were not
as stable as the G-quartet over the course of the simulations.
Since the backbone RMSD of loops and flanking nucleotides in
the G-quadruplex DNA fluctuated throughout the MD simulations
(Fig. S7, Supporting information), clustering was carried out to
probe the major conformations involved. The largest cluster con-
tained 36.4% of the frames (Fig. 6), the second largest contained
26.5% (Fig. S11, Supporting information), implying that the com-
plex fluctuated mainly between these two conformations during
the course of the MD simulation. Cluster representatives 1 and 2
differ mainly in the nucleotides with which the ligands interact
(Figs. 6 and S11, Supporting information). Both showed p-stacking
interactions of the ligands with the top and bottom faces of the
quadruplex.
The best representative structure of cluster-1 had the top ligand
showing p-stacking interactions with nucleotide dG4 and dG8, and
the bottom ligand’s naphthalene-type ring stacking with dG10
(Fig. 6). Similarly, the best representative structure of cluster-2
had the top ligand stacking with both dG8 and dG13, while the
bottom ligand stacked with dG10 via the benzene ring, and with
dG15 through its naphthalene ring (Fig. S11, Supporting informa-
tion). All evidence suggests that both ligands moved over the top
and bottom surface of the quadruplex during the timescale of the
MD simulation (Figs. S12 and S13, Supporting information).
2.3. Biological activity
2.3.1. Anti-cancer activity
Human cancer cell lines from different tissue origin namely,
A431 (human epidermoid cancer), HCT116 (human colorectal can-
cer), MDA-MB-231 (human breast cancer), HeLa (human cervical
cancer), A549 (human lung cancer) and PC-3 (human prostate can-
cer) [no inhibition in HeLa, A549 and PC-3; data not shown] were
used to assess the anticancer potential of the compounds DHCHL,
( )-ADC and its enantiomers. Among the cancer cells, HCT116
showed significant sensitivity against the test compounds ( )-
ADC and its enantiomers. This is in line with the earlier report10
where the compounds showed significant inhibition against the
human colorectal cell lines HCT116 and SW620. However, the
observed extent of inhibition (Table 2) was less when compared
to the earlier report10 and it might be due to the different source
of the compound; synthetic (in our case) vis-a-vis plant extract.
Interestingly, ADC also showed 20% inhibition in the MTT assay
Figure 5. Denaturing PAGE (15%, 7 M urea) and plots of stop products versus ligand
concentration for the Taq DNA polymerase stop assay in the presence of the c-MYC
and mutated c-MYC DNAs. (a) Denaturing PAGE for the ligand DHCHL (0–80
with the c-MYC and the mutated c-MYC DNA templates; (b) Plot of Taq DNA
polymerase stop products versus DHCHL concentration (0–80 M). Primer exten-
lM)
l
sion reaction was carried out at 55 °C. Conditions: 100 nM template, 50 nM primer,
0.2 mM dNTPs and 0.5 U of Taq polymerase in the enzyme buffer (50 mM Tris,
0.5 mM DTT, 0.1 mM EDTA, 5 mM MgCl2, 5 mM KCl). P denotes primer, S denotes
stop product and F denotes full length product. Normalized percentage of stop
products in each lane was plotted against concentration of ligand. Each data points
represent the average from 2 independent experiments with maximum error 64%.
2.2.5. Molecular modeling and dynamics studies
To understand the binding modes and interactions of DHCHL
with the c-MYC G-quadruplex DNA, molecular docking and dynam-
ics (MD) simulations were carried out. The energy optimized struc-
ture of ligand (B3LYP/6-311+G(d,p) (Fig. S5, Supporting
information) was docked with the energy-minimized structure of
c-MYC (PDB entry: 2L7V) using AutoDock 4.2. The results showed
that DHCHL docked on the G-quartet in the 50 as well as the 30-
end of the DNA (2:1, DHCHL:G-quadruplex), which is in agreement
with the binding mode of CHL (Fig. S6, Supporting information).5
with human breast cancer cell line MDA-MB-231 at 15 lM, while
it did not show any inhibitory effect against the proliferation of
the other cancer cell lines. Moreover, the compound exhibited
low level of enantiospecificity in the observed inhibition against
the proliferation of the cancer cells. (+)-ADC inhibited the prolifer-
ation of HCT116 by 47.84% at 15 lM whereas, the other enan-
tiomer (ꢂ)-ADC and the racemic compound produced 36.88% and
28.73% inhibition, respectively, at the same tested concentrations.
Similar pattern was observed in case of MDA-MB-231 cell line
although the extent of inhibition was less. Surprisingly, compound
DHCHL did not show any inhibition against HCT116 & MDA-MB-
231 cell lines, though there was moderate inhibitory activity
MD simulations (1 ls) were carried out based on the docking
results. The binding free energies were estimated over the last
100 ns of the trajectory using the MMPBSA.py module in
AmberTools12 (Table S1, Supporting information). The free energy
against A431 at 20 lM, suggesting this compound is specific to epi-
of binding (
D
G) for the 50-ligand was ꢂ20.43 4.62 kcal molꢂ1 and
dermoid cancer tissues. The anticancer drug doxorubicin, used as
positive control, and CHL (commercial source, as this compound
could not be isolated in pure form in our hand due to significant
chemical instability as observed during synthesis) both showed
consistent inhibition of more than 90% in all cell lines at a concen-
for the bottom ligand was ꢂ16.81 5.67 kcal molꢂ1, indicating the
binding was energetically more favorable for the top ligand than
the bottom one. The binding free energy for both the ligands was
found to be ꢂ44.87 7.63 kcal molꢂ1. The RMSD values and Hoog-
steen H-bond occupancies for the G-quartet remained stable
tration of 20 lM.
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

6
R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
Figure 6. The best representative structure of the cluster-1 of DHCHL with the c-MYC G-quadruplex over a 1 ls MD simulations. (a) Representative figure showing p-stacking
distances; (b) Top view of DHCHL stacking with the 50 quartet, stacking with residues dG4 and dG8; and (c) Top view of DHCHL stacking with the 30 quartet, stacking with
residues dG6 and dG10. Ligands are shown in pink. DNA is shown in green. Distances are in Å. Figures are rendered using PyMOL.
cell proliferation. ( )-ADC and its enantiomers showed significant
inhibition of the proliferation of HCT 116 cells in the MTT assay
which is in line with the earlier observation of the compound’s
(extracted from natural sources) effect on the colon cancer cells;
whereas DHCHL showed moderate inhibition against A431 cell
line. Importantly, no sensitivity towards the compound by other
cell lines raises the possibility of any colon and skin cell specific
effect of ( )-ADC (& its enantiomers] and DHCHL, respectively.
