Permanent or reversible conjugation of 2′-O-or 5′-O- aminooxymethylated nucleosides with functional groups as a convenient and efficient approach to the modification of RNA and DNA sequences

2312–2329 Nucleic Acids Research, 2012, Vol. 40, No. 5

doi:10.1093/nar/gkr896

Published online 8 November 2011

Permanent or reversible conjugation of 2⁰-O- or

5⁰-O-aminooxymethylated nucleosides with

functional groups as a convenient and efficient

approach to the modification of RNA and

DNA sequences

1

2

´

Jacek Cieslak , Andrzej Grajkowski , Cristina Ausın , Alexei Gapeev and

Serge L. Beaucage^1,*

¹Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug Administration,

2

8800 Rockville Pike, Bethesda, MD 20892 and Department of Chemistry and Biochemistry, University of

Maryland, Baltimore County, Baltimore, MD 21250, USA

Received August 31, 2011; Revised October 3, 2011; Accepted October 4, 2011

ABSTRACT

ribonucleosides with aldehydes, including those

generated from their acetals, provides reversible

2⁰-O-Aminooxymethyl ribonucleosides are prepared

from their 3⁰,5⁰-disilylated 2⁰-O-phthalimidooxy-

methyl derivatives by treatment with NH₄F in MeOH.

The reaction of these novel ribonucleosides with

1-pyrenecarboxaldehyde results in the efficient for-

mation of stable and yet reversible ribonucleoside

2⁰-conjugates in yields of 69–82%. Indeed, exposure

of these conjugates to 0.5 M tetra-n-butylammo-

nium fluoride (TBAF) in THF results in the cleavage

of their iminoether functions to give the native ribo-

nucleosides along with the innocuous nitrile side

product. Conversely, the reaction of 5-cholesten-

3-one or dansyl chloride with 2⁰-O-aminooxymethyl

uridine provides permanent uridine 2⁰-conjugates,

which are left essentially intact upon treatment with

TBAF. Alternatively, 5⁰-O-aminooxymethyl thymidine

is prepared by hydrazinolysis of its 3⁰-O-levulinyl-5⁰-

O-phthalimidooxymethyl precursor. Pyrenylation of

5⁰-O-aminooxymethyl thymidine and the sensitivity

of the 5⁰-conjugate to TBAF further exemplify

the usefulness of this nucleoside for modifying

DNA sequences either permanently or reversibly.

Although the versatility and uniqueness of 2⁰-O-

aminooxymethyl ribonucleosides in the preparation

of modified RNA sequences is demonstrated by

the single or double incorporation of a revers-

ible pyrenylated uridine 2⁰-conjugate into an RNA

sequence, the conjugation of 2⁰-O-aminooxymethyl

2⁰-O-protected ribonucleosides for potential appli-

cations in the solid-phase synthesis of native RNA

sequences. The synthesis of a chimeric polyuridylic

acid is presented as an exemplary model.

INTRODUCTION

Over the past decade, the 2⁰-hydroxy function of ribo-

nucleosides has been extensively modiﬁed for the purpose

of identifying the biophysical and biochemical parameters

necessary for effective and lasting RNA interference-

mediated gene silencing activities (1–4). Actually,

2⁰-hydroxy modiﬁcations are known to impart high bind-

ing afﬁnity to RNA sequences, increased lipophilicity,

enhanced chemical stability and resistance to nucleases

(1,2,5). The 2⁰-hydroxyl group of ribonucleosides is also

an attractive function for conjugation reactions; there are

numerous examples of ribonucleoside 2⁰-conjugates that

have been reported in various structural studies (6,7) as

well as in therapeutic and diagnostic applications (8,9).

Although 2⁰-O-alkylation of ribonucleosides with func-

tional groups has often been employed in the synthesis

of ribonucleoside 2⁰-conjugates (8,9), this method is gen-

erally lacking the regioselectivity needed for the production

of conjugates free of isomeric impurities. An alternate

strategy to the preparation of ribonucleosides 2⁰-conjugates

is the use of the oxyamino-aldehyde coupling reaction

(10–12), which incidentally has extensively been applied

to the derivatization of oligonucleotides (13–20).

*To whom correspondence should be addressed. Tel: +1 301 827 5162; Fax: +1 301 480 3256; Email: serge.beaucage@fda.hhs.gov

Published by Oxford University Press 2011.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/

by-nc/3.0), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Nucleic Acids Research, 2012, Vol. 40, No. 5 2313

Although the reversibility of the oxyamino-aldehyde

coupling reaction has, to the best of our knowledge, never

been demonstrated, we rationalized that the conjugation

of 2⁰-O-aminooxymethyl ribonucleosides with various

functional groups may provide a powerful tool for the

preparation and incorporation of permanent or reversible

ribonucleoside 2⁰-conjugates into RNA sequences.

Furthermore, reversible ribonucleoside 2⁰-conjugates may

especially be useful in identifying novel ribonucleoside

2⁰-hydroxyl protecting groups, which have historically

been shown to be of critical importance in RNA synthe-

sis (21) and may lead to an improved approach to the

solid-phase synthesis of native or modiﬁed RNA se-

quences. Given that the preparation of 2⁰-O-amino-

oxymethyl ribonucleosides has not been described in

the scientiﬁc literature, we are now reporting an efﬁcient

method for the synthesis of these ribonucleosides (5a–d,

Scheme 1) and that of several permanent or reversible

2⁰-conjugates (Figure 1). With the objective of demonst-

rating the reversibility of 2⁰-O-aminooxymethyl ribo-

nucleoside conjugates, the details of an unprecedented

ﬂuoride-mediated conversion of conjugates 6a–d, 12, 14,

16 and 18 to their native ribonucleosides (Scheme 2 and

Figure 2) will be discussed. Furthermore, 5⁰-O-aminooxy-

methyl thymidine (25, Scheme 3) has also been prepared

for the ﬁrst time and the addition of its pyrenylated con-

jugate 26 to the 5⁰-terminus of a DNA sequence serves as

a relevant example for the permanent or reversible

functionalization of DNA sequences at their 5⁰-termini.

A single or a double incorporation of the 2⁰-O-pyreny-

lated ribonucleoside conjugate 6a into a chemically syn-

thesized oligoribonucleotide (21-mer) is performed to

further substantiate the permanent/reversible properties

of the modiﬁed RNA sequence. Moreover, the phosphor-

amidite derivative of the reversible uridine 2⁰-conjugate

29 (Scheme 4) is incorporated into a chimeric poly-

uridylic sequence (21-mer) in order to provide convincing

evidence of the usefulness and versatility of 2⁰-O-

aminooxymethyl ribonucleoside conjugates in the design

and implementation of novel 2⁰-hydroxyl protecting

groups for potential applications in the synthesis of

modiﬁed or native RNA sequences.

Scheme 1. Synthesis of 2⁰-O-pyrenylated ribonucleosides derivatives.

(i) DMSO, Ac₂O, AcOH, 50^ꢀC, 16 h; (ii) silica gel chromatography;

(iii) SO₂Cl₂, CH₂Cl₂, 25^ꢀC, 2 h; (iv) N-hydroxyphthalimide, DBU,

CH₂Cl₂, 25^ꢀC, 24 h; (v) NH₄F, MeOH, 25^ꢀC, 16 h; (vi) concd aq

NH₃, 55^ꢀC, 1 h; (vii) 1-pyrenecarboxaldehyde, MeOH, 55^ꢀC, 1 h;

(viii) DMTrCl, pyridine, 25^ꢀC, 16 h; (ix) 2-cyanoethyl N,N-diisopropyl-

chlorophosphoramidite, Et₃N, CH₂Cl₂, 25^ꢀC, 2 h. Abreviations. B^P:

a, uracil-1-yl; b, N⁴-acetylcytosin-1-yl; c, N⁶-isobutyryladenin-9-yl; d,

N²-phenoxyacetylguanin-9-yl; B: a, uracil-1-yl; b, cytosin-1-yl; c,

adenin-9-yl; d, guanin-9-yl; DMTr, 4,4⁰-dimethoxytrityl.

MATERIALS AND METHODS

3⁰,5⁰-O-(1,1,3,3-Tetraisopropyldisiloxane-1,3-diyl)-2⁰-O-

(methylthiomethyl)uridine (2a)

The preparation of 2a was performed with minor modiﬁ-

cations of a published procedure (22,23). To a solution of

commercial

5⁰-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-

diyl)uridine (1a, 7.3 g, 15 mmol) in DMSO (15 ml) was

added glacial AcOH (23 ml) and Ac₂O (15 ml). The

solution was stirred at 50^ꢀC until completion of the reac-

tion (16 h), which was monitored by TLC (CHCl₃:MeOH

95:5 v/v). The solution was transferred to a 2 l Erlenmeyer

ﬂask to which was added, under vigorous stirring, a

solution of K₂CO₃(31 g) in water (200 ml). The precipi-

tated material was isolated either by ﬁltration or decanta-

tion and was redissolved in a minimum volume of THF

(15–20 ml). The resulting solution was then poured into

water (250 ml) to give the crude product as a gummy

material. Most of the water was decanted; the crude prod-

uct was carefully dried by consecutive coevaporation with

pyridine (30 ml), toluene (3 ꢁ 30 ml) and dichloromethane

(30 ml). The crude ribonucleoside 2a was puriﬁed by chro-

matography on silica gel using a gradient of MeOH (0 !

3%) in CH₂Cl₂as the eluent. Fractions containing pure 2a

were collected, evaporated to a foam under low pressure,

and dissolved in dry C₆H₆(ꢂ20 ml); the solution was

2314 Nucleic Acids Research, 2012, Vol. 40, No. 5

frozen and then lyophilized under high vacuum affording a

white powder (7.00 g, 12.8 mmol, 85%). Characterization

data obtained from ¹H and ¹³C NMR analysis of 2a

are in agreement with those reported by Semenyuk

et al. (23).

NMR (75 MHz, DMSO-d₆): d 163.1, 150.7, 140.4, 101.8,

98.0, 86.7, 84.9, 79.1, 69.0, 60.4. +ESI-HRMS: Calcd for

C₁₀H₁₅N₃O₇[M+H]⁺290.0983, found 290.0986.

2⁰-O-(Pyren-1-ylmethanimine-N-oxymethyl)uridine (6a)

2⁰-O-(Aminooxymethyl)uridine (5a) was prepared from 4a

at the scale and under conditions identical to those

described above. After complete NH₄F-mediated desilyla-

tion and dephthalimidation, 1-pyrenecarboxaldehyde

(460 mg, 2.00 mmol) was added to the reaction mixture,

which was then heated at 55^ꢀC in a 4-ml screw-cap glass

vial until completion of the oximation reaction (1 h) as

indicated by TLC [CHCl₃:MeOH (9:1 v/v)]. The reaction

mixture was transferred to a 20-ml screw-cap glass vial to

which was added CH₂Cl₂(7 ml) and a saturated aqueous

solution of NaHCO₃(2 ml); after vigorous shaking the

organic phase was collected and evaporated to dryness

under vacuum. The pyrenylated ribonucleoside 6a was

puriﬁed by chromatography on silica gel employing a

gradient of MeOH (0 ! 8%) in CH₂Cl₂as the eluent.

Fractions containing the pure product were collected

and evaporated to dryness under reduced pressure afford-

ing 6a as a yellowish powder (206 mg, 410 mmol) in a yield

of 82% based on the molar amount of starting material

(4a) that was used. +ESI-HRMS: Calcd for C₂₇H₂₃N₃O₇

[M+H]⁺502.1609, found 502.1609.

3⁰,5⁰-O-(1,1,3,3-Tetraisopropyldisiloxane-1,3-diyl)-2⁰-O-

(phthalimidooxymethyl)uridine (4a)

To a solution of thoroughly dried 2a (1.1 g, 2.0 mmol) in

anhydrous CH₂Cl₂(20 ml) was added sulfuryl chloride

(176 ml, 2.20 mmol); the solution was stirred at ꢂ25^ꢀC

for 2 h and was then concentrated under reduced pressure

to give the 2⁰-O-chloromethyluridine derivative 3a as an

amorphous solid. N-Hydroxyphthalimide (1.3 g, 8.0 mmol)

was placed into a separate reaction vessel to which was

added anhydrous CH₂Cl₂(10 ml) and DBU (1.04 ml,

7.00 mmol). After 10 min, the red solution was added to

unpuriﬁed 3a; the reaction mixture was kept stirring at

ꢂ25^ꢀC for 24 h at which point CH₂Cl₂(80 ml) was

added. The solution was vigorously mixed with aqueous

1 M acetic acid (20 ml); the aqueous layer was discarded

and the organic phase was washed twice with a saturated

aqueous solution of NaHCO₃(20 ml). The organic layer

was collected, dried over anhydrous Na₂SO₄, ﬁltered, and

evaporated to a foamy solid under reduced pressure. The

crude product 4a was puriﬁed by chromatography on

silica gel using a gradient of MeOH (0 ! 3%) in

CH₂Cl₂as the eluent. Fractions containing 4a were col-

lected and evaporated under vacuum to give a solid

(1.24 g, 1.88 mmol) in a yield of 94% based on the molar

amount of starting material (2a) that was employed.

¹H NMR (300 MHz, DMSO-d₆): d 11.41 (d, J = 2.2 Hz,

1H), 7.88-7.80 (m, 4H), 7.65 (d, J = 8.2 Hz, 1H), 5.62

(dd, J = 8.2, 2.2 Hz, 1H), 5.39 (d, J = 7.2 Hz, 1H), 5.34

(d, J = 7.2 Hz, 1H), 4.87 (d, J = 5.2 Hz, 1H), 4.63

(dd, J = 5.2, 5.2 Hz, 1H), 4.03 (dd, J = 13.0, 3.0 Hz,

1 H), 3.90 (dd, J = 13.0, 3.0 Hz, 1H), 3.79 (dt, J = 9.0,

3.0 Hz, 1H), 1.07–0.95 (m, 28 H). ¹³C NMR (75 MHz,

DMSO-d₆): d 163.2, 163.0, 150.0, 142.6, 134.8, 128.4,

123.3, 101.3, 98.0, 90.6, 80.2, 77.9, 69.8, 60.2, 17.2, 17.1,

17.0, 16.81, 16.77, 16.7, 12.5, 12.3, 12.1, 12.0. +ESI-

HRMS: Calcd for C₃₀H₄₃N₃O₁₀Si₂[M+H]⁺662.2560,

found 662.2560.

5⁰-O-(4,4⁰-dimethoxytrityl)-2⁰-O-(pyren-1-ylmethanimine-

N-oxymethyl)uridine (7a)

To a solution of dry 6a (200 mg, 400 mmol) in anhydrous

pyridine (1 ml) was added 4,4’-dimethoxytrityl chloride.

The solution was allowed to stir for 16 h at ꢂ25^ꢀC

and was then evaporated to a gum under reduced pressure.

The material was dissolved in CHCl₃(10 ml) and was

washed with a saturated aqueous solution of NaHCO₃

(3 ml). The organic layer was collected, dried over anhyd-

rous Na₂SO₄, ﬁltered and evaporated to

a solid

under low pressure. The crude product 7a was puriﬁed

by chromatography on silica gel using a gradient of

MeOH (0 ! 2%) in CH₂Cl₂containing 0.2% Et₃N as

the eluent. Fractions containing 7a were collected and

evaporated under vacuum to give a solid (293 mg,

364 mmol, 91%).

