Welcome to LookChem.com Sign In|Join Free
  • or
Thymidine, 3',5'-dideoxy-3'-[[[[(9H-fluoren-9-ylmethoxy)carbonyl]amino]thioxomethyl ]amino]-5'-[[(4-methoxyphenyl)diphenylmethyl]amino]- is a chemical with a specific purpose. Lookchem provides you with multiple data and supplier information of this chemical.

556826-39-2

Post Buying Request

556826-39-2 Suppliers

Recommended suppliers

  • Product
  • FOB Price
  • Min.Order
  • Supply Ability
  • Supplier
  • Contact Supplier

556826-39-2 Usage

Check Digit Verification of cas no

The CAS Registry Mumber 556826-39-2 includes 9 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 6 digits, 5,5,6,8,2 and 6 respectively; the second part has 2 digits, 3 and 9 respectively.
Calculate Digit Verification of CAS Registry Number 556826-39:
(8*5)+(7*5)+(6*6)+(5*8)+(4*2)+(3*6)+(2*3)+(1*9)=192
192 % 10 = 2
So 556826-39-2 is a valid CAS Registry Number.

556826-39-2SDS

SAFETY DATA SHEETS

According to Globally Harmonized System of Classification and Labelling of Chemicals (GHS) - Sixth revised edition

Version: 1.0

Creation Date: Aug 15, 2017

Revision Date: Aug 15, 2017

1.Identification

1.1 GHS Product identifier

Product name 5'-monomethoxytritylamino-3'-(N'-9-fluorenylmethoxycarbonylthiouria)-2',3',5'-trideoxythymidine

1.2 Other means of identification

Product number -
Other names -

1.3 Recommended use of the chemical and restrictions on use

Identified uses For industry use only.
Uses advised against no data available

1.4 Supplier's details

1.5 Emergency phone number

Emergency phone number -
Service hours Monday to Friday, 9am-5pm (Standard time zone: UTC/GMT +8 hours).

More Details:556826-39-2 SDS

556826-39-2Downstream Products

556826-39-2Relevant academic research and scientific papers

Deoxynucleic Guanidines (DNG)- Modified Oligonucleotides and Methods of Synthesizing Deoxynucleic Guanidine Strands

-

Paragraph 0104; 0111; 0112, (2021/01/22)

Disclosed herein are spherical nucleic acids (SNAs) comprising oligonucleotides comprising one or more modified oligonucleotides, and methods of use thereof. Also disclosed are methods of synthesizing modified oligonucleotides for use in therapeutics, inc

Mercury-Free Automated Synthesis of Guanidinium Backbone Oligonucleotides

Skakuj, Kacper,Bujold, Katherine E.,Mirkin, Chad A.

supporting information, p. 20171 - 20176 (2020/01/02)

A new method for synthesizing deoxynucleic guanidine (DNG) oligonucleotides that uses iodine as a mild and inexpensive coupling reagent is reported. This method eliminates the need for the toxic mercury salts and pungent thiophenol historically used in me

Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue: Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding

Reddy, Putta Mallikarjuna,Bruice, Thomas C.

, p. 3736 - 3747 (2007/10/03)

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3′ → 5′ direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5′-terminus using PyBOP/HOBt chemistry. The stability of (DNA)2·DNG-H triplexes and DNA. DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5′-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3′, respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5′-terminus of the DNG enhances the (DNA)2·DNG-H triplex stability by a ΔTm of 13 °C. The fluorescence emission studies of (DNA)2·DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)2·DNG triplex stability by 11 °C, whereas (DNA)2·DNG-H triplex stability was decreased by 23 °C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 °C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA·DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA·DNG minor groove, and the duplex stability was enhanced by ΔTm of 7 °C. The stability of (DNA)2·DNG triplexes and DNA·DNG duplexes is independent of pH, whereas the stability of (DNA)2·DNG-H triplexes decreases with increase in pH.

Deoxynucleic guanidine: Synthesis and incorporation of purine nucleosides into positively charged DNG oligonucleotides

Challa, Hemavathi,Bruice, Thomas C.

, p. 1475 - 1481 (2007/10/03)

The synthesis of purine nucleosides capable of making the guanidinium linkage is described for the first time starting from the corresponding 2′-deoxynucleosides. The positively charged mixed base DNG oligomer containing guanine was synthesized on solid-p

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) oligonucleotide mixed sequences

Reddy, Putta Mallikarjuna,Bruice, Thomas C.

, p. 1281 - 1285 (2007/10/03)

Positively charged DNG oligonucleotide mixed sequences containing A/T bases were prepared by solid-phase synthesis. Synthesis proceeds in 3′→5′ direction and involves coupling of 3′-Fmoc protected thiourea in the presence of HgCl2/TEA with the corresponding 5′-amine of the growing oligo chain. DNG binding characteristics with complementary DNA and with itself have been evaluated.

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1 Customer Service

What can I do for you?
Get Best Price

Get Best Price for 556826-39-2