Additionally, lack of inhibitory effect on the bacterial cells also
rules out detergent or poison-like non-specific cell killing by the
compounds [data not shown]. Overall, our results show that
DHCHL and its derivatives can be harnessed to develop quadruplex
mediated anticancer agents.
Table 2
Effect of DHCHL and ( )-ADC and its enantiomers (+)-ADC, (ꢂ)-ADC against the
proliferation of different cancer cell lines
Compound
Test
conc.
(lM)
% inhibition in % inhibition in
HCT116 MDA-MB-231
% inhibition in
A431
( )-ADC
(+)-ADC
(ꢂ)-ADC
DHCHL
CHLa
15.0
15.0
15.0
20.0
20.0
28.73 0.43*** 16.13 1.51*
47.84 0.40*** 24.30 0.42**
36.88 0.19*** 20.81 1.49**
NA
NA
NA
NA
8.65 0.48**
30.39 6.42*
100.0 0.08***
98.07 0.08***
100.0 0.90*** 100.0 0.03***
97.98 0.29*** 92.68 0.44***
Doxorubicinb 20.0
The results are averages SEM of three independent experiments; NA: not active.
a
Commercial, purchased from Sigma–Aldrich.
Positive control.
p <0.05.
p <0.01.
b
*
4. Experimental section
4.1. Chemistry
**
***
p <0.001 (vs vehicle control).
All reactions were conducted using oven-dried glassware under
an atmosphere of argon (Ar) or nitrogen (N2). Commercial grade
reagents were used without further purification. Solvents were
dried and distilled following usual protocols. Column chromatog-
raphy was carried out using silica gel (100–200 mesh). TLC was
performed on aluminum-backed plates coated with Silica gel 60
with F254 indicator. The 1H NMR spectra were recorded with a
400 MHz spectrometer and 13C NMR spectra were recorded with
a 100 MHz using CDCl3 and DMSO-d6. 1H NMR chemical shifts
are expressed in parts per million (d) relative to CDCl3 (d = 7.26)
and DMSO-d6 (d = 2.49); 13C NMR chemical shifts are expressed
in parts per million (d) relative to the CDCl3 resonance (d = 77.0)
and DMSO-d6 (d = 39.7). High resolution mass spectra (HRMS)
were measured with a QTOF I (quadrupole–hexapole TOF) mass
spectrometer with an orthogonal Z-spray–electro-spray interface.
3. Conclusions
This study has shown that dibromo amine
5 undergo
intramolecular Suzuki coupling via in situ generated aryl borane
to provide DHCHL followed by oxidation gave CHL, which on
acetonylation afforded the ADC. Biophysical and biochemical stud-
ies of DHCHL with promoter quadruplex DNAs (c-MYC and c-KIT1)
showed the similar stabilization effect as compared to the parent
alkaloid CHL. Moreover, the binding mode of interaction for the
DHCHL and c-MYC quadruplex DNA was thoroughly investigated
by using molecular dynamics and modeling studies. It was found
to be well stacked using dual stacking mode by exploiting both
the top and bottom quartets of the c-MYC quadruplex DNA.
DHCHL, ( )-ADC and its enantiomers were tested across cancer cell
lines from different tissue origins for their inhibitory activities on
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
7
4.1.1. 1,2-Dimethoxy-3-methyl-benzene 9
duct which was purified by silica gel column chromatography to
get pure compound 6-bromo-naphtho[2,3-d][1,3]dioxol-5-ol 13
(2.7 g, 71%). 1H NMR (DMSO-d6, 400 MHz) d 9.60 (s, 1H), 7.50 (s,
1H), 7.36 (d, J = 8.7 Hz, 1H), 7.26 (s, 1H), 7.19 (d, J = 8.7 Hz, 1H),
6.13 (s, 2H); 13C NMR (DMSO-d6, 100 MHz): d 148.5, 147.6,
147.4, 130.5, 127.8, 122.4, 120.0, 103.9, 103.7, 101.3, 98.4; LC–
MS (ESI): 267.0 [M+H]+.
To a solution of 1,2-dimethoxy-benzene 8 (15 g, 108.6 mmol) in
dry ether (340 ml) was added n-BuLi (68 ml, 2.4 M, 163 mmol) at
0 °C. Reaction mixture was heated at reflux for 6 h; cool to room
temperature, dimethyl sulfate (63 ml, 652 mmol) was added
slowly to the reaction mixture and heated at reflux for 16 h. Reac-
tion mixture was diluted with ethyl acetate and washed with sat-
urated aq NH4Cl, water, brine, dried over Na2SO4 and evaporated to
get the crude which was purified by silica gel column chromatog-
raphy and gave the pure compound 8 as a pale yellow liquid
(13.7 g, 83%). 1H NMR (DMSO-d6, 400 MHz) d 6.93 (t, J = 7.8 Hz,
1H), 6.84 (d, J = 7.9 Hz, 1H), 6.74 (d, J = 7.4 Hz, 1H), 3.77 (s, 3H),
3.68 (s, 3H), 2.18 (s, 3H); 13C NMR (DMSO-d6, 100 MHz): d 152.2,
146.7, 130.9, 123.5, 122.3, 110.4, 59.2, 55.3, 15.3; GC-MS (EI):
152 m/z [M+].
4.1.6. 2-(6-Bromo-naphtho[2,3-d][1,3]dioxol-5-yloxy)-2-
methyl-propionamide 14
Sodium hydroxide (2.2 g, 56.1 mmol, powder) was added to a
solution of the 6-bromo-naphtho[2,3-d][1,3]dioxol-5-ol 13 (2.5 g,
9.36 mmol) in DMPU (22 ml) at rt and the resulting mixture was
stirred for 15 min. 2-Bromo-2-methylpropanamide (4.6 g,
28.08 mmol) was added and the mixture was stirred vigorously
for 5 h at rt. Water was added to the reaction mixture and acidified
with 5 M HCl to adjust the pH to neutral. Resulting suspension was
added to water and allowed to stand overnight. The solid was fil-
tered, washed with water and dried under vacuum at 60 °C to give
pure product as an off-white solid (2.7 g, 81%). 1H NMR (CDCl3,
400 MHz) d 7.44–7.40 (m, 2H), 7.30 (d, J = 8.6 Hz, 1H), 7.15 (br s,
1H), 7.06 (s, 1H), 6.05 (s, 2H), 1.60 (s, 6H); 13C NMR (DMSO-d6,
100 MHz): d 175.8, 148.2, 147.6, 130.7, 128.2, 128.1, 124.7, 113.7,
103.7, 101.6, 99.3, 84.7, 25.2; LC–MS (ESI): 352.2 [M+H]+.