2⁰-O-(Aminooxymethyl)uridine (5a)

5⁰-O-(4,4⁰-dimethoxytrityl)-3⁰-O-[(N,N-diisopropylamino)

(2-cyanoethyl)]phosphinyl-2⁰-O-(pyren-1-ylmethanimine-

N-oxymethyl)uridine (8a)

Puriﬁed 4a (330 mg, 500 mmol) was dissolved in methanol

(3 ml), and ammonium ﬂuoride (185 mg, 5.00 mmol) was

added. The heterogenous reaction mixture was stirred at

ꢂ25^ꢀC until desilylation and dephthalimidation were

complete (16 h) as indicated by TLC [CHCl₃:MeOH

(9:1 v/v)]. The reaction product was puriﬁed by silica gel

chromatography using a gradient of MeOH (0 ! 12%) in

CH₂Cl₂as the eluent. Fractions containing the product

were collected and evaporated to dryness under low

To a solution of 7a (250 mg, 311 mmol) in anhydrous

CH₂Cl₂(3 ml) containing Et₃N (167 ml, 1.20 mmol) was

added 2-cyanoethyl N,N-diisopropylchlorophosphor-

amidite (140 ml, 622 mmol). The reaction mixture was stirred

at ꢂ25^ꢀC under argon until complete disappearance of 7a

was observed (2 h) by TLC [C₆H₆:Et₃N (9:1 v/v)]. The

reaction mixture was then poured into water (3 ml) and

was extracted with CH₂Cl₂(10 ml). The organic layer was

dried over anhydrous Na₂SO₄and then ﬁltered. The

ﬁltrate was evaporated to dryness under reduced pressure.

The crude phosphoramidite product was puriﬁed by chro-

matography on silica gel using C₆H₆:Et₃N (9:1 v/v) as the

eluent. Fractions containing the pure product were pooled

1

pressure to provide 5a. H NMR (300 MHz, DMSO-d₆):

d 11.4 (br s, 1H), 7.93 (d, J = 8.1 Hz, 1H), 6.21 (br s, 2H),

5.87 (d, J = 4.4 Hz, 1H), 5.64 (d, J = 8.1 Hz, 1H), 5.17

(t, J = 4.9 Hz, 1H), 4.74 (s, 2H), 4.11 (m, 2H), 3.88

(m, 1H), 3.65 (ddd, J = 12.0, 5.0, 3.1 Hz, 1H), 3.56 (ddd,

J = 12.0, 5.0, 3.1 Hz, 1H), 3.16 (d, J = 5.0 Hz, 1H). ¹³C

Nucleic Acids Research, 2012, Vol. 40, No. 5 2315

2⁰-O-(Aminooxymethyl)cytidine (5b)

together and evaporated to dryness under vacuum. The

material was dissolved in dry C₆H₆(3 ml) and the resulting

solution was added to cold (ꢃ78^ꢀC) stirred hexane

(100 ml). The pure ribonucleoside phosphoramidite pre-

cipitated immediately as a yellow solid. After careful

decantation of hexane, the solid was dissolved in dry

C₆H₆(3 ml); the solution was frozen and then lyophilized

under high vacuum. Et₃N-free 8a was isolated as a yellow-

ish powder (275 mg, 0.27 mmol, 88%). ³¹P NMR

(121 MHz, C₆D₆): d 151.9, 150.2. +ESI-HRMS: Calcd

for C₅₇H₅₈N₅O₁₀P (M+Na)⁺1026.3813, found 1026.3796.

Silica gel-puriﬁed 4b (351 mg, 500 mmol) was dissolved in

methanol (3 ml), and ammonium ﬂuoride (185 mg,

5.00 mmol) was added. The heterogenous reaction mixture

was stirred at ꢂ25^ꢀC until desilylation and dephthalimida-

tion were complete (16 h) as indicated by TLC

[CHCl₃:MeOH (9:1 v/v)]. A stream of air was used to

remove MeOH from the reaction mixture and was fol-

lowed by the addition of commercial concentrated aqueous

NH₃(3 ml); the resulting solution was kept at 55^ꢀC for 1 h

in a tightly closed 4-ml screw-cap glass vial. Excess

ammonia was removed under a stream of air; the material

left was puriﬁed by silica gel chromatography using a

gradient of MeOH (0 ! 25%) in CH₂Cl₂as the eluent.

Fractions containing the product were collected and eva-

porated to dryness under low pressure to give 5b. ¹H

NMR (300 MHz, DMSO-d₆): d 7.92 (d, J = 7.4 Hz, 1H),

7.26 (m, 2H), 5.83 (d, J = 3.2 Hz, 1H), 5.74 (d, J = 7.4 Hz,

1H), 5.15 (br s, 1H), 4.77 (q, J = 7.2 Hz, 2H), 4.04 (m,

2H), 3.84 (m, 2H), 3.70 (dd, J = 12.2, 2.2 Hz, 1H), 3.70

(dd, J = 12.2, 2.7 Hz, 1H). ¹³C NMR (75 MHz, DMSO-

d₆): d 165.6, 155.3, 140.9, 97.7, 94.0, 88.2, 83.9, 79.3, 68.3,

59.9. +ESI-HRMS: Calcd for C₁₀H₁₆N₄O₆[M+H]⁺

289.1143, found 289.1145.

N⁴-Acetyl-3⁰,5⁰-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-

diyl)-2⁰-O-(methylthiomethyl)cytidine (2b)

The preparation of 2b was performed with minor modiﬁca-

tions of a published procedure (22,23). To a solution of

commercial N⁴-acetyl-5⁰-O-(1,1,3,3-tetraisopropyldisiloxane-

1,3-diyl)cytidine (1b, 7.9 g, 15 mmol) in DMSO (15 ml) was

added glacial AcOH (15 ml) and Ac₂O (10 ml). The

solution was stirred at 50^ꢀC until completion of the reac-

tion (16 h), which was monitored by TLC [CHCl₃:MeOH

(95:5 v/v)]. The solution was transferred to a 2 l

Erlenmeyer ﬂask to which was added, under vigorous

stirring, a solution of K₂CO₃(31.2 g) in water (240 ml).

The precipitated material was worked-up, puriﬁed and

processed under conditions identical to those employed

in the preparation of 2a. The ribonucleoside 2b was

isolated as a white solid (8.30 g, 14.1 mmol, 94%). ¹H

NMR (300 MHz, DMSO-d₆): d 11.08 (s, 1H), 8.19 (d,

J = 7.5 Hz, 1H), 7.35 (d, J = 7.5 Hz, 1H), 5.77 (s, 1H),

5.14 (d, J = 11.2 Hz, 1H), 5.04 (d, J = 11.2 Hz, 1H), 4.44

(d, J = 4.4 Hz, 1H), 4.22 (m, 3H), 3.93 (dd, J = 13.6,

1.9 Hz, 1H), 2.16 (s, 3H), 2.14 (s, 3H), 1.08-0.95 (m,

28H). ¹³C NMR (75 MHz, DMSO-d₆): d 170.9, 162.6,

154.1, 143.1, 95.0, 88.9, 81.3, 77.0, 73.0, 67.0, 59.2, 24.2,

17.1, 17.0, 16.9, 16.8, 16.7, 16.5, 12.6, 12.4, 12.3, 12.2, 11.8.

+ESI-HRMS: Calcd for C₂₅H₄₅N₃O₇SSi₂[M+H]⁺

580.2590, found 580.2597.

2⁰-O-(Pyren-1-ylmethanimine-N-oxymethyl)cytidine (6b)

2⁰-O-(Aminooxymethyl)cytidine (5b) was prepared from

4b at a scale and under conditions identical to those

described above. After removal of excess ammonia, the

material left was suspended in MeOH (3 ml), reacted

with 1-pyrenecarboxaldehyde and processed under condi-

tions identical to those employed for the preparation of

6a. The pyrenylated ribonucleoside was puriﬁed on silica

gel using chromatographic conditions identical to those

used for the puriﬁcation of 6a affording 6b as a yellow

powder (188 mg, 375 mmol) in a yield of 75 % based on the

molar amount of starting material (4b) that was utilized.

+ESI-HRMS: Calcd for C₂₇H₂₄N₄O₆[M+H]⁺501.1769,

found 501.1769.

N⁴-Acetyl-3⁰,5⁰-O-(1,1,3,3-tetraisopropyldisiloxane-

1,3-diyl)-2⁰-O-(phthalimidooxymethyl) cytidine (4b)

N⁶-Isobutyryl-3⁰,5⁰-O-(1,1,3,3-tetraisopropyldisiloxane-

1,3-diyl)-2⁰-O-(methylthiomethyl) adenosine (2c)

The preparation and puriﬁcation of 4b were performed at

a scale and under conditions identical to those described

above for the preparation of 4a. The ribonucleoside 4b

was obtained as a solid (1.04 g, 1.48 mmol) in a yield of

74% based on the molar amount of starting material (2b)

that was utilized. ¹H NMR (300 MHz, DMSO-d₆): d 10.98

(s, 1H), 8.10 (d, J = 7.5 Hz, 1H), 7.87–7.80 (m, 4H), 7.22

(d, J = 7.5 Hz, 1H), 5.76 (s, 1H), 5.52 (d, J = 7.0 Hz, 1H),

5.45 (d, J = 7.0 Hz, 1H), 4.70 (d, J = 4.8 Hz, 1H), 4.41

(dd, J = 4.8, 4.8 Hz, 1H), 4.15 (dd, J = 12.9, 1.2 Hz,

1H), 4.00–3.88 (m, 2H), 2.10 (s, 3H), 1.04–0.89

(m, 28H). ¹³C NMR (75 MHz, DMSO-d₆): d 171.0,

162.9, 162.7, 154.0, 145.2, 134.7, 134.2, 128.5, 123.2,

122.9, 98.1, 95.0, 90.1, 80.8, 79.3, 68.3, 59.7, 24.3, 17.2,

17.12, 17.09, 17.0, 16.8, 16.7, 16.6, 12.5, 12.3, 12.2, 11.9.

+ESI-HRMS: Calcd for C₃₂H₄₆N₄O₁₀Si₂[M+H]⁺

703.2825, found 703.2825.

The preparation of 2c was performed with minor modiﬁ-

cations of a published procedure (22,23). To a solution of

commercial N⁶-isobutyryl-5⁰-O-(1,1,3,3-tetraisopropyldisi-

loxane-1,3-diyl)adenosine (1c, 8.7 g, 15 mmol) in DMSO

(23 ml) was added glacial AcOH (23 ml) and Ac₂O

(15 ml). The solution was stirred at 50^ꢀC until completion

of the reaction (16 h), which was monitored by TLC

[CHCl₃:MeOH (95:5 v/v)]. The solution was transferred

to a 2 l Erlenmeyer ﬂask to which was added, under

vigorous stirring, a solution of K₂CO₃(46.2 g) in water

(230 ml). The precipitated material was worked-up and

puriﬁed under conditions identical to those employed in

the preparation of 2a. The ribonucleoside 2c was isolated

as a white solid (8.5 g, 13.3 mmol, 89%). ¹H NMR

(300 MHz, DMSO-d₆): d 10.69 (s, 1H), 8.56 (s, 1H), 8.49

(s, 1H), 6.11 (d, J = 1 Hz, 1H), 5.00 (dd, J = 5.3, 5.2 Hz,

1H), 4.97 (d, J = 11.4 Hz, 1H), 4.91 (d, J = 11.4 Hz, 1H),

2316 Nucleic Acids Research, 2012, Vol. 40, No. 5

4.89 (d, J = 4.8 Hz, 1H), 4.08 (dd, J = 12.9, 2.5 Hz, 1H),

4.02 (dt, J = 9.0, 2.5, Hz, 1H), 3.93 (dd, J = 12.9, 2.3 Hz,

1H), 2.96 (sept, J = 6.7 Hz, 1H), 2.08 (s, 3H), 1.12 (d,

J = 6.7 Hz, 6H), 1.09-0.97 (m, 28H). ¹³C NMR

(75 MHz, DMSO-d₆): d 175.2, 151.4, 150.8, 149.9, 142.6,

124.1, 87.6, 80.8, 76.7, 73.7, 69.3, 59.9, 34.2, 19.1, 17.2,

17.1, 17.0, 16.9, 16.8, 16.7, 12.7, 12.6, 12.3, 12.1, 11.9.

+ESI-HRMS: Calcd for C₂₈H₄₉N₅O₆SSi₂[M+H]⁺

640.3015, found 640.3016.

N²-Phenoxyacetyl-3⁰,5⁰-O-(1,1,3,3-

tetraisopropyldisiloxane-1,3-diyl)-2⁰-O-(methylthiomethyl)

guanosine (2d)

The preparation of 2d was performed with minor modiﬁ-

cations of a published procedure (22,23). To a solution of

commercial N²-phenoxyacetyl-5⁰-O-(1,1,3,3-tetraisopro-

pyldisiloxane-1,3-diyl)guanosine (1d, 9.9 g, 15 mmol) in

DMSO (22.5 ml) was added glacial AcOH (22.5 ml) and

Ac₂O (15.0 ml). The solution was stirred at 50^ꢀC until

completion of the reaction (ꢂ16 h), which was monitored

by TLC [CHCl₃:MeOH (95:5 v/v)]. The solution was trans-

ferred to a 2 l Erlenmeyer ﬂask to which was added, under

vigorous stirring, a solution of K₂CO₃(51.0 g) in water

(270 ml). The precipitated material was worked-up and

puriﬁed under conditions identical to those employed in

the preparation of 2a. The ribonucleoside 2d was isolated

as a white solid (9.3 g, 13 mmol, 87 %). ¹H NMR

(300 MHz, DMSO-d₆): d 11.84 (br s, 1H), 11.83 (br s,

1H), 8.05 (s, 1H), 7.32 (d, J = 7.6 Hz, 1H), 7.30 (d,

J = 8.4 Hz, 1H), 6.98 (m, 3H), 5.91 (d, J = 1.1 Hz, 1H),

4.95 (s, 2H), 4.84 (s, 2H), 4.52 (m, 2H), 4.16 (dd, J = 12.9,

2.5 Hz, 1H), 4.06 (dt, J = 8.2, 2.5 Hz, 1H), 3.95 (dd,

J = 12.9, 2.5 Hz, 1H), 2.08 (s, 3H), 1.06–0.95 (m, 28H).

¹³C NMR (75 MHz, DMSO-d₆): d 170.7, 157.5, 154.8,

147.6, 147.3, 136.1, 129.4, 121.3, 120.5, 114.5, 86.5, 81.3,

77.8, 73.8, 68.8, 66.2, 60.0, 17.2, 17.16, 17.13, 17.1, 17.05,

17.03, 16.8, 16.74, 16.70, 12.8, 12.7, 12.6, 12.3, 12.2, 11.9.

+ESI-HRMS: Calcd for C₃₂H₄₉N₅O₈SSi₂[M+H]⁺

720.2913, found 720.2918.

