.
Angewandte
Communications
TMPyP4 with KHSO5 in aqueous buffer is extremely rapid
and efficient. The face of the porphyrin where peroxide
coordination triggers the formation of the metal-oxo species
must be accessible from the solvent.
In the case of water-soluble metallo porphyrins, it has
been shown that the oxygen atom incorporated in the
substrate does not originate exclusively from the peroxide,
owing to an oxo–hydroxo tautomerism mechanism
(Scheme 2).[31–33] This oxygen atom can also originate from
the trans water molecule on the opposite face of the
folds into an antiparallel G-quadruplex. Second, 5’-
d(TGAGGGTGGGGAGGGTGGGGAA) oligonucleotide
(c-myc), corresponds to the human oncogene c-myc promoter
sequence (myc2345), which adopts a propeller-type parallel-
stranded G-quadruplex structure in KCl medium.[36]
Scheme 4 shows a schematic drawing of the three types of
folding.
Scheme 4. Scheme showing the different G-quadruplex structures. The
left and middle structures correspond to a hybrid type 1 and antipar-
allel orientation of the TTG4A sequence in K+ and Na+ buffers,
respectively. The right structure shows the propeller-type parallel-
stranded orientation of the c-myc sequence in K+ buffer.
Scheme 2. Oxo–hydroxo tautomerism of high-valent metal-oxo manga-
nese porphyrin in water and subsequent labeling of the product of the
reaction of olefin epoxidation.
The oxidation reaction of CBZ by Mn-TMPyP4/KHSO5
was previously described in phosphate buffer at pH 5 in the
presence of 10% methanol.[32] Because the optimal pH value
for this oxidation reaction is pH 5, the structure of the G-
quadruplexes was determined by circular dichroism under
these experimental conditions (Supporting Information, Fig-
ures S1–S4). The folding of the quadruplexes appeared
identical to the folding observed at neutral pH (Supporting
Information, Figures S1,S2). The addition of 10% methanol
to the buffer also did not alter the structure of the G-
quadruplexes (Supporting Information, Figures S3,S4). In
phosphate buffer (50 mm) containing 10 mm KCl, the
TTG4A oligonucleotide showed a typical CD spectrum of
the classic hybrid type 1 structure of telomeric quadruplex
DNA. In phosphate buffer (pH 5) containing NaCl, TTG4A
folded into a typical antiparallel G-quadruplex structure.
Thus, the folding of these G-quadruplexes is not affected by
the lower pH value of the buffer. In addition, the G-
quadruplex structure of the TTG4A oligonucleotide proved
stable following the lyophilization and redissolution steps that
were necessary for experiments in labeled water. Further-
more, we have previously shown that Mn-TMPyP4 interac-
tion with TTG4A does not change its CD spectrum.[27]
porphyrin. The reaction face of the porphyrin, where the
oxo entity reacts with the substrate may be different from the
activation face, where the oxo species was originally formed.
Consequently, measurement of the oxo–hydroxo tautomerism
provides a way to tell whether the two faces of the porphyrin
are accessible to the solvent. If the reaction face where the
metal-oxo entity locates is the same as the activation face, the
oxygen atom incorporated into the substrate originates from
the peroxide. If the reaction face is opposite to the activation
face, the oxygen atom incorporated into the substrate
originates from water. When the two faces of the metallo-
porphyrin are equally accessible, the oxygen atom incorpo-
rated into the substrate will originate equally from the
peroxide and the water molecule. It has been shown that
the ratio is 50% from KHSO5 and 50% from water under
normal reaction conditions in buffered solutions.[32–34] Herein,
we tested the oxo–hydroxo tautomerism of the metal-oxo
form of Mn-TMPyP4 porphyrin in complex with G-quad-
ruplex nucleic acids by analyzing the oxygen atom incorpo-
rated into the epoxidation product of carbamazepine (CBZ;
Scheme 3).
We used two different G-quadruplex forming oligonucle-
otides: first, 5’-d[TT(GGGTTA)3GGGA] (TTG4A), corre-
sponds to a variable form of the human telomere sequence
previously shown to adopt a hybrid type 1 structure (95%) in
KCl containing medium.[35] In the presence of NaCl, TTG4A
Oxidation of CBZ by Mn-TMPyP4/KHSO5 was first
carried out in the absence of G-quadruplex DNA. CBZ
(500 mm) was reacted with Mn-TMPyP4 (2 mm) for one minute
at 258C in phosphate buffer (pH 5) containing KCl (or NaCl).
At the end of the reaction, unreacted CBZ and the epoxide
OCBZ were extracted using dichloromethane (extraction was
quantitative) and the organic phase was analyzed by HPLC
coupled to electrospray mass spectrometry (Supporting
Information, Figure S5). OCBZ epoxide (Table 1) was the
only oxidation product detected. The low yield (approxi-
mately 7% with respect to CBZ) is due to the short reaction
V
=
time. The oxo–hydroxo tautomerism on the Mn O was
measured by performing the same reaction in H218O. The
Scheme 3. Mn-TMPyP4/KHSO5 catalyst converts carbamazepine (CBZ)
into carbamazepine-10,11-oxide (OCBZ).
incorporation of 18O atoms from the labeled water into OCBZ
2186
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2013, 52, 2185 –2188