4.1.2. 1-Bromo-3,4-dimethoxy-2-methyl-benzene 10
To a solution of 1,2-dimethoxy-3-methyl-benzene 9 (55 g,
361.8 mmol) in ACN (1.8 L) was added NBS (65.3 g, 369 mmol) por-
tion wise and the mixture was stirred at rt for 24 h under nitrogen
atmosphere. Reaction mixture was diluted with ethyl acetate and
washed with sat. aq NaHCO3, water and dried over Na2SO4. Con-
centration of the solvent and recrystallization from MeOH gave
the pure product as white solid (67 g, 80%). 1H NMR (CDCl3,
400 MHz) d 7.22 (d, J = 8.8 Hz, 1H), 6.64 (d, J = 8.8 Hz, 1H), 3.82
(s, 3H), 3.76 (s, 3H), 2.32 (s, 3H). 13C NMR (CDCl3, 100 MHz): d
152.1, 148.0, 132.2, 127.2, 116.0, 110.9, 60.3, 55.8, 16.0; GC-MS:
230, 230 m/z [M+].
4.1.7. N-(6-Bromo-naphtho[2,3-d][1,3]dioxol-5-yl)-2-hydroxy-
2-methyl-propionamide 15
Sodium hydride (0.422 g, 10.73 mmol) was added to a solution
of the 2-(6-bromo-naphtho[2,3-d][1,3]dioxol-5-yloxy)-2-methyl-
propionamide 14 (3.1 g, 8.80 mmol) in dry DMF (60 ml) and DMPU
(15 ml). Resulting mixture was stirred at 100 °C for 2 h. The solu-
tion was then poured into water and extracted with ethyl acetate.
Organic layer was washed with water, dried over Na2SO4, and con-
centrated. Crude obtained was purified by silica gel column chro-
matography to get pure compound N-(6-bromo-naphtho[2,3-d]
[1,3]dioxol-5-yl)-2-hydroxy-2-methyl-propionamide 15 as a white
solid (2.6 g, 83%). 1H NMR (DMSO-d6, 400 MHz) d 9.60 (s, 1H), 7.63
(d, J = 8.7 Hz, 1H), 7.54 (d, J = 8.7 Hz, 1H), 7.37 (s, 1H), 7.17 (s, 1H),
6.15 (s, 2H), 5.71 (s, 1H), 1.43 (s, 6H). 13C NMR (DMSO-d6,
100 MHz): d 175.8, 148.4, 147.6, 132.1, 129.8, 129.4, 127.5, 127.3,
118.9, 103.6, 101.5, 100.0, 72.4, 27.6; LC–MS (ESI): 354.0 [M+H]+.
4.1.3. 1-Bromo-2-bromomethyl-3,4-dimethoxy-benzene 7
A solution of 1-bromo-3,4-dimethoxy-2-methyl-benzene 10
(4.8 g, 20.86 mmol), NBS (3.7 g, 20.89 mmol) and AIBN (680 mg)
in ethyl acetate (265 ml) was heated overnight at reflux. After fil-
tration and evaporation of the solvent, the residue was dissolved
in CH2Cl2, washed with sat. aq NaHCO3, water, dried over Na2SO4,
and evaporated in vacuum to afford white solid (4.7 g, 73.4%)
which was pure enough for further use. 1H NMR (CDCl3,
400 MHz) d 7.26 (d, J = 9.4 Hz, 1H), 6.76 (d, J = 8.8 Hz, 1H), 4.69
(s, 2H), 3.96 (s, 3H), 3.84 (s, 3H); 13C NMR (CDCl3, 100 MHz): d
152.2, 148.6, 131.5, 127.9, 115.2, 113.8, 61.0, 55.9, 28.0; GC-MS
(EI) 310 m/z [M+].
4.1.4. 6,6-Dibromo-7,8-dihydro-6H-naphtho[2,3-d][1,3]dioxol-
5-one 12
4.1.8. 6-Bromo-naphtho[2,3-d][1,3]dioxol-5-ylamine 6
Sodium hydroxide (21.2 g, 530.6 mmol) in H2O (52 ml) was
added to a solution of the N-(6-bromo-naphtho[2,3-d][1,3]dioxol-
5-yl)-2-hydroxy-2-methyl-propionamide 15 (2.6 g, 6.63 mmol) in
methanol (26 ml), and the resulting mixture was refluxed for
2 days. After cooling, water and ethyl acetate were added. The
phases were separated and the aqueous phase was extracted with
ethyl acetate. The combined organic layer was washed with water,
dried over Na2SO4, and concentrated. Crude obtained was purified
by silica gel column chromatography to get pure compound 6-
bromo-naphtho[2,3-d][1,3]dioxol-5-ylamine 6 as a white solid
(0.78 g, 44%). 1H NMR (DMSO-d6, 400 MHz) d 7.62 (s, 1H), 7.26
(d, J = 8.6 Hz, 1H), 7.18 (s, 1H), 6.91 (d, J = 8.7 Hz, 1H), 6.10 (s,
2H), 5.61 (s, 2H)0; 13C NMR (DMSO-d6, 100 MHz): d 147.1, 146.9,
140.3, 130.1, 127.9, 119.2, 116.5, 103.9, 101.1, 100.9, 99.4; LC–
MS (ESI): 265.9 [M+H]+.
A solution of bromine (2.1 ml, 43.1 mmol) in CHCl3 (10 ml) was
added drop wise to a stirred solution of 7,8-dihydro-6H-naphtho
[2,3-d][1,3]dioxol-5-one 11 (3.9 g, 20.5 mmol) in CHCl3 (25 ml).
The resulting mixture was stirred at ambient temperature over-
night. Reaction mixture was quenched with water and extracted
with ethyl acetate, dried over Na2SO4 and concentrated in vacuum
to afford crude compound 6,6-dibromo-7,8-dihydro-6H naphtho
[2,3-d][1,3]dioxol-5-one 12 as a yellow liquid (5 g, 70%), which
was used in the following step without further purification. 1H
NMR (CDCl3, 400 MHz) d 7.52 (s, 1H), 6.63 (s, 1H), 6.02 (s, 2H),
3.00 (s, 4H); 13C NMR (CDCl3, 100 MHz): d 182.9, 153.2, 147.7,
139.4, 121.6, 108.2, 107.6, 102.0, 67.0, 46.0, 29.5; LC–MS (ESI):
348.8 [M+H]+, 366 [M+NH4]+.