N⁶-Isobutyryl-3⁰,5⁰-O-(1,1,3,3-tetraisopropyldisiloxane-1,3-

diyl)-2⁰-O-(phthalimidooxymethyl) adenosine (4c)

The preparation and puriﬁcation of 4c were performed at

a scale and under conditions identical to those described

above for the preparation of 4a. The ribonucleoside 4c

was obtained as a solid (1.24 g, 1.64 mmol) in a yield of

82% based on the molar amount of the starting material

1

(2c) that was used. H NMR (300 MHz, DMSO-d₆): d

10.72 (s, 1H), 8.59 (s, 1H), 8.45 (s, 1H), 7.84-7.74

(m, 4H), 6.06 (d, J = 1.1 Hz, 1H), 5.45 (d, J = 7.5 Hz,

1H), 5.37-5.30 (m, 3H), 4.04–3.89 (m, 3H), 2.97 (sept,

J = 6.8 Hz, 1H), 1.15 (d, J = 6.8 Hz, 3H), 1.14

(d, J = 6.8 Hz, 3H), 1.04–0.96 (m, 28H). ¹³C NMR

(75 MHz, DMSO-d₆): d 175.2, 163.0, 151.2, 150.9, 149.9,

144.3, 134.8, 134.2, 128.3, 124.3, 123.2, 122.9, 98.4, 87.7,

80.2, 77.8, 70.3, 59.9, 34.3, 19.2, 19.1, 17.1, 17.0, 16.9, 16.8,

16.7, 12.6, 12.3, 12.1. +ESI-HRMS: Calcd for

C₃₅H₅₀N₆O₉Si₂[M+H]⁺755.3251, found 755.3250.

2⁰-O-(Aminooxymethyl)adenosine (5c)

N²-Phenoxyacetyl-3’,5’-O-(1,1,3,3-

tetraisopropyldisiloxane-1,3-diyl)-2’-O-

(phthalimidooxymethyl)guanosine (4d)

The preparation of 5c from 4c was performed at a scale

and under conditions identical to those used for the prep-

aration of 5b. After removal of excess ammonia under a

stream of air, 2⁰-O-(aminooxymethyl)adenosine was puri-

ﬁed by silica gel chromatography employing a gradient of

MeOH (0 ! 10%) in CH₂Cl₂as the eluent. Fractions

containing the product were collected and evaporated

to dryness under low pressure affording 5c. ¹H NMR

(300 MHz, DMSO-d₆): d 8.38 (s, 1H), 8.13 (s, 1H), 7.37

(br s, 2H), 6.21 (br s, 2H), 6.06 (d, J = 6.0 Hz, 1H), 5.43

(m, 2H), 4.68 (q, J = 7.3 Hz, 2H), 4.67 (m, 1H), 4.33 (br s,

1H), 3.99 (q, J = 3.4 Hz, 1H), 3.68 (m, 1H), 3.57 (m, 1H).

¹³C NMR (75 MHz, DMSO-d₆): d 156.1, 152.4, 148.9,

139.7, 119.2, 98.2, 86.3, 86.1, 79.3, 69.8, 61.4.

+ESI-HRMS: Calcd for C₁₁H₁₆N₆O₅[M+H]⁺313.1255,

found 313.1256.

The preparation and puriﬁcation of 4d were performed at

a scale and under conditions identical to those described

above for the preparation of 4a. The ribonucleoside 4d

was obtained as a solid (1.10 g, 1.32 mmol) in a yield of

66% based on the molar amount of starting material (2d)

1

that was employed. H NMR (300 MHz, DMSO-d₆): d

11.81 (br s, 1H), 11.55 (br s, 1H), 8.15 (s, 1H), 7.85–7.70

(m, 4H), 7.34–7.28 (m, 3H), 6.99–6.94 (m, 3H), 5.94 (d,

J = 1.3 Hz, 1H), 5.48 (d, J = 7.0 Hz, 1H), 5.39 (d,

J = 7.0 Hz, 1H), 5.48 (dd, J = 5.2, 1.2 Hz, 1H), 4.75 (m,

2H), 4.64 (m, 1H), 4.07–3.89 (m, 3H), 1.07–0.95 (m, 28H).

¹³C NMR (75 MHz, DMSO-d₆): d 170.5, 162.9, 157.5,

154.9, 148.1, 147.2, 137.2, 134.8, 129.5, 128.3, 123.2,

121.3, 114.5, 98.4, 86.0, 80.7, 78.6, 70.2, 66.2, 60.1, 17.2,

17.1, 16.9, 16.8, 12.8, 12.6, 12.3, 12.05, 12.02. +ESI-

HRMS: Calcd for C₃₉H₅₀N₆O₁₁Si₂[M+H]⁺835.3149,

found 835.3148.

2⁰-O-(Pyren-1-ylmethanimine-N-oxymethyl)adenosine (6c)

The preparation of 5c from 4c was performed at a scale

and under conditions identical to those described above.

After removal of excess ammonia, the material left was

suspended in MeOH (3 ml), reacted with 1-pyrenecarbox-

aldehyde and processed under conditions identical to

those employed for the preparation of 6a. The pyrenylated

ribonucleoside was puriﬁed on silica gel using chromato-

graphic conditions identical to those used for the puriﬁca-

tion of 6a affording 6c in a yield of 77% (200 mg,

385 mmol) based on the molar amount of starting material

(4c) that was employed. +ESI-HRMS: Calcd for

C₂₈H₂₄N₆O₅[M+H]⁺525.1881, found 525.1882.

2⁰-O-(Aminooxymethyl)guanosine (5d)

The preparation of 5d from 4d was performed under con-

ditions identical to those used for the preparation of 5b.

After removal of excess ammonia under a stream of air, 2⁰-

O-(aminooxymethyl)guanosine was puriﬁed by silica gel

chromatography using a gradient of MeOH (0 ! 25%)

in CH₂Cl₂as the eluent. Fractions containing the product

were collected and evaporated to dryness under reduced

Nucleic Acids Research, 2012, Vol. 40, No. 5 2317

1

pressure providing 5d. H NMR (300 MHz, DMSO-d₆): d

J = 7.4 Hz, 2H), 1.66-1.22 (m, 7H). ¹³C NMR (75 MHz,

DMSO-d₆): d 172.2, 162.6, 102.0, 61.0, 59.1, 55.4, 53.1,

40.2, 39.8, 34.9, 28.1, 28.0, 25.2. +ESI-HRMS: Calcd for

C₁₄H₂₅N₃O₄S [M+H]⁺332.1639, found 332.1641.

10.77 (br s, 1H), 7.96 (s, 1H), 6.59 (br s, 2H), 5.85 (d,

J = 6.0 Hz, 1H), 5.12 (t, J = 5.2 Hz, 1H), 4.72 (m, 2H),

4.46 (dd, J = 6.0, 5.7 Hz, 1H), 4.26 (dd, J = 4.8, 4.8 Hz,

1H), 3.91 (q, J = 3.8 Hz, 1H), 3.61 (dt, J = 11.8, 4.4 Hz,

1H), 3.52 (dt, J = 11.8, 4.4 Hz, 1H). ¹³C NMR

(75 MHz, DMSO-d₆): d 156.6, 153.8, 151.1, 135.3, 116.5,

98.0, 85.6, 84.8, 79.6, 69.6, 61.1. +ESI-HRMS: Calcd for

C₁₁H₁₆N₆O₆[M+H]⁺329.1204, found 329.1211.

N-(2-Oxoethyl)biotinamide

The acetal 11 (280 mg, 850 mmol) was dissolved in MeOH

(2 ml) and commercial concentrated HCl (0.5 ml) was

added to the solution, which was allowed to stir for 1 h

at ꢂ25^ꢀC. The reaction mixture was evaporated to dryness

under reduced pressure to yield the aldehyde, the total

amount of which was used without further puriﬁcation

in the preparation of 12.

2⁰-O-(Pyren-1-ylmethanimine-N-oxymethyl)guanosine (6d)

The preparation of 5d from 4d was performed at a scale

and under conditions identical to those described above.

After removal of excess ammonia, the material left was

suspended in MeOH (3 ml), reacted with 1-pyrenecarbox-

aldehyde and processed under conditions identical to

those employed for the preparation of 6a. The pyrenylated

ribonucleoside was puriﬁed on silica gel using chromato-

graphic conditions identical to those used for the puriﬁca-

tion of 6a affording 6d in a yield of 69% (187 mg,

345 mmol) based on the molar amount of starting

material (4d) that was utilized. +ESI-HRMS: Calcd for

C₂₈H₂₄N₆O₆[M+H]⁺541.1830, found 541.1829.

Preparation of the biotinylated uridine conjugate 12

2⁰-O-(Aminooxymethyl)uridine (5a) was prepared from

silica gel-puriﬁed 4a at a scale and under conditions iden-

tical to those described for the preparation of 10. After

complete NH₄F-mediated desilylation and dephthalimida-

tion, all of the N-(2-oxoethyl)biotinamide produced above

was dissolved in MeOH (2 ml) and added to the reaction

mixture, which was heated at 55^ꢀC in a 4-ml screw-cap

glass vial until completion of the oximation reaction (1 h)

as indicated by TLC [CHCl₃:MeOH (9:1 v/v)]. The

reaction mixture was puriﬁed by chromatography on

silica gel employing a gradient of MeOH (0 ! 20%) in

CH₂Cl₂as the eluent. Fractions containing the pure

product were collected and evaporated to dryness under

reduced pressure providing 12 as a white powder (74 mg,

0.13 mmol) in a yield of 66% based on the molar amount

of starting material (4a) that was utilized. +ESI-HRMS:

Calcd for C₂₂H₃₂N₆O₉S [M+H]⁺557.2024, found

557.2024. The RP-HPLC proﬁle of 12 is shown in

Supplementary Figure S2A.

2⁰-O-(5-Cholesten-3-imine-N-oxymethyl)uridine (10)

2⁰-O-(Aminooxymethyl)uridine (5a) was prepared as de-

scribed above from silica gel-puriﬁed 4a (132 mg,

200 mmol). After complete NH₄F-mediated desilylation

and dephthalimidation of 4a, 5-cholesten-3-one (9,

154 mg, 400 mmol) was added to the reaction mixture,

which was then processed under conditions identical to

those described in the preparation of 6a. The reaction

product was puriﬁed by chromatography on silica gel

using a gradient of MeOH (0 ! 4%) in CH₂Cl₂as the

eluent. Fractions containing the pure product were col-

lected and evaporated to dryness under reduced pressure

giving 10 as a white powder (90 mg, 0.14 mmol) in a yield

of 69% based on the molar amount of starting material

(4a) that was used. +ESI-HRMS: Calcd for C₃₇H₅₇N₃O₇

[M+H]⁺656.4269, found 656.4269. The normal phase

HPLC proﬁle of 10 is shown in Supplementary Figure S1.

N-(2,2-Dimethoxyethyl)-5-(dimethylamino)naphthalene-1-

sulfonamide (13)

To a solution of dansyl chloride (270 mg, 1.00 mmol) in

CH₂Cl₂(10 ml) was added aminoacetaldehyde dimethyl

acetal (130 ml, 1.20 mmol) and Et₃N (170 ml, 1.20 mmol);

the solution was allowed to stir for 1 h at ꢂ25^ꢀC.

The reaction mixture was then evaporated to dryness

under vacuum and the material left was puriﬁed by silica

gel chromatography using a gradient of MeOH (0 ! 1%)

in CH₂Cl₂as the eluent. Fractions containing the product

were collected and evaporated to dryness under low pres-

sure affording 13 as a solid (318 mg, 940 mmol, 94%).

¹H NMR (300 MHz, DMSO-d₆): d 8.45 (dt, J = 8.5, 1.1

Hz, 1H), 8.29 (dt, J = 8.8, 0.9 Hz, 1H), 8.16 (t, J = 5.5 Hz,

1H), 8.10 (dd, J = 7.3, 1.1 Hz, 1H), 7.61 (t, J = 8.5 Hz,

1H), 7.58 (t, J = 8.5 Hz, 1H), 7.25 (dd, J = 7.6, 0.7 Hz,

1H), 4.11 (t, J = 5.5 Hz, 1H), 3.06 (s, 6H), 2.89

(t, J = 5.5 Hz, 2H), 2.81 (s, 6H). ¹³C NMR (75 MHz,

DMSO-d₆): d 151.2, 136.2, 129.3, 128.9, 127.9, 127.7,

123.5, 119.1, 115.0, 102.4, 53.3, 44.9, 43.9. +ESI-HRMS:

Calcd for C₁₆H₂₂N₂O₄S [M+H]⁺339.1373, found

339.1374.

N-(2,2-Dimethoxyethyl)biotinamide (11)

To a suspension of D-(+)-biotin 2-nitrophenyl ester

(365 mg, 1.00 mmol) in MeCN (20 ml) was added

aminoacetaldehyde dimethyl acetal (130 ml, 1.20 mmol)

and Et₃N (170 ml, 1.20 mmol). The suspension was gently

heated until a solution was obtained; the solution was then

stirred for 16 h at ꢂ25^ꢀC. The reaction mixture was

evaporated to dryness under reduced pressure and the

material left was puriﬁed by silica gel chromatography

using a gradient of MeOH (0 ! 10%) in CH₂Cl₂as the

eluent. Fractions containing the product were collected

and evaporated to dryness under low pressure affording

11 as a solid (300 mg, 910 mmol, 91%). ¹H NMR

(300 MHz, DMSO-d₆): d 7.87 (t, J = 5.8 Hz, 1H), 6.43

(s, 1H), 6.37 (s, 1H), 4.32 (t, J = 5.5 Hz, 1H), 4.28 (d,

J = 5.5 Hz, 1H), 4.12 (ddd, J = 7.6, 4.4, 1.8 Hz, 1H),

3.25 (s, 6H), 3.13 (t, J = 5.7 Hz, 2H), 2.82 (dd, J = 12.3,

12.3 Hz, 1H), 2.56 (d, J = 12.3 Hz, 1H), 2.07 (t,

2318 Nucleic Acids Research, 2012, Vol. 40, No. 5

N-(2-Oxoethyl)-5-(dimethylamino)naphthalene-1-

sulfonamide

+ESI-HRMS: Calcd for C₂₀H₃₀N₂O₄S [M+H]⁺

395.1999, found 395.2000.

The acetal 13 (287 mg, 850 mmol) was dissolved in MeOH

(1 ml) and concentrated HCl (0.5 ml) was added to the so-

lution, which was stirred for 1 h at ꢂ25^ꢀC. The reaction

mixture was then evaporated to dryness under reduced

pressure; the material left was dissolved in CH₂Cl₂

(10 ml) and the solution was washed with NaHCO₃(2 ml

of a saturated aqueous solution). The organic layer was

collected and was evaporated under low pressure to give

the aldehyde as a pale green foam, the total amount of

which was used without further puriﬁcation in the prep-

aration of 14.

N-(4-Oxobutyl)-5-(dimethylamino)naphthalene-1-

sulfonamide

This aldehyde was prepared from acetal 15 at a scale and

under conditions identical to those employed for the

preparation N-(2-oxoethyl)-5-(dimethylamino)naphthalene-

1-sulfonamide from acetal 13. N-(4-Oxobutyl)-5-(dimethyla-

mino)naphthalene-1-sulfonamide was obtained as a pale

green foam, the total amount of which was used without

further puriﬁcation in the preparation of 16.

Preparation of the dansylated uridine conjugate 16

Preparation of the dansylated uridine conjugate 14

This conjugate was prepared and puriﬁed exactly as re-

ported for the preparation and puriﬁcation of the

dansylated uridine conjugate 14. The dansylated uridine

conjugate 16 was isolated as a light green powder (96 mg,

0.16 mmol) in a yield of 81 % based on the molar amount

of starting material (4a) that was used. +ESI-HRMS:

Calcd for C₂₆H₃₃N₅O₉S [M+H]⁺592.2072, found

592.2071. The RP-HPLC proﬁle of 16 is shown in

Supplementary Figure S4A.