4.1.5. Bromo-naphtho[2,3-d][1,3]dioxol-5-ol 13
6,6-Dibromo-7,8-dihydro-6H-naphtho[2,3-d][1,3]dioxol-5-one
12 (5 g, 14.36 mmol) was stirred in acetonitrile (90 ml) at 40 °C for
15 min. DBU (3.2 ml, 21.55 mmol) was added and the resulting
solution was stirred at 40–45 °C for 20 min. After cooling to room
temperature, 1 M HCl was added. The reaction mass was extracted
with DCM and combined organic phase was washed with water,
dried over Na2SO4 and evaporated in vacuum to give the crude pro-
4.1.9. 6-bromo-N-(6-bromo-2,3-dimethoxybenzyl)naphtho[2,3-
d][1,3]dioxol-5-amine 16
Sodium hydride (0.164 g, 3.75 mmol) was added to
a
solution of 6-bromo-naphtho[2,3-d][1,3]dioxol-5-ylamine 6 (0.5 g,
1.87 mmol) in dry DMF (6 ml) at 0 °C and stirred at that temp for
30 min. Compound 7 (0.87 g, 2.81 mmol) was added to the reaction
mixture at 0 °C and reaction mixture was then allowed to warm to
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

8
R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
ambient temperature and stirred for 1 h. The solution was then
poured into ice water and extracted with ethyl acetate. Organic
layer was washed with water, dried over Na2SO4, filtered and con-
centrated. Crude compound was purified by silica gel column chro-
matography to get pure compound 6-bromo-N-(6-bromo-2,3-
dimethoxybenzyl)naphtho[2,3-d][1,3]dioxol-5-amine 16 as an
off-white solid (0.75 g, 81%). 1H NMR (DMSO-d6, 400 MHz) d 7.69
(s, 1H), 7.43–7.29 (m, 4H), 6.97 (d, J = 8.8 Hz, 1H), 6.16 (s, 2H),
4.43–4.33 (m, 3H), 3.79 (s, 3H), 3.49 (s, 3H); 13C NMR (DMSO-d6,
100 MHz): d 151.8, 148.2, 147.8, 147.4,141.2, 131.8, 130.6, 127.4,
127.3, 126.0, 123.4, 114.4, 113.9, 112.8, 104.0, 101.4, 100.2, 60.1,
55.8, 47.7; LC–MS (ESI): 495.9 [M+H]+. HRMS (ESI): calcd for
1 N sodium bisulfite solution (20 ml) and extracted with 10% MeOH-
DCM mixture. Organic layer was dried over Na2SO4 and concen-
trated to get crude compound 1,2-dimethoxy-12-methyl-[1,3]diox-
olo[40,50:4,5]benzo[1,2-c]phenanthridin-12-ium (0.82 g, crude) as a
yellow liquid which was taken forward to the next step without any
purification on the basis of LCMS monitoring.
4.1.13. 1-(1,2-Dimethoxy-12-methyl-12,13-dihydro-
[1,3]dioxolo-[40,50:4,5]benzo[1,2-c]phenanthridin-13-yl)-
propan-2-one[( )-6-acetonyldihydro chelerythrine] ( )-3
To a stirred solution of 1,2-dimethoxy-12-methyl-[1,3]dioxolo
[40,50:4,5]benzo
[1,2-c]phenanthri-din-12-ium
1
(0.80 g,
C
20H17Br2NO4 495.9624 m/z [M+H]+, found 495.9624.
2.29 mmol) in dry acetone (40 ml) was added aqueous Na2CO3
(1.58 g, 14.94 mmol in 20 ml H2O) solution. Resulting mixture
was refluxed for 6 h. Excess acetone was evaporated and the resi-
due was diluted with ethyl acetate, washed successively with
water and brine, dried over Na2SO4 and concentrated. Crude com-
pound was purified by silica gel column chromatography eluting
with 2–5% DCM in hexane to get pure racemic compound ( )-3
as a brown solid (0.30 g, 60%). 1H NMR (CDCl3, 400 MHz) d 7.70
(d, J = 8.5 Hz, 1H), 7.53 (d, J = 8.5 Hz, 1H), 7.50 (s, 1H), 7.47 (d,
J = 8.6 Hz, 1H), 7.09 (s, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.03 (s, 2H),
5.04–5.01 (m, 1H), 3.94 (s, 3H), 3.91 (s, 3H), 2.63 (s, 3H), 2.56–
2.53 (m, 1H), 2.26–2.22 (m, 1H), 2.05 (s, 3H). 13C NMR (CDCl3,
100 MHz): d 207.6, 152.1, 148.1, 147.5, 145.5, 139.2, 131.0, 128.1,
127.3, 124.8, 123.8, 123.2, 119.7, 118.7, 111.5, 104.3, 101.0,
100.6, 60.9, 55.8, 54.8, 46.8, 42.8, 31.1; LC–MS (ESI): 406.0 [M+H]+.
HPLC analysis: Two enantiomers are separated by chiral prepar-
ative purification using Chiralpak AD-H column (20 ꢁ 250 mm)
4.1.10. 6-bromo-N-(6-bromo-2,3-dimethoxybenzyl)-N-
methylnaphtho[2,3-d][1,3]dioxol-5-amine 5
Sodium hydride (0.132 g, 3.03 mmol) was added to a solution of
the
6-bromo-N-(6-bromo-2,3-dimethoxybenzyl)naphtho[2,3-
d][1,3]dioxol-5-amine 16 (0.5 g, 1.01 mmol) in dry DMF (26 ml)
at 0 °C and stirred at that temp for 30 min. CH3I (0.26 ml,
4.04 mmol) was added to the reaction mixture at 0 °C and temper-
ature was slowly raised to room temperature, stirred at rt for 5 h.
The solution was then poured into ice water and extracted with
ethyl acetate. The organic layer was washed with water, dried over
Na2SO4 and concentrated. Crude compound was purified by silica
gel column chromatography to get pure compound 6-bromo-
N-(6-bromo-2,3-dimethoxybenzyl)-N-methylnaphtho[2,3-d][1,3]-
dioxol-5-amine 5 (0.320 g, 62%). 1H NMR (CDCl3, 400 MHz) d 7.59
(s, 1H), 7.42 (d, J = 8.7 Hz, 1H), 7.29 (d, J = 8.7 Hz, 1H), 7.22 (d,
J = 8.7 Hz, 1H), 6.99 (s, 1H), 6.67 (d, J = 8.7 Hz, 1H), 5.99 (d,
J = 8.7 Hz, 2H), 4.57 (q, J = 12.9 Hz, 2H), 3.79 (s, 3H), 3.61 (s, 3H),
2.95 (s, 3H); 13C NMR (CDCl3, 100 MHz): d 151.9, 149.0, 148.1,
147.6, 145.8, 133.0, 132.3, 130.6, 129.6, 127.6, 125.8, 119.2,
116.9, 112.6, 103.5, 102.2, 100.9, 60.8, 55.9, 52.6, 40.9; LC–MS
(ESI): 509.9 [M+H]+. HRMS (ESI): calcd for C21H19Br2NO4
531.9602 m/z [M+Na]+, found 531.9602.
5
l
, mobile phase: EtOH/DEA: 100/0.1(v/v), flow rate: 10 ml/min,
at 285 nm. Run time: 30 min. Enantiomer (+)-ADC: [
a]
D
25 = +279
(c 0.20, CHCl3), HPLC analysis—Chiralpak AD-H, EtOH/DEA:
100/0.1(v/v), 0.5 ml/min, 285 nm, tR 9.05 min. Enantiomer
(ꢂ)-ADC: [
a
]
25 = ꢂ255 (c 0.20, CHCl3), HPLC analysis—Chiralpak
D
AD-H, EtOH/DEA: 100/0.1 (v/v), 0.5 ml/min, 285 nm, tR 18.73 min.
4.2. Materials and methods
4.1.11. 1,2-Dimethoxy-12-methyl-12,13-dihydro-[1,3]dioxolo-
[40,50:4,5]benzo[1,2-c]phenanthridine 4
4.2.1. Oligonucleotides
To a degassed solution of DMSO (degassed by argon, 3.5 ml/
mmol) were added 6-bromo-2,3-dimethoxy-benzyl)-(6-bromo-
Oligonucleotides used for CD and UV–Visible titrations, CD
melting and Taq DNA polymerase stop assay were synthesized in
a Mermade-4 DNA/RNA synthesizer and were purified by 20%
PAGE using standard protocols. Sequences used for the biophysical
studies were c-MYC (50-TGAGGGTGGGTAGGGTGGGGAA-30) and c-
KIT1 (50GGGAGGGCGCTGGGAGGAGGG-30) DNAs. For stop assay,
primer (50-ACGACTCACTATAGCAATTGCG-30), template with c-
MYC DNA (50-TGAGGGTGGGGAGGGTGGGGAAGCCA CCGCAATTGC-
TATAGTGAGTCGT-30) and template with mutated c-MYC DNA (50-
naphtho[2,3-d][1,3]dioxol-5-yl)-methyl-amine
0.196 mmol), bis(pinacolato)diborane (0.065 g, 0.255 mmol),
potassium acetate (32.7 mg, 0.333 mmol) and 1,1-bis
5
(0.10 g,
(diphenylphosphino)ferrocene palladium(II) dichloride [Pd(dppf)2-
Cl2; 0.015 g, 0.019 mmol). Reaction mixture was stirred at 120 °C
for 16 h. Water was added to the reaction mixture and extracted
with ethyl acetate. Organic layer was washed with water, dried
(Na2SO4) and concentrated. Crude compound was purified by silica
gel column chromatography to get pure compound 1,2-dimethoxy-
12-methyl-12,13-dihydro-[1,3]dioxolo[40,50:4,5]benzo-[1,2-c]
phenanthridine 4 as a dark yellow liquid (0.054 g, 79%). 1H NMR
(CDCl3, 400 MHz) d 7.70–7.66 (m, 2H), 7.51–7.45 (m, 2H), 7.10 (s,
1H), 6.93 (d, J = 8.4 Hz, 1H), 6.03 (s, 2H), 4.28 (s, 2H), 3.92 (s, 3H),
3.83 (s, 3H), 2.58 (s, 3H); 13C NMR (CDCl3, 100 MHz): d 152.2,
148.0, 147.4, 146.1, 142.7, 130.8, 126.3, 126.2, 124.2, 123.7,
120.1, 118.6, 111.0, 104.3, 100.9, 100.7, 61.0, 55.8, 48.7, 41.2;
LC–MS (ESI): 350.2 [M+H]+.
TGAGGGTGGGTAGAGTGGGTAAGC
CACCGCAATTGCTATAGTGAG
TCGT-30) were used. Concentration of all oligonucleotides was
measured at 260 nm in UV–Vis spectrophotometer using appropri-
ate molar extinction coefficients (e).
4.2.2. CD spectroscopy
CD spectra were recorded on a Jasco 815 CD spectrophotometer
in the wavelength range of 220–320 nm using a quartz cuvette with
1.0 mm path length. The scanning speed of the instrument was set to
100 nm/min and response time was 2 s. Baseline was measured
using 50 mM Tris buffer, pH 7.2. The strand concentration of
4.1.12. 1,2-Dimethoxy-12-methyl-[1,3]dioxolo[40,50:4,5]benzo
[1,2-c]phenanthridin-12-ium 1
oligonucleotide used was 12.5 lM and ligand stock solution was
5 mM in DMSO. Each spectrum is an average of 3 measurements at
To a boiling solution of 1,2-dimethoxy-12-methyl-12,13-dihy-
25 °C. All spectra were analyzed using Origin 8.0 software.
dro-[1,3]dioxolo[40,50:4,5]benzo[1,2-c]phenan-thridine
4
(1.1 g,
3.15 mmol) in ethanol was added sodium acetate (5.2 g, 64.1 mmol)
and iodine(1.65 g, 6.52 mmol), and refluxed for 2 h. Ethanol was dis-
tilled out; the mixture was diluted with water (20 ml) and aqueous
4.2.3. CD melting studies
CD melting studies were recorded on a Jasco 815 CD spec-
trophotometer using a quartz cuvette with 1.0 mm path length.
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
9
For melting studies, 10
l
M strand concentration of oligonucleotide
4.2.7. Molecular modeling and dynamics studies
in 10 mM lithium cacodylate (pH 7.2), required amount of mono-
valent salts like LiCl, KCl and 5 molar equivalents of ligands
The 22-mer NMR solution structure of the c-MYC G-quadruplex
(PDB ID: 2L7V;24 after removing the ligand quindoline) was used as
the receptor starting structure. The sdf file containing the 3D struc-
ture of DHCHL was obtained from PubChem database (CID:
485077). It was optimized using Gaussian09 at a B3LYP level of
theory with a 6-311+G(d,p) basis set.25 It was then fitted with RESP
charges calculated using Gaussian09 at the HF level of theory with
a 6-31G(d) basis set, using the Antechamber module of AmberTool-
s14.26 In accordance with the earlier study on CHL,5 DHCHL was
docked twice, once with c-MYC (1:1) and then with a system con-
taining the most commonly-occurring docked conformation (2:1).