2⁰-O-(Aminooxymethyl)uridine (5a) was prepared from

silica gel-puriﬁed 4a at a scale and under conditions iden-

tical to those described for the preparation of 10. After

complete NH₄F-mediated desilylation and dephthalimida-

tion, all of the N-(2-oxoethyl)-5-(dimethylamino)

naphthalene-1-sulfonamide generated above was dissolved

in MeOH (1 ml) and added to the reaction mixture, which

was heated at 55^ꢀC in a 4-ml screw-cap glass vial until

completion of the oximation reaction (1 h) as indicated

by TLC [CHCl₃:MeOH (9:1 v/v)]. The reaction mixture

was then worked-up and processed exactly as described in

the preparation of 10. The product was puriﬁed by chro-

matography on silica gel employing a gradient of MeOH

(0 ! 6%) in CH₂Cl₂as the eluent. Fractions containing

the pure product were collected and evaporated to dryness

under reduced pressure to give 14 as a pale green powder

(82 mg, 0.14 mmol) in a yield of 70 % based on the molar

amount of starting material (4a) that was employed.

+ESI-HRMS: Calcd for C₂₄H₂₉N₅O₉S [M+H]⁺

564.1759, found 564.1759. The RP-HPLC proﬁle of 14 is

shown in Supplementary Figure S3A.

N-(2,2-Dimethoxyethyl)-4-(dimethylamino)azobenzene-4⁰-

sulfonamide (17)

To a solution of 4-(dimethylamino)azobenzene-4⁰-sulfonyl

chloride (324 mg, 1.00 mmol) in CH₂Cl₂(5 ml) was added

aminoacetaldehyde dimethyl acetal (130 ml, 1.20 mmol)

and Et₃N (179 ml, 1.20 mmol). The solution was allowed

to stir for 16 h at ꢂ25^ꢀC. The reaction mixture was

evaporated to dryness under reduced pressure and the

material left was puriﬁed by silica gel chromatography

using a gradient of MeOH (0 ! 2%) in CH₂Cl₂as the

eluent. Fractions containing the product were collected

and evaporated to dryness under reduced pressure afford-

ing 17 as a solid (373 mg, 950 mmol, 95%). ¹H NMR

(300 MHz, DMSO-d₆): d 7.82 (d, J = 9.3 Hz, 2H), 7.19

(m, 4H), 6.85 (d, J = 9.3 Hz, 2H), 4.29 (t, J = 5.4 Hz,

1H), 3.19 (s, 6H), 3.08 (s, 6H), 2.89 (t, J = 5.6 Hz, 2H).

¹³C NMR (75 MHz, DMSO-d₆): d 154.4, 153.0, 142.5,

140.5, 127.7, 125.3, 122.1, 111.5, 102.3, 53.3, 44.1, 39.8.

+ESI-HRMS: Calcd for C₁₈H₂₄N₄O₄S [M+H]⁺393ꢄ1591,

found 393.1596.

N-(4,4-Diethoxybutyl)-5-(dimethylamino)naphthalene-1-

sulfonamide (15)

To a solution of dansyl chloride (270 mg, 1.00 mmol) in

CH₂Cl₂(10 ml) was added 4-aminobutyraldehyde diethyl

acetal (237 ml, 1.20 mmol) and Et₃N (170 ml, 1.20 mmol).

The solution was stirred for 1 h at ꢂ25^ꢀC and was then

evaporated to dryness under low pressure. The material

left was processed and puriﬁed under conditions identical

to those described for the processing and puriﬁcation of

13. Fractions containing the product were collected and

evaporated to dryness under low pressure affording 15 as

a solid (366 mg, 930 mmol, 93%). ¹H NMR (300 MHz,

DMSO-d₆): d 8.45 (dt, J = 8.5, 1.1 Hz, 1H), 8.30 (dt,

J = 8.8, 0.9 Hz, 1H), 8.09 (dd, J = 7.3, 1.2 Hz, 1H), 7.89

(t, J = 5.5 Hz, 1H), 7.61 (t, J = 8.5 Hz, 1H), 7.58

(t, J = 8.5 Hz, 1H), 7.25 (dd, J = 7.6, 0.7 Hz, 1H), 4.19

(t, J = 5.3 Hz, 1H), 3.36 (m, 2H), 3.23 (m, 2H), 2.81 (s,

6H), 2.77 (t, J = 5.5 Hz, 2H), 1.31 (m, 4H), 0.99 (t,

J = 7.0 Hz, 6H). ¹³C NMR (75 MHz, DMSO-d₆): d

151.2, 136.1, 129.2, 128.9, 128.1, 127.7, 123.5, 119.1,

114.9, 101.6, 60.2, 44.9, 42.2, 30.1, 24.4, 15.1.

N-(2-Oxoethyl)-4-(dimethylamino)azobenzene-4⁰-

sulfonamide

The acetal 17 (287 mg, 850 mmol) was dissolved in a

solution of 10% (w/v) I₂in acetone (10 ml) (24). The re-

sulting solution was stirred at ꢂ25^ꢀC for 16 h and was

then evaporated to dryness under reduced pressure. The

material left was dissolved in CH₂Cl₂(10 ml) and washed

with an aqueous solution of 5% (w/v) sodium bisulﬁte

(5 ml) followed by a saturated aqueous solution of

NaHCO₃(5 ml). The organic layer was collected and

was evaporated to dryness under vacuum. The total

amount of the orange product was used in the preparation

of 18.

Nucleic Acids Research, 2012, Vol. 40, No. 5 2319

The dabsylated cytidine conjugate 18

gradient of MeOH (0 ! 8%) in CH₂Cl₂as the eluent.

Fractions containing 22 were collected and evaporated

under vacuum giving a yellow solid (130 mg, 250 mmol,

83%). +ESI-HRMS: Calcd for C₂₂H₂₆N₄O₉S [M+H]⁺

523.1493, found 523.1493. The RP-HPLC proﬁle of 22 is

shown in Supplementary Figure S6A.

2⁰-O-(Aminooxymethyl)cytidine (5b) was prepared from

silica gel-puriﬁed 4b (140 mg, 0.2 mmol) as described

above. After removal of excess ammonia, the material

left was suspended in MeOH (3 ml) and all of the N-(2-

oxoethyl)-4-(dimethylamino)azobenzene-4⁰-sulfonamide

produced above was suspended in MeOH (1 ml)

and added to the reaction mixture, which was heated at

55^ꢀC in a 4-ml screw-cap glass vial until completion of

the oximation reaction (1 h) as indicated by TLC

[CHCl₃:MeOH (9:1 v/v)]. The reaction mixture was

then worked-up and processed exactly as described in

the preparation of 10. The product was puriﬁed by chro-

matography on silica gel employing a gradient of MeOH

(0 ! 8%) in CH₂Cl₂as the eluent. Fractions containing

the pure product were collected and evaporated to dryness

under reduced pressure providing 18 as an orange powder

(74 mg, 0.12 mmol) in a yield of 61% based on the molar

amount of starting material (4b) that was employed.

+ESI-HRMS: Calcd for C₂₆H₃₂N₈O₈S [M+H]⁺

617.2137, found 617.2134. The RP-HPLC proﬁle of 18 is

shown in Supplementary Figure S5A.

3⁰-O-(Levulinyl)-5⁰-O-(methylthiomethyl)-2⁰-

deoxythymidine (23)

To a solution of commercial 3⁰-O-(levulinyl)-2⁰-deoxy-

thymidine (3.0 g, 8.8 mmol) in DMSO (9 ml) was added

glacial AcOH (13 ml) and Ac₂O (9 ml). The solution was

stirred at ꢂ50^ꢀC until completion of the reaction (16 h),

which was monitored by TLC [CHCl₃:MeOH (95:5 v/v)].

AcOH and Ac₂O were evaporated under vacuum and the

remaining material was mixed with 15 g of silica gel.

Residual DMSO was allowed to evaporate from the

silica gel over a period of 16 h at room temperature. The

silica gel mix was layered on the top of a glass column

packed with silica gel. The product was eluted using a

gradient of MeOH (0 ! 3%) in CH₂Cl₂as the eluent.

Fractions containing pure 23 were collected, evaporated

to a foam under low pressure, and dissolved in dry C₆H₆

(ꢂ20 ml); the solution was frozen and then lyophilized

under high vacuum affording a white powder (2.8 g,

7.0 mmol, 80%). ¹H NMR (300 MHz, DMSO-d₆): d.

11.33 (s, 1H), 7.55 (s, 1H), 6.19 (t, J = 6.2 Hz, 1H), 5.18

(d, J = 5.6 Hz, 1H), 4.74 (s, 2H), 4.11 (s, 1H), 3.69 (s, 2H),

3.31 (s, 1H), 2.74 (t, J = 6.2 Hz, 2H), 2.50 (t, J = 6.2 Hz,

2H), 2.27 (m, 3H), 2.11 (s, 3H), 2.10 (s, 3H), 1.79 (s, 3H).

¹³C NMR (75 MHz, DMSO-d₆): d 206.7, 171.9, 163.5,

150.3, 135.4, 109.8, 83.7, 82.2, 74.8, 74.7, 67.6, 37.3,

35.9, 29.4, 27.6, 13.4, 12.6. +ESI-HRMS: Calcd for

C₁₇H₂₄N₂O₇S [M+H]⁺401.1377, found 401.1379.

N-(4-Cyanobut-1-yl)-5-(dimethylamino)naphthalene-1-

sulfonamide (20)

4-Aminobutyronitrile was prepared from the reaction of

4-chlorobutyronitrile (207 mg, 2.00 mmol) with potassium

phthalimide (407 mg, 2.20 mmol) under the conditions

described by McKay et al. (25) with the following modi-

ﬁcation: the crude 4-aminobutyronitrile, instead of puriﬁed

4-aminobutyronitrile hydrochloride, was reacted with a

stirred solution of dansyl chloride (135 mg, 500 mmol) in

CH₂Cl₂(1 ml) for 10 min at ꢂ25^ꢀC. The reaction product

was analyzed by TLC [CHCl₃:MeOH (95:5 v/v)] and was

puriﬁed by chromatography on silica gel using a gradient

of MeOH (0 ! 3%) in CH₂Cl₂as the eluent. Fractions

containing 20 were collected and evaporated under

vacuum affording the pure product (123 mg, 390 mmol)

in a yield of 78% based on the molar amount of dansyl

chloride used in the reaction. ¹H NMR (300 MHz,

DMSO-d₆): d 8.47 (dt, J = 8.5, 1.1 Hz, 1H), 8.28 (dt,

J = 8.5, 1.1 Hz, 1H), 8.11 (dd, J = 7.2, 1.2 Hz, 1H), 8.02

(t, J = 5.8 Hz, 1H), 7.63 (t, J = 7.5 Hz, 1H), 7.60

(t, J = 7.5 Hz, 1H), 7.26 (dd, J = 7.5, 0.7 Hz, 1H), 2.85

(m, 2H), 2.82 (s, 6H), 2.39 (t, J = 7.0 Hz, 2H), 1.60

(quint, J = 7.0 Hz, 2H). ¹³C NMR (75 MHz, DMSO-d₆):

d 151.3, 135.5, 129.5, 129.0, 128.9, 128.3, 127.8, 123.5,

119.9, 118.8, 115.1, 44.9, 40.9, 25.2, 13.4. +ESI-HRMS:

Calcd for C₁₆H₁₉N₃O₂S [M+H]⁺318.1271, found

318.1271.

3⁰-O-(Levulinyl)-5⁰-O-(phthalimidooxymethyl)-2⁰-

deoxythymidine (24)

To a solution of thoroughly dried 23 (2.8 g, 7.0 mmol) in

anhydrous CH₂Cl₂(70 ml) was added neat sulfuryl

chloride (626 ml, 7.73 mmol); the solution was stirred at

ꢂ25^ꢀC for 2 h and was then concentrated under reduced

pressure to give 5⁰-O-chloromethyl-3⁰-O-levulinyl-2⁰-O-

deoxythymidine

as

an

amorphous

solid.

N-

Hydroxyphthalimide (4.58 g, 28.1 mmol) was placed into

a separate reaction vessel to which was added anhydrous

CH₂Cl₂(35 ml) and DBU (3.60 ml, 24.6 mmol). After

10 min, the red solution was added to unpuriﬁed 5⁰-O-

chloromethyl-3⁰-O-levulinyl-2⁰-O-deoxythymidine; the re-

action mixture was kept stirring at ꢂ25^ꢀC for 24 h at

which point CH₂Cl₂(150 ml) was added. The solution

was extracted twice with aqueous 1 M acetic acid

(30 ml); the organic phase was collected, washed with a

saturated aqueous solution of NaHCO₃(3 ꢁ 100 ml),

dried over anhydrous Na₂SO₄, ﬁltered, and evaporated

to a foamy solid under reduced pressure. The crude prod-

uct was puriﬁed by chromatography on silica gel using a

gradient of MeOH (0 !3%) in CH₂Cl₂as the eluent.

Fractions containing 24 were collected and evaporated

2⁰-O-[5-(Dimethylamino)naphthalene-1-sulfonamidyl-N-

oxymethyl]uridine (22)

Silica gel-puriﬁed 2⁰-O-(aminooxymethyl)uridine (5a,

87 mg, 0.30 mmol) was dissolved in pyridine (2 ml) and

dansyl chloride (135 mg, 500 mmol) was added. The

solution was stirred at ꢂ25^ꢀC for 2 h and was then

evaporated to dryness under vacuum. The crude product

22 was puriﬁed by silica gel chromatography using a

1

under vacuum to give a solid (2.1 g, 4.1 mmol, 58%). H

NMR (300 MHz, DMSO-d₆): d 11.31 (s, 1H), 7.87 (s, 4H),

2320 Nucleic Acids Research, 2012, Vol. 40, No. 5

7.48 (s, 1H), 6.17 (dd, J = 6.0, 2.5 Hz, 1H), 5.24 (m, 3H),

4.13 (m, 3H), 2.75 (t, J = 6.2 Hz, 2H), 2.50 (m, 2H), 2.25

(m, 2H), 2.12 (s, 3H), 1.64 (s, 3H). ¹³C NMR (75 MHz,

DMSO-d₆): d 206.7, 171.8, 163.4, 163.1, 150.3, 135.6,

134.8, 128.4, 123.2, 109.6, 100.0, 83.7, 81.8, 74.3, 69.3,

37.3, 35.6, 29.4, 27.6, 11.9.+ESI-HRMS: Calcd for

C₂₄H₂₅N₃O₁₀[M+H]⁺516.1613, found 516.1618.

pressure. The crude phosphoramidite product was puriﬁed

by chromatography on silica gel using C₆H₆:Et₃N (9:1 v/v)

as the eluent. Fractions containing the pure product were

pooled together and evaporated to dryness under vacuum.

The material was dissolved in dry C₆H₆(4 ml) and the

resulting solution was added to cold (ꢃ78^ꢀC) stirred

hexane (100 ml). The pure deoxyribonucleoside phosphor-

amidite precipitated immediately as a yellowish solid.

After careful decantation of hexane, the solid was

dissolved in dry C₆H₆(4 ml); the solution was frozen

and then lyophilized under high vacuum. Et₃N-free 27

was isolated as a yellowish powder (451 mg, 640 mmol,

92%). ³¹P NMR (121 MHz, C₆D₆): d 148.1, 147.7.