The input files used for docking were prepared using AutoDock-
Tools-1.5.6.27An MD simulation was run using the ACEMD program
for accelerated MD.28 Input files for c-MYC as well as the docked
complex were created in xleap module of AmberTools14 with the
ff14SB force field parameters applied for DNA and the GAFF param-
eters applied for DHCHL. The system was then solvated in a cubic
box of explicit TIP3P water with the edges 8.0 Å away from any of
the solute atom. For the negatively charged docked complex, K+
ions were added to neutralize; and 20 Na+ and 20 Clꢂ ions were
added to bring the simulation closer to experimental conditions.
The system was then subjected to 1000 cycles of conjugate gradi-
ent minimization in ACEMD, followed by 0.5 ns of heating with
harmonic constraints on the complex. The Berendsen thermostat
was used for temperature control and the SHAKE algorithm used
to constrain hydrogens. An integration time step of 4 fs was used.
Finally, equilibration was performed, with scaling of the con-
straints at a rate of 0.8/step. The production run for the docked
complex was carried out under constant temperature and volume
(50
lM) were used. Promoter quadruplex DNAs, c-MYC (10
lM in
1 mM KCl and 99 mM LiCl) and c-KIT1 DNAs (10
l
M DNA in
10 mM KCl and 90 mM LiCl) were annealed by heating at 95 °C
for 5 min followed by gradual cooling to room temperature. After
the annealing 5 equiv of ligands were added and incubated for
overnight. Thermal melting was monitored at 263 nm for the pro-
moter quadruplex DNAs at the heating rate of 1 °C/min from 20–
95 °C for c-MYC and from 15–95 °C for c-KIT1 DNAs. All spectra
were fitted by sigmoidal curve fit and analyzed using Boltzmann
function in Origin 8.0 software.
4.2.4. UV–Visible absorption spectroscopy
UV–Visible absorption titration experiments were carried out
on a PerkinElmer (Lambda Bio+) instrument. Absorption spectra
measured in the range of 225–600 nm using quartz cuvette with
10 mm path length. DNA was pre-annealed in 100 mM KCl and
10 mM lithium cacodylate buffer, pH 7.2 by heating at 95 °C for
5 min followed by slow cooling to room temperature. Initially
ligand (30 lM in 100 mM KCl and 10 mM lithium cacodylate buf-
fer, pH 7.2) absorbance was measured. Increasing concentration
of pre-annealed DNA was titrated against the ligand till the satura-
tion level and the absorbance spectrum was recorded. Binding con-
stant was derived by using the absorbance values at 316 nm and
fitting the data using half reciprocal equation as reported previ-
ously.22 Plot of [DNA]/
D
e
ap versus [DNA] provides slope and inter-
cept. Slope was divided by intercept to get binding constant.
[DNA]/ ap = [DNA]/ + 1/Kb ( ). Here, ap = |eb f|; eb is a
D
e
D
e
D
e
D
e
ꢂ
e
molar extinction coefficient of DNA-ligand bound complex and ef
conditions at 300 K for 1 ls. The trajectory was saved in an interval
is molar extinction coefficient of ligand.
of every 2 ps. The MMPBSA.py module of AmberTools12 was used
to calculate the binding free energies for the last 100 ns with an
interval of 100 ps. Trajectories were visualized in UCSF Chimera
and PyMOL. All figures were rendered using PyMOL. Trajectories
were analyzed using the cpptraj module of the AmberTools14
suite. Root mean square deviations (RMSDs) of DNA backbone
atoms, G-quartets and of each ligand were calculated with respect
to the first frame of equilibration as well as the averaged structure
over the entire period of simulation. Clustering was done to a total
of 50,000 frames, using a sieve of every 10 frames, to calculate pair-
wise RMSDs on 5000 frames to the limit of 10 clusters, with an
average standard deviation of 0.593, using the hierarchical agglom-
eration algorithm. Cluster representatives were chosen based on
closeness to the centroid. Root mean square fluctuations (RMSFs)
were calculated with respect to the averaged structure, on a per
residue basis. Intermolecular hydrogen bonds were analyzed with
the following cutoffs: >3.5 Å between the acceptor, and donor
heavy atoms and >135° D–H–A angle.
4.2.5. 50-End-radiolabeling of oligonucleotides
Labeling of the primer was performed by following the previ-
ously reported procedure.23 DNA (10 pmol) was 50 end labeled by
T4 polynucleotide kinase (PNK) enzyme (5 U) in 1 ꢁ PNK buffer
for forward reaction [50 mM Tris–HCl pH 7.6, 10 mM MgCl2,
5 mm DTT, 0.1 mM each spermidine and 0.1 mM EDTA] and
[c- lCi) in a total volume of 10 lL for 1 h at 37 °C fol-
32P]ATP (30
lowed by deactivation of the enzyme by heating at 70 °C for
3 min. The end labeled DNA was then purified using a QIAquick
Nucleotide removal kit protocol provided by the manufacturer.
4.2.6. Taq DNA polymerase stop assay
This assay was performed using reported procedures.23 Appro-
priate amount of labeled primer oligonucleotide (ꢀ20,000 CPM)
was mixed with cold primer (50 nM) and template (100 nM) and
they were annealed in an annealing buffer [5 mM Tris (pH 8),
10 mM NaCl, 0.1 mM EDTA] by heating at 95 °C for 5 min and then
gradual cooling to room temperature over 4 to 5 h. The annealed
primer-template was mixed with 1 ꢁ polymerase buffer [50 mM
Tris, 0.5 mM DTT, 0.1 mM EDTA, 5 mM MgCl2, 5 mM KCl for
4.2.8. Anti-cancer activity
Effects of the compounds on the viability of human cancer cell
lines from different tissue origin (in order to assess cell specific
effect) were determined by colorimetric assay using MTT.29 HeLa
(human cervical cancer), A549 (human lung cancer), A431 (human
epidermoid cancer), HCT116 (human colorectal cancer), PC-3
(human prostate cancer) and MDA-MB-231 (human breast cancer)
cell lines, all were procured from ATCC (American Type Culture
Collection, Manassas, USA) and cultured following their instruc-
tions. Around 5000 cells/well were plated in 96-well plate 24 h
prior to the experiment and incubated at 37 °C in a CO2 incubator.
Cells were treated with either vehicle (0.5% DMSO) or with serially
c-MYC template], 1
dNTPs. The ligands in appropriate concentration were added to
the reaction mixture (10 l total volumes) and incubated for
lg/ll BSA in 5% glycerol (v/v), and 0.2 mM
l
30 min at room temperature. Finally the primer extension reaction
was initiated by adding Taq DNA polymerase (0.5 U) and incubated
at 55 °C for 30 min. The extension reaction was stopped by adding
10
l
l of 2 ꢁ stop buffer (10 mM EDTA, 10 mM NaOH, 0.1% each
bromophenol blue (w/v) and xylene cyanole (w/v) in formamide).
Samples were analysed in 15% denaturing PAGE in which 1 ꢁ TBE
(89 mM of each Tris and boric acid and 2 mM of EDTA, pH ꢀ8.3)
was used as running buffer and gels were autoradiographed using
a phosphorimager. Quantification of gels was performed using
ImageQuant 5.2 software.
diluted test compounds (0.1 to 15 or 20
(20 M as positive control) in a final volume of 200
incubated at 37 °C in a CO2 incubator for 72 h. Following incubation,
cells were treated with 100 g of MTT and incubated at 37 °C for 4 h.
lM) or doxorubicin
l
ll/well and
l
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059

10
R. Malhotra et al. / Bioorg. Med. Chem. xxx (2016) xxx–xxx
9. Chang, Y.-C.; Hsieh, P.-W.; Chang, F.-R.; Wu, R.-R.; Liaw, C.-C.; Lee, K.-H.; Wu,
Y.-C. Planta Med. 2003, 69, 148.
10. Mansoor, T. A.; Borralho, P. M.; Luo, X.; Mulhovo, S.; Rodrigues, C. M. P.;
Ferreira, M.-J. U. J. Nat. Prod. 2014, 77, 1825.
Supernatants were carefully removed (without disturbing the for-
mazan crystals formed) and 150 l DMSO was added to each well.
The plate was kept on the plate shaker until the crystals were dis-
solved and the absorbance was read at 570 nm. The absorbance
values from test compound wells were compared to that for the
control wells to calculate the percentage of inhibition.
l
11. (a) MacKay, S. P.; Meth-Cohn, O.; Waigh, R. D. Adv. Heterocycl. Chem. 1997, 67,
345; (b) Richardson, T.; Robinson, R.; Seijo, E. J. Chem. Soc. 1937, 835; (c) Ishii,
H.; Ichikawa, Y.-I.; Kawanabe, E.; Ishikawa, M.; Ishikawa, T.; Kuretani, K.;
Inomata, M.; Hoshi, A. Chern. Pharm. Bull. 1985, 33, 4139; (d) Kessar, S. V.;
Gupta, Y. P.; Balakrishnan, P.; Sawal, K. K.; Mohammad, T.; Dutt, M. J. Org. Chem.
1988, 53, 1708; (e) Clark, R. D.; Jahangir, J. Org. Chem. 1988, 53, 2378; (f)
Beugelmans, R.; Bois-Choussy, M. Tetrahedron 1992, 48, R285; (g) Sotomayor,
N.; Dominguez, E.; Lete, E. Tetrahedron Lett. 1994, 35, 2973; (h) Hanaoka, M.;
Mukai, C. In Studies in Natural Products Chemistry; Atta-ur-Rahman, Ed.;
Elsevier: Amsterdam, 1994; Vol. 14, p 769; (i) Seraphin, D.; Lynch, M. A.; DuVal,
O. Tetrahedron Lett. 1995, 36, 5731; (j) Harayama, T.; Akiyama, T.; Kawano, K.
Chern. Pharm. Bull. 1996, 44, 1634.
12. Geen, G. R.; Mann, I. S.; Mullane, M. V. Tetrahedron 1998, 54, 9875.
13. Lv, P.; Huang, K.; Xie, L.; Xu, X. Org. Biomol. Chem. 2011, 9, 3133.
14. Korivi, R. P.; Cheng, C.-H. Chem. Eur. J. 2010, 16, 282.
15. Clement, B.; Weide, M.; Wolschendorf, U.; Kock, I. Angew. Chem., Int. Ed. 2005,
44, 635.
4.3. Statistical analysis
In vitro experiments for the assessment of anticancer activity of
the compounds were performed in triplicate and data have been
reported as means SEM. Statistical significance was determined
using two-sided Student’s t-test.
Acknowledgments
16. De, S.; Mishra, S.; Kakde, B. N.; Dey, D.; Bisai, A. J. Org. Chem. 2013, 78, 7823.
17. Castillo, J.-C.; Quiroga, J.; Abonia, R.; Rodriguez, J.; Coquerel, Y. Org. Lett. 2015,
17, 3374.
18. (a) Levy, A. A.; Rains, H. C.; Smiles, S. J. Chem. Soc. 1931, 3264; (b) Matsui, K.;
Maeno, N.; Suzuki, S.; Shizuka, H.; Morita, T. Tetrahedron Lett. 1970, 11, 1467;
(c) Wang, Z. In Comprehensive Organic Name Reactions and Reagents; Wiley:
Hoboken, 2010.
19. (a) Sambiagio, C.; Marsden, S. P.; Blacker, A. J.; McGowan, P. C. Chem. Soc. Rev.
2014, 43, 3525; (b) Hassan, J.; Sevignon, M.; Gozzi, C.; Schulz, E.; Lemaire, M.
Chem. Rev. 2002, 102, 1359.
20. (a) Paramasivan, S.; Rujan, I.; Bolton, H. P. Methods 2007, 43, 324; (b) Randazzo,
A.; Spada, G.; Silva, M. Top. Curr. Chem. 2013, 330, 67.
We are thankful to Department of Biotechnology (DBT)-Govern-
ment of India (sanction no.: 102/IFD/SAN/1191/2009-2010 to
TCGLS and Pilot Project Grants for Young Investigators in Cancer
Biology, Grant No: 6242-P4/RGCB/PMD/DBT/PKPI/2015, to P.I.P.)
and IRCC-IIT Bombay for providing financial support. Computer
center, IIT Bombay is gratefully acknowledged for providing high
performance computing facilities. We are thankful Dr. Ruchi Anand
for providing access to her laboratory facilities and S. Harikrishna
for assistance in the molecular modeling studies. D.K.V. thanks
Council of Scientific and Industrial Research, India (CSIR) for the
fellowship.