+ESI-HRMS: Calcd for C₃₇H₄₂N₅O₇P (M+H)⁺

700.2895, found 700.2904.

5⁰-O-(Aminooxymethyl)-2⁰-deoxythymidine (25)

Under an inert atmosphere, 1 M hydrazine hydrate in

pyridine:acetic acid (3:2 v/v, 7.3 ml) was added to a

solution of 24 (1.2 g, 2.3 mmol) in anhydrous pyridine

(11 ml). The reaction mixture was stirred for 1 h at 25^ꢀC

and was then concentrated under vacuum to a volume of

ꢂ3 ml. The crude product was puriﬁed by chromatog-

raphy on silica gel using a gradient of MeOH (0 !3%)

in CH₂Cl₂as the eluent. Fractions containing 25 were col-

lected and evaporated under vacuum to give a solid

2⁰-O-[2-(Methylthio)ethanimine-N-oxymethyl]uridine (28)

Commercial 2-methylthioacetaldehyde dimethylacetal was

converted in situ to methylthiomethylacetaldehyde under

conditions identical to those employed for the preparation

of N-(2-oxoethyl)biotinamide with the exception of the

reaction scale, which was 10-fold larger. The acidic

solution of methylthioacetaldehyde in aqueous methanol

was used without workup in the preparation of 28. 2⁰-O

(Aminooxymethyl)uridine (5a) was prepared from silica

gel-puriﬁed 4a at a scale of 2 mmol under conditions

identical to those described for the preparation of 6a.

After complete NH₄F-mediated desilylation and

dephthalimidation, all of the acidic methylthioace-

taldehyde solution prepared above was added to the

reaction mixture, which was heated at 55^ꢀC in a 4-ml

screw-cap glass vial until completion of the oximation

reaction (1 h) as indicated by TLC [CHCl₃:MeOH (9:1

v/v)]. The reaction mixture was puriﬁed by chromatog-

raphy on silica gel employing a gradient of MeOH (0 !

5%) in CH₂Cl₂as the eluent. Fractions containing the

pure product were collected and evaporated to dryness

under reduced pressure providing 28 as a white powder

(557 mg, 1.54 mmol) in a yield of 77% based on the molar

amount of starting material (4a) that was utilized. ¹H

NMR (300 MHz, DMSO-d₆): d 11.31 (br s, 1H), 7.87

(d, J = 8.1 Hz, 0.25H), 7.85 (d, J = 8.1 Hz, 0.75H), 7.34

(t, J = 6.7 Hz, 0.75H), 6.89 (t, J = 6.0 Hz, 0.25H), 5.90 (d,

J = 5.9 Hz, 0.75H), 5.88 (d, J = 5.9 Hz, 0.25H)), 5.66 (d,

J = 8.1 Hz, 0.75H), 5.65 (d, J = 8.1 Hz, 0.25H), 5.22-5.11

(m, 3H), 5.05 (d, J = 7.8 Hz, 1H), 4.25 (dt J = 5.5, 5.3 Hz,

1H), 4.13 (m, 1H), 3.87 (dt, J = 3.3, 3.1 Hz, 1H), 3.65-3.51

(m, 2H), 3.28 (ddd, J = 6.4, 5.9, 5.7 Hz, 1H), 3.11 (ddd,

J = 6.9, 6.6, 6.5 Hz, 1H), 2.01 (s, 0.75H), 1.96 (s, 2.25H).

¹³C NMR (75 MHz, DMSO-d₆): d 162.9, 150.4, 149.5,

149.0, 140.5, 101.9, 101.8, 95.7, 95.6, 85.9, 85.7, 85.3,

85.2, 78.7, 78.5, 68.7, 68.6, 60.8, 60.7, 30.9, 26.4, 14.6, 13.8.

1

(318 mg, 1.11 mmol, 48%). H NMR (300 MHz, DMSO-

d₆): d 11.27 (br s, 1H), 7.61 (s, 1H), 6.19 (dd, J = 6.5,

2.5 Hz, 1H), 5.30 (br s, 2H), 4.70 (s, 2H), 4.26 (br s,

1H), 3.90 (br s, 1H), 3.71 (m, 3H), 2.12 (m, 2H), 1.78 (s,

3H). ¹³C NMR (75 MHz, DMSO-d₆): d 163.6, 150.3,

135.9, 109.4, 98.5, 85.2, 83.8, 70.6, 67.7, 39.0, 12.1.

+ESI-HRMS: Calcd for C₁₁H₁₇N₃O₆[M+H]⁺288.1190,

found 288.1196.

5⁰-O-(Pyren-1-ylmethanimine-N-oxymethyl)-2⁰-

deoxythymidine (26)

A solution of 25 (300 mg, 1.05 mmol) and 1-pyrenecarbox-

aldehyde (1.1 g, 5.0 mmol) in MeOH (2 ml) was heated

at 55^ꢀC in a 4-ml screw-cap glass vial until completion

of the oximation reaction (1 h) as indicated by TLC

[CHCl₃:MeOH (9:1 v/v)]. The reaction mixture was trans-

ferred to a 20-ml screw-cap glass vial to which was added

CH₂Cl₂(7 ml) and a saturated aqueous solution of

NaHCO₃(2 ml); after vigorous shaking the organic

phase was collected and evaporated to dryness under

vacuum. The pyrenylated product was puriﬁed by chro-

matography on silica gel employing a gradient of MeOH

(0 ! 5%) in CH₂Cl₂as the eluent. Fractions containing

the pure product were collected and evaporated to dryness

under reduced pressure affording 26 as a yellowish powder

(400 mg, 800 mmol, 80%). +ESI-HRMS: Calcd for

C₂₈H₂₅N₃O₆[M+Na]⁺522.1636, found 522.1642.

5⁰-O-(Pyren-1-ylmethanimine-N-oxymethyl)-3’-O-[(N,N-

diisopropylamino) (2-cyanoethyl)]phosphinyl-2⁰-

deoxythymidine (27)

To

a

solution of 5⁰-O-(pyren-1-ylmethanimine-N-

oxymethyl)-2⁰-deoxythymidine (26, 350 mg, 700 mmol) in

anhydrous CH₂Cl₂(5 ml), containing Et₃N (0.39 ml,

2.8 mmol), was added 2-cyanoethyl N,N-diisopropylchlor-

ophosphoramidite (0.31 ml, 1.4 mmol). The reaction

mixture was stirred at ꢂ25^ꢀC under argon until complete

disappearance of 26 (2 h) was conﬁrmed by TLC

[C₆H₆:Et₃N (9:1 v/v)]. The reaction mixture was then

poured into water (5 ml) and was extracted with CH₂Cl₂

(15 ml). The organic layer was dried over anhydrous

Na₂SO₄, ﬁltered and evaporated to dryness under reduced

5⁰-O-(4,4⁰-Dimethoxytrityl)-2⁰-O-[2-

(methylsulﬁnyl)ethanimine-N-oxymethyl]uridine (29)

To a solution of 28 (500 mg, 1.38 mmol) in methanol

(20 ml) was added 30% H₂O₂(5 ml). The solution was

allowed to stir at ꢂ25^ꢀC until completion of the reaction

(2 h) as monitored by TLC [(CHCl₃:MeOH (9:1 v/v)]. The

reaction mixture was evaporated to dryness under reduced

Nucleic Acids Research, 2012, Vol. 40, No. 5 2321

pressure and the residue was puriﬁed by chromatography

on silica gel using a gradient of CH₃OH (0!7%) in

CH₂Cl₂. Fractions containing the pure product were col-

lected and evaporated to a foam under low pressure. The

oxidized material was dried by co-evaporation with an-

hydrous pyridine (3 ꢁ 5 ml) under reduced pressure. Dry

pyridine (10 ml) was added and was followed by

4,4⁰-dimethoxytrityl chloride (474 mg, 1.40 mmol). TLC

analysis [(CHCl₃:MeOH (95:5 v/v)] of the reaction

showed a complete reaction within 16 h at ꢂ25^ꢀC. The

reaction mixture was then poured into a saturated solution

of NaHCO₃(200 ml) and was extracted with CH₂Cl₂

(3 ꢁ 150 ml). The combined organic layers were dried

over anhydrous Na₂SO₄. Following ﬁltration, the ﬁltrate

was evaporated under reduced pressure and the material

left was puriﬁed by chromatography on silica gel using a

gradient of CH₃OH (0!2%) in CH₂Cl₂containing 0.2%

Et₃N as the eluent. Fractions containing pure 29 were

collected and evaporated to a foam under low pressure.

The puriﬁed product was dissolved in dry C₆H₆(10 ml);

the resulting solution was frozen and was then lyophilized

under high vacuum to provide 29 as a powder (830 mg,

1.22 mmol, 89%). The stereochemical complexity of 29

precluded its facile characterization by NMR spectros-

copy. The ribonucleoside 29 was characterized as its

3⁰-phosphoramidite derivative 30.

GUCAUG)dT (32) [U* and dT correspond to 2⁰-O-

(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2⁰-de-

oxythymidine residues, respectively] and 5⁰-r(UAUCCG

UAGCUAACGUCAUG)dT (33) were conducted on a

scale of 0.2 mmole in the ‘trityl-off’ mode using a

succinyl long chain alkylamine controlled-pore glass

(CPG) support functionalized with 2⁰-deoxythymidine

as the leader nucleoside. The syntheses were carried out

using a DNA/RNA synthesizer and commercial 2⁰-O-

(tert-butyldimethylsilyl) A^Pac, G^Pac, C^Acand U phosphor-

amidite monomers (Pac and Ac correspond to

phenoxyacetyl and acetyl, respectively), which were dis-

solved in dry MeCN to give 0.15 M solutions. The

pyrenylated ribonucleoside phosphoramidite 8a was also

used as a 0.15 M solution in dry MeCN. 5-Benzylthio-1H-

tetrazole (0.25 M in MeCN) and all other ancillary

reagents necessary for oligonucleotide synthesis were

obtained from commercial sources. The reaction time for

each phosphoramidite coupling step was set to 5 min. The

dedimethoxytritylation, capping and oxidation steps of

any synthesis cycle were each performed over a period

of 60 s.

Solid-phase synthesis of modiﬁed DNA sequences

The solid-phase syntheses of 5⁰-d(T*ATCCGTAGCTAA

CGTCATGT) [T* corresponds to 5⁰-O-(pyren-

1-ylmethanimine-N-oxymethyl)-2⁰-deoxythymidine] (34)

and 5⁰-d(TATCCGTAGCTAACGTCATGT) (35) were

carried out using the 5⁰-pyrenylated deoxyribonucleoside

phosphoramidite 27 and commercial dA^Pac, dG^Pac, dC^Ac

and dT phosphoramidite monomers, as 0.1 M solutions in

dry MeCN, under conditions identical to those employed

in the syntheses of 31–33 with the following exceptions: (i)

5⁰-O-(4,4’-Dimethoxytrityl)-3⁰-O-[(N,N-diisopropylamino)

(2-cyanoethyl)]phosphinyl-2⁰-O-[2-

(methylsulﬁnyl)ethanimine-N-oxymethyl]uridine (30)

This compound was prepared from 29, puriﬁed and pro-

cessed under conditions similar to those described for the

preparation of the phosphoramidite 8a. The

phosphoramidite 30 was isolated as a white powder

(801 mg, 0.91 mmol, 83%). ³¹P NMR (121 MHz, C₆D₆):

d 151.7, 151.6, 150.5, 150.1, 150.0. +ESI-HRMS: Calcd

for C₄₃H₅₄N₅O₁₁PS (M+Na)⁺902.3170, found 902.3187.

1

H-tetrazole (0.45 M in MeCN) was used for

phosphoramidite activation; (ii) the reaction time for

each phosphoramidite coupling step was set to 3 min

and; (iii) the dedimethoxytritylation, capping and oxida-

tion steps of any synthesis cycle were each performed over

a period of 60 s, 30 s and 30 s, respectively.

General procedure for the removal of functional

groups from the ribonucleoside conjugates 6a–d,

12, 14, 16 and 18

Solid-phase synthesis of r(U₂₀)dT (37) from the

phosphoramidite derivative of a reversible uridine

2⁰-conjugate

Puriﬁed 6a (5.0 mg, 10 mmol) was placed in a 4-ml screw-

cap glass vial and 0.5 M TBAF in THF (100 ml) was

added. The tightly closed vial was heated at 55^ꢀC;

progress of the reaction was monitored by RP-HPLC.

Excess solvent was removed under a stream of air; the

material left was dissolved in HPLC buffer A (0.1 M

triethylammonium acetate, pH 7.0, 500 ml). An aliquot

(2 ml) was analyzed by RP-HPLC according to the follow-

ing conditions: starting from 0.1 M triethylammonium

acetate pH 7.0, a linear gradient of 1% MeCN/min was

pumped at a ﬂow rate of 1 ml/min for 40 min; the gradient

was then increased to 6% MeCN/min for 10 min at the

same ﬂow rate and was kept isocratic for an additional

15 min. Peak heights were normalized to the highest peak,

which was set to 1 AU.

The solid phase syntheses of r(U⁺₂₀)dT (36) [U⁺and dT

correspond

to

2⁰-O-[2-(methylsulﬁnyl)ethanimine-N-

oxymethyl]uridine and 2⁰-deoxythymidine residues, respect-

ively] and the corresponding control sequence

r(U₂₀)dT (37) were conducted using the 2⁰-O-[2-(methylsul-

ﬁnyl)ethanimine-N-oxymethyl]uridine phosphoramidite 30

and commercial 2⁰-O-(tert-butyldimethylsilyl)uridine

phosphoramidite monomers, respectively, as 0.2 M solu-

tions in dry MeCN, under conditions identical to those

employed in the syntheses of 31–33 with the exception of

the coupling reaction time for phosphoramidite 30, which

was set to 3 min.

Deprotection and characterization of the chimeric RNA

sequences

Solid-phase synthesis of modiﬁed chimeric RNA sequences

The solid phase syntheses of 5⁰-r(U*AUCCGUAGCUAA

CGUCAUG)dT (31) and 5⁰-r(U*AUCCGUAGCU*AAC

The solid-phase-linked 5⁰-dedimethoxytritylated RNA

oligonucleotide (31, 32 or 33) was placed into a 4 ml

2322 Nucleic Acids Research, 2012, Vol. 40, No. 5

screw-capped glass vial to which was added concentrated

aqueous NH₃(1 ml). The suspension was shaken occasion-

ally over a period of 30 min at ꢂ25^ꢀC. The ammoniacal

solution was then transferred to another 4 ml glass screw-

capped and was left standing at ꢂ25^ꢀC for 16 h. A sample

of the ammoniacal solution (5 OD₂₆₀) was evaporated to

dryness using a stream of air. The oligonucleotide was

then dissolved in DMSO (50 ml) and Et₃Nꢅ3HF (65 ml)

was added to the solution, which was heated to for 2.5 h

at 65 ^ꢀC. The solution was then concentrated under a

stream of air, diluted in 0.1 M triethylammonium acetate

pH 7.0 and puriﬁed by RP-HPLC using a 5 mm Supelcosil

LC-18S column (25 cm ꢁ 4.6 mm) under the following

conditions: starting from 0.1 M triethylammonium

acetate pH 7.0, a linear gradient of 1% MeCN/min was

pumped at a ﬂow rate of 1 ml/min for 40 min and was then

held, isocratically, for 20 min. Fractions containing the

pyrenylated (31 or 32) or unmodiﬁed oligonucleotide

(33) were pooled together, concentrated to a volume of

ꢂ250 ml and loaded onto a PD-10 (Sephadex G-25M)

column. The oligonucleotide was eluted from the column

using DEPC-treated H₂O as the eluent. Fractions of 1 ml

were collected and those containing the RNA oligomer

(A₂₆₀) were pooled together for analysis by RP-HPLC

and characterization by mass spectrometry. –MALDI-

TOF MS (31): Calcd for C₂₁₇H₂₃₉N₇₅O₁₄₇P₂₀[M ꢃ H]⁺

6868, found 6868. –MALDI-TOF MS (32): Calcd for

C₂₃₅H₂₅₀N₇₆O₁₄₈P₂₀[M ꢃ H]⁺7125, found 7126.

–MALDI-TOF MS (33): Calcd for C₁₉₉H₂₂₈N₇₄O₁₄₆P₂₀

[M ꢃ H]⁺6611, found 6611. Samples (1 OD₂₆₀) of the

puriﬁed and desalted oligoribonucleotides 31 and 32

were evaporated to dryness using a stream of air and

were treated with 0.5 M TBAF in DMSO (0.1 ml) for 2 h

at 55^ꢀC. Each solution was diluted using 0.1 M

triethylammonium acetate pH 7.0 (1 ml) and desalted as

described above through a PD-10 column prior to

RP-HPLC analysis and characterization by mass spec-

trometry. –MALDI-TOF MS (31!33): Calcd for

found 6633. –MALDI-TOF MS (35): Calcd for

C₂₀₅H₂₄₀N₇₄O₁₂₆P₂₀[M ꢃ H]⁺6375, found 6372.

A sample (1 OD₂₆₀) of the puriﬁed and desalted

oligodeoxyribonucleotide 34 was evaporated to dryness

using a stream of air and was treated with 0.5 M TBAF

in DMSO (0.1 ml) for 1 h at 55^ꢀC. After diluting the

solution with 0.1 M triethylammonium acetate pH 7.0

(1 ml), the solution was desalted as described above

through a PD-10 column prior to RP-HPLC analysis

(Supplementary Figure S7) and characterization by mass

spectrometry. –MALDI-TOF MS (34!35): Calcd for

C₂₀₅H₂₄₀N₇₄O₁₂₆P₂₀[M ꢃ H]⁺6375, found 6378.

Deprotection of r(U⁺₂₀)dT (36) and characterization

of its conversion to r(U₂₀)dT (37)

The solid-phase-linked 5⁰-dedimethoxytritylated RNA

oligonucleotide 36 or 37 was placed into a 4 ml screw-

capped glass vial to which was added concentrated

aqueous NH₃(1 ml). The suspension was shaken occasion-

ally over a period of 30 min at ꢂ25^ꢀC. The ammoniacal

solution was then transferred to another 4 ml glass

screw-capped and was evaporated to dryness using a

stream of air. The oligonucleotide was then dissolved

with 0.5 M TBAF in DMSO (0.1 ml) and was heated for

16 h at 55^ꢀC. After diluting the solution with 0.1 M

triethylammonium acetate pH 7.0 (1 ml), the solution

was desalted, as described above, through a PD-10

column prior to RP-HPLC analysis (Figure 6) and char-

acterization by mass spectrometry. –MALDI-TOF MS

(36!37): Calcd for C₁₉₀H₂₁₄N₄₂O₁₆₅P₂₀[M ꢃ H]⁺6344,

found 6349. –MALDI-TOF MS (37): Calcd for

C₁₉₀H₂₁₄N₄₂O₁₆₅P₂₀[M ꢃ H]⁺6344, found 6350.

RESULTS AND DISCUSSION

Synthesis and oximation of 2⁰-O-aminooxymethyl

ribonucleosides

C₁₉₉H₂₂₈N₇₄O₁₄₆P₂₀[M ꢃ H]⁺6611, found 6613.

–

The preparation of the pyrenylated ribonucleosides 6a–d

from commercially available ribonucleosides (1a–d) is

outlined in Scheme 1. The reaction of 1a–d with DMSO,

acetic anhydride and acetic acid produced the ribonucleo-

side 2⁰-thioacetals 2a–d in yields of 85–94%; these acetals

were efﬁciently converted to their chloromethyl ether de-

rivatives (3a–d) by treatment with sulfuryl chloride (26,27)

in CH₂Cl₂and were isolated, without puriﬁcation, as

amorphous materials. The addition of a pre-mixed solu-

tion of N-hydroxyphthalimide and a limiting amount of

DBU (ꢂ0.9 molar equiv) in CH₂Cl₂to 3a-d gave the 2’-O-

phthalimidooxymethyl ribonucleosides 4a–d in yields of

66–94% relative to the molar amounts of 2a–d that were

used as starting materials. Desilylation and, unexpectedly,

dephthalimidation of 4a–d occurred when treated with

a suspension of NH₄F in MeOH (23), thereby affording

the novel 2⁰-O-aminooxymethyl ribonucleosides 5a–d after

N-deacylation of the nucleobases upon exposure to

concentrated aqueous NH₃. For characterization

purposes, analytical samples of 5a–d were puriﬁed by

MALDI-TOF

MS

(32!33):

Calcd

for

C₁₉₉H₂₂₈N₇₄O₁₄₆P₂₀[M ꢃ H]⁺6611, found 6611.

Deprotection and characterization of DNA sequences

The solid-phase-linked 5⁰-dedimethoxytritylated 5⁰-

pyrenylated oligodeoxyribonucleotide 34 or DNA oligo-

nucleotide 35 was placed into a 4 ml screw-capped glass

vial to which was added concentrated aqueous NH₃(1 ml).

The suspension was shaken occasionally over a period of

30 min at ꢂ25^ꢀC. The ammoniacal solution was then

transferred to another 4 ml glass screw-capped and was

left standing at ꢂ25^ꢀC for 16 h. A sample of the ammoni-

acal solution (1 OD₂₆₀) was evaporated to dryness using a

stream of air, redissolved in 0.1 M triethylammonium

acetate pH 7.0 and puriﬁed by RP-HPLC under condi-

tions identical to those used for the puriﬁcation of 31–

33. The puriﬁed DNA sequences were desalted under con-

ditions identical to those used for the RNA sequences and

were analyzed by RP-HPLC (Supplementary Figure S7)

and characterized by mass spectrometry. –MALDI-TOF

MS (34): Calcd for C₂₂₃H₂₅₁N₇₅O₁₂₇P₂₀[M ꢃ H]⁺6632,

1

silica gel chromatography and were analyzed by H and

¹³C NMR spectroscopies and high resolution mass spec-

trometry (HRMS). Otherwise, unpuriﬁed 5a–d was

Nucleic Acids Research, 2012, Vol. 40, No. 5 2323

reacted with 1-pyrenecarboxaldehyde in MeOH and

afforded the pyrenylated ribonucleoside conjugates 6a–d

in post-puriﬁcation yields of 69–82%; the identities of

6a–d were conﬁrmed by HRMS analysis. It should be

noted that partial deacylation of the nucleobases

occurred during the desilylation and dephthalimidation

of 4b–d. However, if required, N-acylation of the

nucleobases can be easily achieved by transient protection

of the hydroxyl functions of 6b–d by treatment with

chlorotrimethylsilane in dry pyridine followed by reac-

tion with the desired acylating reagent as described by

Ti et al. (28). It is also worth noting that when the

desilylation of 4a was effected by treatment with 0.5 M

TBAF in THF, uridine was the only nucleosidic product

detected by RP-HPLC analysis of the deprotection

reaction. Similarly, when 4a was successively treated

with hydrazine hydrate to release the aminooxymethyl

function and with NH₄F in methanol to desilylate the

5⁰-and 3⁰-hydroxy groups, RP-HPLC analysis of the reac-

tion revealed only uridine as the nucleosidic product.

Further investigations are necessary to fully assess the

mechanistic implications of these ﬁndings, which convin-

cingly underscore the uniqueness of the concomitant

desilylation and dephtalimidation of 4a–d by NH₄F in

MeOH.

With the intent of further substantiating the versatility

of 4a–d in the preparation of ribonucleoside 2⁰-conjugates,

the ribonucleoside 4a was converted to 2⁰-O-aminooxy-

methyl uridine (5a), as described above, by treatment

with NH₄F/MeOH, and was reacted with either

cholesten-3-one (9) or with aldehydes derived from N-

(2,2-dimethoxyethyl)biotinamide (11), N-(2,2-dimethoxy-

ethyl)-5-(dimethylamino)-naphthalene-1-sulfonamide (13)

and N-(4,4-diethoxybutyl)-5-(dimethylamino)naphthalene-

1-sulfonamide (15) to give the uridine 2⁰-conjugates 10,

12, 14 and 16, respectively (Figure 1). The reaction of 2⁰-

O-aminooxymethyl cytidine (5b) with the aldehyde

derived from N-(2,2-dimethoxyethyl)-4-(dimethylamino)-

azobenzene-4⁰-sulfonamide (17) afforded the cytidine

2⁰-conjugate 18 (Figure 1). The acetals 11, 13, 15 and 17

were conveniently prepared from the reaction of amino-

acetaldehyde dimethyl acetal or 4-aminobutyraldehyde

diethyl acetal with D-(+)-biotin 2-nitrophenyl ester,

dansyl chloride and dabsyl chloride in the presence of

triethylamine. These acetals were isolated in yields of

91–95%. The equilibrium between acetals 11, 13, 15 and

their corresponding aldehydes upon exposure to

concentrated HCl in MeOH led to efﬁcient conjugation

with 5a to provide the conjugates 12, 14 and 16 in

isolated yields of 66–81%. The acetal 17 did not signiﬁ-

cantly convert to the aldehyde under acidic conditions

presumably because protonation of the acetal’s azo

function might have considerably decreased its solubility

in MeOH. This shortcoming was avoided by the reaction

of 17 with a solution of 10% iodine in acetone as

described in the literature (24); under these conditions,

the crude N-(2-oxoethyl)-4-(dimethylamino)azobenzene-

4⁰-sulfonamide was obtained and, without further puriﬁ-

cation, was reacted with the 2⁰-O-aminooxymethyl

ribonucleoside 5b. The cytidine 2⁰-conjugate 18 was

obtained in a yield exceeding 60%.

Reversibility of ribonucleoside 2⁰-conjugates to their

ribonucleoside precursors

Ribonucleoside 2⁰-conjugates 6a–d, 12, 14, 16 and 18 are

stable conjugates, which can be conveniently and efﬁcient-

ly converted to their native ribonucleoside precursors upon

treatment with 0.5 M TBAF in THF. A proposed mech-

anism for these transformations is shown in Scheme 2 and

is supported by representative RP-HPLC proﬁles illustrat-

ing the conversion of 6a, 12 and 14 to uridine (Figure 2,

Supplementary Figures S2 and S3, respectively). The RP-

HPLC chromatograms demonstrate the formation of

pyrene-1-carbonitrile (19) and N-(4-cyanobut-1-yl)-5-

(dimethylamino)naphthalene-1-sulfonamide (20, Figure 3)

as side products from the ﬂuoride-assisted cleavage of

the 2⁰-iminooxymethyl ether function from 6a and 16, re-

spectively (Figure 2 and Supplementary Figure S4). The

identities of 19 and 20 were conﬁrmed by their RP-HPLC

retention times (t_R= 61.5 and 48.2 min, respectively),

which were found identical to those of authentic commer-

cial (19) or chemically synthesized (20) samples (see

Figures 2 and 3, respectively). Although it had been

reported that the oxime phosphate ester 21 (Figure 3)

underwent base-catalyzed decomposition to produce

diphenyl phosphate and 4-nitrobenzonitrile (29), the

ﬂuoride-mediated cleavage of ribonucleoside 2⁰-O-aryl or

-alkyliminooxymethyl ethers has not, to the best of our

knowledge, been reported in the literature.

It should be noted that the synthesis of 2⁰-O-phthalimi-

dooxyethyl ribonucleosides had been reported earlier by

Kawasaki et al. (30) with the purpose of preparing 2⁰-O-

aminooxyethyl-modiﬁed antisense oligonucleotides for

potential therapeutic applications. Although 2⁰-O-

aminooxyethyl ribonucleosides can be amenable to conju-

gation with various functional groups, these permanent

conjugates cannot be easily converted back to unmodiﬁed

ribonucleosides.

In this regard, the reaction of the 2⁰-O-aminooxymethyl

ribonucleoside 5a with cholesten-3-one (9) and dansyl

chloride also gave, as expected, the permanent uridine

2⁰-conjugates 10 (Figure 1) and 22 (Figure 3), respectively.

These conjugates were both found stable to TBAF/

THF under the conditions used for the conversion

of 6a-d, 12, 14, 16 and 18 to their corresponding

ribonucleosides. Indeed, treatment of 22 with 0.5 M

TBAF in THF for 72 h at 55^ꢀC produced uridine to

the extent of <1%, as determined by RP-HPLC

analysis of the reaction products (data shown in

Supplementary Figure S6).

The conjugates 6a–d, 12, 14, 16 and 18 exist as a mixture

of E- and Z-geometrical isomers; one of these isomers

appears to undergo ﬂuoride-assisted cleavage of the

2⁰-iminooxymethyl ether function at a faster rate than

the other geometrical isomer, as judged by RP-HPLC

analysis of the cleavage reactions. Our ﬁndings are con-

sistent with those reported earlier by others (31) indicating

that both syn- and anti-piperonaldoxime acetates

produced a nitrile via b-elimination under basic condi-

tions; the trans-b-elimination from the anti-acetate pro-

ceeding faster than the cis-b-elimination. It is also worth

noting that the proximity of an electron-donating group to

2324 Nucleic Acids Research, 2012, Vol. 40, No. 5

Figure 1. Ribonucleoside 2⁰-conjugates produced from the reaction of 5a or 5b with cholesten-3-one (9) or with aldehydes derived from various

acetals (11, 13, 15 and 17).

the 2⁰-iminooxymethyl ether function clearly affects the

rates of the ﬂuoride-assisted cleavage reaction. As shown

in Figure 2, the ﬂuoride-mediated conversion of 6a to

uridine was complete within 4 h at 55^ꢀC while the conver-

sion of 12 to uridine took 6 h under identical conditions

(Supplementary Figure S2). One might argue that in the

presence of ﬂuoride ion, which is a strong base in aprotic

solvent, the amide function of 12 (pK_aꢂ25) may become

negatively charged to some extent and decrease the acidity

of the nearby oximic proton as a consequence of the

electron-donating properties of the partially ionized

amide function. The reduced acidity of the oximic

proton would then result in a slower ﬂuoride-mediated

b-elimination reaction. This argument is further supported

by the considerably slower ﬂuoride-assisted conversion of

14 to uridine, which was only 15% complete after 24 h at

55^ꢀC (Supplementary Figure S3). The relatively acidic sul-

fonamide function of 14 (pK_aꢂ10) is presumably ionized

to a larger extent than that of an amide function by the

strongly basic ﬂuoride ion, thereby decreasing further the

acidity of the oximic proton, which led to slower

b-elimination rates relative to those of 6a–d and 12

under identical conditions. Also consistent with this

argument is that when the sulfonamide function is increas-

ingly distal to the oximic proton, the electron-donating

properties of the ionized sulfonamide have a lesser effect

on the acidity of the oximic proton and result in relatively

faster b-elimination rates. Typically, the ﬂuoride-assisted

Nucleic Acids Research, 2012, Vol. 40, No. 5 2325

Scheme 2. Fluoride-assisted

conversion

of

2⁰-O-pyrenylated

ribonucleosides (6a–d) to native ribonucleosides. TBAF, tetra-n-

butylammonium ﬂuoride; B, uracil-1-yl, cytosin-1-yl, adenin-9-yl, or

guanin-9-yl.