21. Guedin, A.; Lacroix, L.; Mergny, J. L. Methods Mol. Biol. 2010, 613, 25.
22. Kieltyka, R.; Englebienne, P.; Moitessier, N.; Sleiman, H. In G-Quadruplex DNA;
Baumann, P., Ed.; Humana Press, 2010; Vol. 608,.
23. (a) Han, H.; Hurley, L. H.; Salazar, M. Nucleic Acids Res. 1999, 27, 537; (b)
Seenisamy, J.; Bashyam, S.; Gokhale, V.; Vankayalpati, H.; Grand, C. L.; Siddiqui-
Jain, A.; Streiner, N.; Wilson, W. D.; Hurley, L. H. J. Am. Chem. Soc. 2005, 127,
2944.
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2016.04.059.
24. Dai, J.; Carver, M.; Hurley, L. H.; Yang, D. J. Am. Chem. Soc. 2011, 133, 17673.
25. Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.;
Cheeseman, J. R.; Scalmani, G.; Barone, V.; Mennucci, B.; Petersson, G. A.;
Nakatsuji, H.; Caricato, M.; Li, X.; Hratchian, H. P.; Izmaylov, A. F.; Bloino, J.;
Zheng, G.; Sonnenberg, J. L.; Hada, M.; Ehara, M.; Toyota, K.; Fukuda, R.;
Hasegawa, J.; Ishida, M.; Nakajima, T.; Honda, Y.; Kitao, O.; Nakai, H.; Vreven,
T.; Montgomery, J. A., Jr.; Peralta, J. E.; Ogliaro, F.; Bearpark, M.; Heyd, J. J.;
Brothers, E.; Kudin, K. N.; Staroverov, V. N.; Kobayashi, R.; Normand, J.;
Raghavachari, K.; Rendell, A.; Burant, J. C.; Iyengar, S. S.; Tomasi, J.; Cossi, M.;
Rega, N.; Millam, J. M.; Klene, M.; Knox, J. E.; Cross, J. B.; Bakken, V.; Adamo, C.;
Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin, A. J.; Cammi, R.;
Pomelli, C.; Ochterski, J. W.; Martin, R. L.; Morokuma, K.; Zakrzewski, V. G.;
Voth, G. A.; Salvador, P.; Dannenberg, J. J.; Dapprich, S.; Daniels, A. D.; Farkas, Ö;
Foresman, J. B.; Ortiz, J. V.; Cioslowski, J.; Fox, D. J. Gaussian 09, Revision D.01,
2014, Gaussian, Wallingford CT.
26. Case, D. A.; Babin, V.; Berryman, J. T.; Betz, R. M.; Cai, Q.; Cerutti, D. S.;
Cheatham, T. E., III; Darden, T. A.; Duke, R. E.; Gohlke, H.; Goetz, A.W.; Gusarov,
S.; Homeyer, N.; Janowski, P.; Kaus, J.; Kolossvry, I.; Kovalenko, A.; Lee, T. S.;
LeGrand, S.; Luchko, T.; Luo, R.; Madej, B.; Merz, K. M.; Paesani, F.; Roe, D. R.;
Roitberg, A.; Sagui, C.; Salomon-Ferrer, R.; Seabra, G.; Simmerling, C. L.; Smith,
W.; Swails, J.; Walker, R.C.; Wang, J.; Wolf, R.M.; Wu, X.; Kollman, P. A. AMBER
14, 2014, University of California, San Francisco.
References and notes
1. (a) Simanek, V. In The Alkaloids; Brossi, A., Ed.; Academic Press: New York,
1985; Vol. 26, p 185; (b) Krane, B. D.; Fagbule, M. O.; Shamma, M.; Gozler, B. J.
Nat. Prod. 1984, 47, 1.
2. (a) Vavreckov, C.; Gawlik, I.; Muller, K. Planta Med. 1996, 62, 397; (b)
Schemeller, T.; Latz-Bruning, B.; Wink, M. Phytochemistry 1997, 44, 257; (c)
Huang, F.-C.; Kutchan, T. M. Phytochemistry 2000, 53, 555.
3. (a) Taira, Z.; Matsumoto, M.; Ishida, S.; Ichikawa, T.; Sakiya, Y. Chem. Pharm.
Bull. 1994, 42, 1556; (b) Herbert, J. M.; Augereau, J. M.; Gleye, J.; Maffrand, J. P.
Biochem. Biophys. Res. Commun. 1990, 172, 993; (c) Fang, S.-D.; Wang, L.-K.;
Hecht, S. M. J. Org. Chem. 1993, 58, 5025; (d) Nakanishi, T.; Suzuki, M. J. Nat.
Prod. 1998, 61, 1263.
4. (a) Collie, G. W.; Parkinson, G. N. Chem. Soc. Rev. 2011, 40, 5867; (b) Monchaud,
D.; Teulade-Fichou, M. P. Org. Biomol. Chem. 2008, 6, 627.
5. (a) Bai, L.-P.; Hagihara, M.; Nakatani, K.; Jiang, Z.-H. Nat. Sci. Rep. 2014, 4, 2015.
http://dx.doi.org/10.1038/srep06767; (b) Ghosh, S.; Jana, J.; Kar, R. K.;
Chatterjee, S.; Dasgupta, D. Biochemistry 2015, 54, 974.
6. (a) Ghosh, S.; Dasgupta, D. Biochem. Biophys. Res. Commun. 2015, 459, 75; (b)
Cui, X.; Lin, S.; Yuan, G. Int. J. Biol. Macromol. 2012, 50, 996.
7. Hurley, L. H.; Neidle, S. Nat. Rev. Drug Disc. 2011, 10, 261.
8. Yang, X.-J.; Miao, F.; Yao, Y.; Cao, F.-J.; Yang, R.; Ma, Y.-N.; Qin, B.-F.; Zhou, L.
Molecules 2012, 17, 13026.
27. Harvey, M.; Giupponi, G.; De Fabritis, G. J. Chem. Theory Comput. 2009, 5, 1632.
28. Morris, G. M.; Huey, R.; Lindstrom, W.; Sanner, M. F.; Belew, R. K.; Goodsell, D.
S.; Olson, A. J. J. Comput. Chem. 2009, 16, 2785.
29. Mosmann, T. J. Immunol. Methods 1983, 65, 55.
Please cite this article in press as: Malhotra, R.; et al. Bioorg. Med. Chem. (2016), http://dx.doi.org/10.1016/j.bmc.2016.04.059