Figure 3. Structures of compounds 20, 21 and 22.

Single or double incorporation of a reversible

ribonucleoside 2’-conjugate into chimeric RNA sequences:

synthesis, deprotection and characterization

With the objective of demonstrating the ability of 2⁰-O-

aminooxymethyl ribonucleoside conjugates to modify

RNA sequences, the pyrenylated ribonucleoside conjugate

6a was reacted with 4,4⁰-dimethoxytrityl chloride in pyri-

dine to provide 7a, which after puriﬁcation, was reacted

with

2-cyanoethyl

N,N-diisopropylchlorophosphor-

amidite and triethylamine to give the pyrenylated ribo-

nucleoside phosphoramidite 8a (Scheme 1). The RNA

sequences 5⁰-r(U*AUCCGUAGCUAACGUCAUG)dT

(31), 5⁰-r(U*AUCCGUAGCU*AACGUCAUG)dT (32)

[U* and dT correspond to 2⁰-O-(pyren-1-ylmethanimine-

N-oxymethyl)uridine and 2’-deoxythymidine residues, re-

spectively] and 5’-r(UAUCCGUAGCUAACGUCA

UG)dT (33) were prepared using solid-phase techniques

(32) to show that the single or double incorporation of

pyrenylated ribonucleoside phosphoramidite 8a into

RNA sequences constructed from commercial 2⁰-O-(tert-

butyldimethylsilyl) ribonucleoside phosphoramidites

(Supplementary ‘Materials and Methods’ section) pro-

ceeded without compromising the overall yields of the

RNA sequences on the basis of the stepwise colorimetric

determination of the dimethoxytrityl cation concentration

after the ﬁrst and last coupling steps of each oligonucleo-

tide assembly. Treatment of the solid-phase-linked oligo-

nucleotides with concentrated aqueous NH₃at ambient

temperature (ꢂ25^ꢀC) resulted in the cleavage of all

nucleobase and phosphate protecting groups with the

release of the 2⁰-O-protected oligonucleotides from the

CPG support. Exposure of 2⁰-O-protected oligonucleo-

tides to Et₃Nꢅ3HF (33,34) in DMSO at 65^ꢀC resulted in

the exclusive cleavage of the 2⁰-O-TBDMS protecting

groups. Although the 2⁰-O-pyrenylated ribonucleoside

conjugates 6a–d are cleaved by TBAF, these conjugates

are totally stable to Et₃Nꢅ3HF under the conditions

used for complete cleavage of the 2⁰-O-TBDMS groups.

The RP-HPLC retention times of the puriﬁed

Figure 2. RP-HPLC analysis of the ﬂuoride-assisted conversion of

silica gel-puriﬁed 2⁰-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine

(6a) to uridine. (A) Chromatogram of the silica gel puriﬁed 6a. (B)

Chromatogram of the conversion of 6a to uridine by treatment with

0.5 M tetra-n-butylammonium ﬂuoride in THF for 3 h at 55^ꢀC. (C)

Chromatogram of mixed uridine and pyrene-1-carbonitrile commercial

samples. Conditions: RP-HPLC analysis was performed using UV de-

tection (254 nm) and

a

5 mm Supelcosil LC-18S column

(25 cm ꢁ 4.6 mm) according to the following conditions: starting from

0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1%

MeCN/min was pumped at a ﬂow rate of 1 ml/min for 40 min; the

gradient was then increased to 6% MeCN/min for 10 min at the

same ﬂow rate and kept isocratic for an additional 15 min. Peak

heights are normalized to the highest peak, which is set to 1 AU.

conversion of 16 to uridine was complete within 48 h

at 55^ꢀC (Supplementary Figure S4); this b-elimination

rate is comparatively faster than that of 14 but still signiﬁ-

cantly slower than those of 6a–d and 12. Given the struc-

tural similarity of 18 and 14 in terms of proximity of the

sulfonamide function to the oximic proton, the conversion

of 18 to cytidine by treatment with 0.5 M TBAF in

THF was comparable to that of 14 to uridine, as it was

only 25% complete after 24 h at 55^ꢀC (Supplementary

Figure S5).

2326 Nucleic Acids Research, 2012, Vol. 40, No. 5

oligonucleotides 31, 32 and 33 (t_R= 29.0, 31.0 and

17.6 min, respectively) were compared and found consist-

ent with the composition of each oligonucleotide under

identical chromatographic conditions (Figures 4 and 5).

MALDI-TOF analyses of 31, 32 and 33 corroborated

their expected molecular weights. The reversibility of the

2⁰-O-pyrenylated oligonucleotides 31 and 32 to 33 was

demonstrated by the reaction of 31 and 32 with 0.5 M

TBAF in DMSO at 55^ꢀC. Under these conditions, 31

and 32 were completely converted to 33, as shown by

RP-HPLC (Figures 4 and 5) and mass spectrometry

analyses of the fully deprotected oligonucleotides.

Functionalization of the 5⁰-terminus of a DNA sequence

with a reversible conjugate: synthesis, deprotection and

characterization

Figure 4. RP-HPLC

5⁰-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT repre-

sent and

2⁰-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine

analysis

of

puriﬁed

and

desalted

2⁰-deoxythymidine residues, respectively] and its conversion to

5⁰-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram

of 31 that was prepared from the 2⁰-O-pyrenylated ribonucleoside

phosphoramidite 8a and commercial 2⁰-O-(tert-butyldimethylsilyl)

It was also our intent to show that 5⁰-O-aminooxymethyl

deoxyribonucleosides are similar to 2⁰-O-aminooxymethyl

ribonucleosides in their abilities to produce conjugates

for the functionalization of DNA sequences at their

5⁰-termini; 5⁰-O-aminooxymethyl thymidine (25) served

as an appropriate model for this purpose. The synthesis

of 25 (Scheme 3) began with the thioacetalization of com-

mercial 3⁰-O-levulinyl thymidine under conditions similar

to those used for the 2⁰-O-thioacetalization of 1a–d. The

5⁰-O-thioacetal 23 was then treated with sulfuryl chloride

to yield the 5⁰-chloromethylated deoxyribonucleoside

intermediate, which was reacted with N-hydroxyphthalimide

in the presence of DBU to provide 24. Hydrazinolysis of 24

resulted in the cleavage of the phthalimido and levulinyl

groups affording 5⁰-O-aminooxylmethyl thymidine (25).

Oximation of 25 with pyrenecarboxaldehyde in MeOH at

55^ꢀC led to the 5⁰-pyrenylated thymidine derivative 26,

which was puriﬁed and phosphitylated using 2-cyanoethyl

N,N-diisopropylchlorophosphoramidite and triethylamine

under anhydrous conditions to give the 5⁰-pyrenylated

thymidine phosphoramidite 27. The DNA sequences

5⁰-d(T*ATCCGTAGCTAACGTCATGT) (34) [T* cor-

responds to 5⁰-O-(pyren-1-ylmethanimine-N-oxymethyl)-

2⁰-deoxythymidine] and 5⁰-d(TATCCGTAGCTAACGT

CATGT) (35) were synthesized, using the phosphor-

amidite 27 and commercial dA^Pac, dG^Pac, dC^Acand dT

phosphoramidite monomers under the conditions de-

scribed in the experimental section. Post-synthesis oligo-

nucleotide deprotection was carried out by treatment with

concentrated aqueous NH₃at ꢂ25^ꢀC. The coupling efﬁ-

ciency of 27 was found comparable to that of commercial

deoxyribonucleoside phosphoramidites given the similar

recovery of both 34 and 35, as judged by UV spectroscopy

at 260 nm. The 5⁰-pyrenylated DNA sequence 34 ex-

hibited, as expected, a retention time (t_R= 33.4 min) con-

siderably larger than that of the control DNA sequence 35

(t_R= 18.2 min) as a consequence of the notorious hydro-

phobicity of the pyrenyl function. (Supplementary

Figure S7). The identity of both 34 and 35 was conﬁrmed

by mass spectrometry. The reversibility of the 5⁰-pyreny-

lated DNA sequence 34 was also veriﬁed by its reaction

with 0.5 M TBAF in DMSO at 55^ꢀC. Under these condi-

tions 34 was completely converted to 35 on the basis of

A^Pac

, , U phosphoramidite monomers, deprotected,

G^PacC^Acand

RP-HPLC puriﬁed and desalted as delineated in the ‘Materials and

Methods’ section. (B) Chromatogram of 33 that was prepared from

, , U

G^PacC^Acand

commercial 2⁰-O-(tert-butyldimethylsilyl) A^Pac

phosphoramidite monomers, and processed as described in (A). (C)

Chromatogram of RP-HPLC puriﬁed and desalted 31 that was

treated with 0.5 M TBAF in DMSO for 2 h at 55^ꢀC and then

desalted. RP-HPLC analysis was performed using UV detection

(254 nm) and a 5 mm Supelcosil LC-18S column (25 cm ꢁ 4.6 mm) ac-

cording to the following conditions: starting from 0.1 M

triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/

min was pumped at a ﬂow rate of 1 ml/min for 40 min and was then

held, isocratically, for 20 min. Peak heights are normalized to the

highest peak, which is set to 1 AU.

Figure 5. RP-HPLC

5⁰-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT repre-

sent and

2⁰-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine

analysis

of

puriﬁed

and

desalted

2⁰-deoxythymidine residues, respectively] and its conversion to

5⁰-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram

of 32 that was prepared from the 2⁰-O-pyrenylated ribonucleoside

phosphoramidite 8a and commercial 2⁰-O-(tert-butyldimethylsilyl)

A^Pac

, , U phosphoramidite monomers, deprotected,

G^PacC^Acand

RP-HPLC puriﬁed and desalted as delineated in the ‘Materials and

Methods’ section. (B) Chromatogram of 33 that was prepared from

commercial 2⁰-O-(tert-butyldimethylsilyl) A^Pac

, , U

G^PacC^Acand

phosphoramidite monomers, and processed as described in (A). (C)

Chromatogram of RP-HPLC puriﬁed and desalted 32 that was

treated with 0.5 M TBAF in DMSO for 2 h at 55^ꢀC and then

desalted. RP-HPLC analysis was performed as described in the

caption of Figure 4.

Nucleic Acids Research, 2012, Vol. 40, No. 5 2327

when exposed to TBAF in DMSO. In preliminary experi-

ments, the 2⁰-O-aminooxymethyl ribonucleoside inter-

mediate 5a was reacted with either acetaldehyde or

methythioacetaldehyde, the latter of which was produced

in situ from its commercial dimethyl acetal under acidic

conditions, to generate the expected oxime conjugates

(Scheme 4). Both ribonucleoside 2⁰-conjugates were

found stable to the reagents and conditions used for

routine solid-phase RNA synthesis and to the mild basic

conditions that are required for N-deacylation of the

nucleobases, cleavage of the 2-cyanoethyl phosphate pro-

tecting groups and release of the 2⁰-O-protected RNA

sequence from the CPG support. The conversion of 2⁰-

O-[2-(methylthio)ethanimine-N-oxymethyl]uridine (28) to

uridine upon exposure to 0.5 M TBAF in DMSO was

complete within 30 min at 55^ꢀC and was the fastest of

the two 2⁰-O-aminooxymethyl ribonucleoside conjugates

investigated. In order to further improve the ﬂuoride-

assisted conversion of 28 to uridine, we rationalized that

by increasing the acidity of the oximic proton, the revers-

ibility of 28 to uridine should be enhanced. Indeed,

reaction of the sulfoxide derivative of 28 with 0.5 M

TBAF in DMSO led to its complete transformation to

uridine within 5 min at 25^ꢀC. These encouraging results

prompted us to prepare the ribonucleoside phosphor-

amidite

30,

which

was

obtained

from

the

Scheme 3. Preparation of the pyrenylated deoxyribonucleoside

phosphoramidite 27. (i) DMSO, Ac₂O, AcOH, 50^ꢀC, 16 h; (ii) silica gel

chromatography; (iii) SO₂Cl₂, CH₂Cl₂, 25^ꢀC, 2 h; (iv) N-hydroxy-

phthalimide, DBU, CH₂Cl₂, 25^ꢀC, 24 h; (v) 1 M hydrazine hydrate in

pyridine:AcOH (3:2 v/v), 25^ꢀC, 1 h; (vi) 1-pyrenecarboxaldehyde,

MeOH, 55^ꢀC, 1 h; (vii) 2-cyanoethyl N,N-diisopropylchloropho-

sphoramidite, Et₃N, CH₂Cl₂, 25^ꢀC, 2 h. Lev, levulinyl; Thy,

thymin-1-yl.

RP-HPLC (Supplementary Figure S7) and mass spec-

trometry analyses.

Reversible ribonucleoside 2⁰-conjugate in the synthesis of

native RNA sequences: synthesis and characterization of

the chimeric polyuridylic acid model r(U₂₀)dT

Given the pressing need for RNA sequences in RNA inter-

ference research (21), the versatility of reversible 2⁰-O-

aminooxymethyl ribonucleoside conjugates in the design

of novel 2⁰-hydroxyl protecting groups for the synthesis of

native or modiﬁed RNA sequences is clearly an asset. The

reaction of aldehydes or aldehydes derived from acetals

with 2⁰-O-aminooxymethyl ribonucleosides was per-

formed with the purpose of assessing the stability of the

resulting 2⁰-conjugates to the conditions prevailing during

the synthesis and deprotection of RNA sequences, and

evaluating the reversibility kinetics of these conjugates

Scheme 4. Preparation of the ribonucleoside phosphoramidite 30.

(i) NH₄F, MeOH, 25^ꢀC, 16 h; (ii) methylthioacetaldehyde, MeOH,

55^ꢀC, 1 h; (iii) silica gel chromatography; (iv) 30% H₂O₂, MeOH,

25^ꢀC, 2 h; (v) DMTrCl, pyridine, 25^ꢀC, 16 h; (vi) 2-cyanoethyl N,N-

diisopropylchlorophosphoramidite, Et₃N, CH₂Cl₂, 25^ꢀC, 2 h. Ura,

uracil-1-yl.

2328 Nucleic Acids Research, 2012, Vol. 40, No. 5

ketones. The synthetic process, whereby 2⁰-O-phthalimi-

dooxymethyl ribonucleoside derivatives (4a–d) have gen-

erally been prepared from commercial ribonucleoside

precursors (1a–d) in relatively high yields is remarkable

in terms of simplicity; a unique feature of this process is

the one-step removal of the silyl and phthalimido groups

from 4a–d by treatment with methanolic ammonium

ﬂuoride. The reaction of 5a–d with 1-pyrenecarbox-

aldehyde or 5a with aldehydes, generated from acetals

(11, 13 and 15) under acidic conditions, gave stable but

reversible ribonucleoside 2⁰-conjugates, whereas the

reaction of 5a with the cholestenone 9 or dansyl chloride

afforded permanent ribonucleoside conjugates. The con-

jugation of cholesterol derivatives to antisense oligo-

nucleotides has been reported to enhance the cellular

uptake and antisense efﬁcacy of these biomolecules in

cell-based systems (35). In this context, it has become ap-

parent that 2⁰-O-aminooxymethyl ribonucleosides (5a–d)

are capable of forming conjugates with a variety of func-

tional groups. Conversion of these ribonucleoside conju-

gates, after 5⁰-O- and nucleobase protection, to

3⁰-phosphoramidite derivatives should permit their in-

corporation into oligonucleotides. These oligonucleotide

conjugates may particularly be useful in the development

of innovative approaches to improving the cellular uptake

of nucleic acid-based drugs through speciﬁc pathways.

Cellular uptake and localization of therapeutic oligo-

nucleotides are still the most challenging problems to

overcome in order to better control gene expression. In

addition, one of the important ﬁndings of this work is

the facile reversibility of ribonucleoside 2⁰-conjugates to

native ribonucleosides upon treatment with 0.5 M TBAF

in DMSO. As discussed above, TBAF induced the

b-elimination of 2⁰-iminooxymethyl ether functions

through the formation of innocuous nitriles and thus

provides new opportunities for the discovery and imple-

mentation of novel 2⁰-hydroxy protecting groups, which

are of crucial importance in the synthesis of native and/or

modiﬁed RNA sequences for RNA interference applica-

tions (21). Furthermore, the reversibility of DNA/RNA

oligonucleotides conjugated to speciﬁc ligands is particu-

larly useful in the afﬁnity puriﬁcation of synthetic DNA/

RNA from which intact DNA/RNA oligonucleotides can

be recovered from the ligand-afﬁnity binding system (36).

This approach may ﬁnd application in the large-scale syn-

thesis and puriﬁcation of therapeutic DNA/RNA

sequences. The reversibility of DNA/RNA oligonucleo-

tides conjugated to afﬁnity ligands may have a much

broader appeal when the reversible DNA/RNA conjugate

serves as an aptamer for capturing proteins from cell

lysates. This strategy may permit the identiﬁcation and

characterization of biomedically relevant DNA/RNA

protein complex(es) upon release from the ligand-afﬁnity

binding system.

Figure 6. RP-HPLC analysis of the conversion of unpuriﬁed and

desalted

5⁰-r(U⁺₂₀)dT)

[U⁺represents

2⁰-O-[2-(methylsulﬁny-

l)ethanimine-N-oxymethyl]uridine] (36) to 5⁰-r(U₂₀)dT (37). (A)

Chromatogram of r(U₂₀)dT 37 that was prepared from commercial

2⁰-O-(tert-butyldimethylsilyl)uridine phosphoramidite, deprotected, and

desalted as delineated in the ‘Materials and Methods’ section. (B)

Chromatogram of 36 that was prepared from the ribonucleoside

phosphoramidite monomer 30 and processed as described in (A).

RP-HPLC analysis was performed as described in the caption of

Figure 4.

5⁰-dimethoxytritylation of the sulfoxide derivative of 28 to

29 and its subsequent 3⁰-phosphitylation by 2-cyanoethyl

N,N-diisopropylchlorophosphoramidite under the condi-

tions described in the caption of Scheme 4. The

ribonucleoside phosphoramidite 30 was successfully used

in the solid-phase synthesis of r(U⁺₂₀)dT bearing the 2-

(methylsulﬁnyl)ethanimine-N-oxymethyl

group

for

2⁰-hydroxyl protection. The iterative coupling efﬁciency

of 30 exceeded 99% and the yield of r(U⁺₂₀)dT was

80 5% as determined by the colorimetric trityl assay.

Upon phosphate deprotection and release of r(U⁺₂₀)dT

from the CPG support effected by aqueous NH₃, the

ﬂuoride-mediated cleavage of the 2⁰-O-[2-(methylsulﬁny-

l)ethanimine-N-oxymethyl] groups was subsequently per-

formed under anhydrous conditions by treatment with

0.5 M TBAF in DMSO over a period of 16 h at 55^ꢀC.

Unpuriﬁed r(U₂₀)dT (37) was desalted, analyzed by

RP-HPLC and successfully characterized by MALDI-

TOF mass spectrometry. The RP-HPLC proﬁle of the

chimeric polyuridylic acid was compared with the proﬁle

of r(U₂₀)dT that was prepared from commercial 2⁰-O-

(tert-butyldimethylsilyl)uridine phosphoramidite mono-

mers and deprotected under standard conditions (32).

Figure 6 shows the high similarity of these chromato-

graphic proﬁles and strongly suggests that reversible

2⁰-O-aminooxymethyl ribonucleoside conjugates may

lead to the development of novel 2⁰-hydroxyl protecting

groups for the optimal preparation of native or modiﬁed

RNA sequences.

CONCLUSIONS

SUPPLEMENTARY DATA

The synthesis of novel 2⁰-O-aminooxymethyl ribonucleo-

sides (5a–d) provides facile access to reversible or perman-

ent ribonucleoside 2⁰-conjugates through an efﬁcient and

chemoselective oximation reaction with aldehydes or

Supplementary Data are available at NAR Online:

and

Supplementary Materials

Supplementary Figures S1–S7.

and

Methods,

Nucleic Acids Research, 2012, Vol. 40, No. 5 2329

18. Forget,D., Renaudet,O., Boturyn,D., Defrancq,E. and Dumy,P.

(2001) 3’-Oligonucleotides conjugation via chemoselective oxime

bond formation. Tetrahedron Lett., 42, 9171–9174.

19. Katajisto,J., Virta,P. and Lonnberg,H. (2004) Solid-phase

synthesis of multiantennary oligonucleotide glycoconjugates

utilizing on-support oximation. Bioconjugate Chem., 15, 890–896.

20. Morvan,F., Sanghvi,Y.S., Perbost,M., Vasseur,J.-J. and Bellon,L.

(1996) Oligonucleotide mimics for antisense therapeutics: solution

phase and automated solid-support synthesis of MMI linked

oligomers. J. Am. Chem. Soc., 118, 255–256.

21. Beaucage,S.L. and Reese,C.B. (2009) Recent advances in the

chemical synthesis of RNA. In: Beaucage,S.L., Herdewijn,P. and

Matsuda,A. (eds), Current Protocols in Nucleic Acid Chemistry,

Vol. I. John Wiley & Sons, Inc., Hoboken, pp. 2.16.1–2.16.31,

and references therein.

FUNDING

Funding for open access charge: Intramural research

funding.

Conﬂict of interest statement. None declared.

REFERENCES

1. Deleavey,G.F., Watts,J.K. and Damha,M.J. (2010) Chemical

modiﬁcation of siRNA. In: Beaucage,S.L., Herdewijn,P. and

Matsuda,A. (eds), Current Protocols in Nucleic Acid Chemistry,

Vol. III. John Wiley & Sons, Inc., Hoboken, pp. 16.3.1–16.3.22.

2. Watts,J.K., Deleavey,G.F. and Damha,M.J. (2008) Chemically

modiﬁed siRNA: tools and applications. Drug Disc. Today, 13,

842–855.

3. Beaucage,S.L. (2008) Solid-phase synthesis of siRNA

oligonucleotides. Curr. Opin. Drug Disc. Devel., 11, 203–216.

4. Rozners,E. (2006) Carbohydrate chemistry for RNA interference:

synthesis and properties of RNA analogues modiﬁed in

sugar-phosphate backbone. Curr. Org. Chem., 10, 675–692.

5. Manoharan,M. (1999) 2⁰-Carbohydrate modiﬁcations in antisense

oligonucleotide therapy: importance of conformation,

conﬁguration and conjugation. Biochim. Biophys. Acta, 1489,

117–130.

6. Silverman,S.K. and Cech,T.R. (1999) RNA tertiary folding

monitored by ﬂuorescence of covalently attached pyrene.

Biochemistry, 38, 14224–14237, and references therein.

7. Griffey,R., Lesnik,E., Freier,S., Sanghvi,Y.S., Teng,K.,

Kawasaki,A., Guinosso,C., Wheeler,P., Mohan,V. and Cook,P.D.

(1994) New twists on nucleic acids structural properties of

modiﬁed nucleosides incorporated into oligonucleotides.

In: Sanghvi,Y.S. and Cook,P.D. (eds), Carbohydrate Modiﬁcations

in Antisense Research. American Chemical Society, Washington

DC, pp. 212–224.

8. Beaucage,S.L. (1999) Attachment of reporter and conjugate

groups to DNA. In: Barton,D., Nakanishi,H., Meth-Cohn,O. and

Kool,E.T. (eds), Comprehensive Natural Products Chemistry: DNA

and Aspect of Molecular Biology, Vol. 7. Elsevier, Oxford,

pp. 153–249.

22. Cieslak,J., Grajkowski,A., Kauffman,J.S., Duff,R.J. and

´

Beaucage,S.L. (2008) The 4-(N-dichloroacetyl-N-

methylamino)benzyloxymethyl group for 2’-hydroxyl protection of

ribonucleosides in the solid-phase synthesis of

oligoribonucleotides. J. Org. Chem., 73, 2774–2783.

23. Semenyuk,A., Foldesi,A., Johansson,T., Estmer-Nilsson,C.,

Blomgren,P., Brannvall,M., Kirsebom,L.A. and Kwiatkowski,M.

(2006) Synthesis of RNA Using 2’-O-DTM protection.

J. Am. Chem. Soc., 128, 12356–12357.

24. Sun,J., Dong,Y., Cao,L., Wang,X., Wang,S. and Hu,Y. (2004)

Highly efﬁcient chemoselective deprotection of O,O-acetals and

O,O-ketals catalyzed by molecular iodine in acetone. J. Org.

Chem., 69, 8932–8934.

25. McKay,A.F., Garmaise,D.L., Gaudry,R., Baker,H.A., Paris,G.Y.,

Kay,R.W., Just,G.E. and Schwartz,R. (1959) Bacteriostats. II.

The chemical and bacteriostatic properties of isothiocyanates and

their derivatives. J. Am. Chem. Soc., 81, 4328–4335.

26. Rastogi,H. and Usher,D.A. (1995) A new 2⁰-hydroxyl protecting

group for the automated synthesis of oligoribonucleotides.

Nucleic Acids Res., 23, 4872–4877.

27. Parey,N., Baraguey,C., Vasseur,J.-J. and Debart,F. (2006) First

evaluation of acyloxymethyl or acylthiomethyl groups as biolabile

2⁰-O-protection of RNA. Org. Lett., 8, 3869–3872.

28. Ti,G.S., Gaffney,B.L. and Jones,R.A. (1982) Transient protection:

efﬁcient one-ﬂask syntheses of protected deoxynucleosides.

J. Am. Chem. Soc., 104, 1316–1319.

29. Reese,C.B. and Yau,L. (1978) Reaction between

4-nitrobenzaldoximate ion and phosphotriesters. Tetrahedon Lett.,

19, 4443–4446.

30. Kawasaki,A.M., Casper,M.D., Prakash,T.P., Manalili,S.,

Sasmor,H., Manoharan,M. and Cook,P.D. (1999) Synthesis,

hybridization, and nuclease resistance properties of 2⁰-O-

aminooxyethyl (2’-O-AOE) modiﬁed oligonucleotides.

Tetrahedron Lett., 40, 661–664.

31. Hauser,C.R. and Hoffenberg,D.S. (1955) b-eliminations of

syn- and anti-piperonaldoxime acetates with potassium amide in

liquid ammonia. J. Org. Chem., 20, 1535–1537, and references

therein.

32. Bellon,L. (2000) Oligoribonucleotides with 2⁰-O-(tert-

butyldimethylsilyl) groups. In: Beaucage,S.L., Bergstrom,D.E.,

Glick,G.D. and Jones,R.A. (eds), Current Protocols in

Nucleic Acid Chemistry, Vol. I. John Wiley & Sons, Inc.,

Hoboken, pp. 3.6.1–3.13.

9. Cook,P.D. (1998) Second generation antisense oligonucleotides:

2⁰-Modiﬁcations. In: Bristol,J.A. (ed.), Annual Report in

Medicinal Chemistry, Vol. 33. Academic Press, San Diego,

pp. 313–325.

10. Hilvert,D. (1994) Chemical synthesis of proteins. Chem. Biol., 1,

201–203.

11. Rose,K. (1994) Facile synthesis of homogeneous artiﬁcial

proteins. J. Am. Chem. Soc., 116, 30–33.

12. Rodriguez,E.C., Winans,K.A., King,D.S. and Bertozzi,C.R. (1997)

A strategy for the chemoselective synthesis of O-linked

glycopeptides with native sugar-peptide linkages. J. Am. Chem.

Soc., 119, 9905–9906, and references therein.

13. Trevisiol,E., Renard,A., Defrancq,E. and Lhomme,J. (1997) The

oxyamino-aldehyde coupling reaction: An efﬁcient method for the

derivatization of oligonucleotides. Tetrahedron Lett., 38,

8687–8690.

14. Salo,H., Virta,P., Hakala,H., Prakash,T.P., Kawasaki,A.M.,

Manoharan,M. and Lonnberg,H. (1999) Aminooxy functionalized

oligonucleotides: preparation, on-support derivatization, and

postsynthetic attachment to polymer support. Bioconj. Chem., 10,

815–823.

15. Forget,D., Boturyn,D., Defrancq,E., Lhomme,J. and Dumy,P.

(2001) Highly efﬁcient synthesis of peptide - oligonucleotide

conjugates: chemoselective oxime and thiazolidine formation.

Chem. Eur. J., 7, 3976–3984.

33. Gasparutto,D., Livache,T., Bazin,H., Duplaa,A.-M., Guy,A.,

Khorlin,A., Molko,D., Roget,A. and Teoule,R. (1992) Chemical

´

synthesis of a biologically active natural tRNA with its minor

bases. Nucleic Acids Res., 20, 5159–5166.

34. Westman,E. and Stromberg,R. (1994) Removal of

t-butyldimethylsilyl protection in RNA-synthesis. Triethylamine

trihydroﬂuoride (TEA, 3HF) is a more reliable alternative to

tetrabutylammonium ﬂuoride (TBAF). Nucleic Acids Res., 22,

2430–2431.

16. Defrancq,E. and Lhomme,J. (2001) Use of an aminooxy linker

for the functionalization of oligodeoxyribonucleotides. Bioorg.

Med. Chem. Lett., 11, 931–933.

17. Forget,D., Renaudet,O., Defrancq,E. and Dumy,P. (2001)

Efﬁcient preparation of carbohydrate–oligonucleotide conjugates

(COCs) using oxime bond formation. Tetrahedron Lett., 42,

7829–7832.

35. Manoharan,M. (2002) Oligonucleotide conjugates as potential

antisense drugs with improved uptake, biodistribution, targeted

delivery and mechanism of action. Antisense Nucleic Acid Drug

Dev., 12, 103–128, and references therein.

36. Fang,S. and Bergstrom,D.E. (2004) Reversible 5⁰-end biotinylation

and afﬁnity puriﬁcation of synthetic RNA. Tetrahedron Lett., 45,

7987–7990, and references therein.

Article Doi

Permanent or reversible conjugation of 2′-O-or 5′-O- aminooxymethylated nucleosides with functional groups as a convenient and efficient approach to the modification of RNA and DNA sequences

DOI: 10.1093/nar/gkr896

Source and publish data:

Authors:

Article abstract of DOI:10.1093/nar/gkr896

Full text of DOI:10.1093/nar/gkr896

Products guided by the article

R&D Labs maybe for 1180489-71-7

Relevant to this article

Hot Product