Discovery of small molecules that enhance astrocyte differentiation in rat fetal neural stem cells

Article abstract of DOI:10.1016/j.bmcl.2011.09.099

1,3,4-Oxadiazole derivatives were found to enhance astrocyte differentiation in rat fetal neural stem cells (NSCs). Differentiation activity was assessed by immunocytochemistry and analysis of mRNA expression of astrocyte markers, GFAP and S100. Compounds 7 and 8 showed approximately a two-fold increase in astrocyte differentiation without engagement of neuronal differentiation and detectable cytotoxicity.

Full text of DOI:10.1016/j.bmcl.2011.09.099

Bioorganic & Medicinal Chemistry Letters 21 (2011) 7050–7053
Contents lists available at SciVerse ScienceDirect
Bioorganic & Medicinal Chemistry Letters
journal homepage: www.elsevier.com/locate/bmcl
Discovery of small molecules that enhance astrocyte differentiation
in rat fetal neural stem cells
Dong Jo Chang a, , Mi Young Jeong b, , Jiho Song c, Chang Yun Jin b, Young-Ger Suh a, Hyun-Jung Kim b,
,
⇑
Kyung Hoon Min c,
⇑
a College of Pharmacy, Seoul National University, Seoul 151-741, Republic of Korea
b Laboratory of Molecular and Stem Cell Pharmacology, College of Pharmacy, Chung-Ang University, Seoul 156-756, Republic of Korea
c College of Pharmacy, Chung-Ang University, Seoul 156-756, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 23 July 2011
Revised 14 September 2011
Accepted 23 September 2011
Available online 29 September 2011
1,3,4-Oxadiazole derivatives were found to enhance astrocyte differentiation in rat fetal neural stem cells
(NSCs). Differentiation activity was assessed by immunocytochemistry and analysis of mRNA expression
of astrocyte markers, GFAP and S100. Compounds 7 and 8 showed approximately a two-fold increase in
astrocyte differentiation without engagement of neuronal differentiation and detectable cytotoxicity.
Ó 2011 Elsevier Ltd. All rights reserved.
Keywords:
Neural stem cell
Small molecule
Astrocyte
Differentiation
1,3,4-Oxadiazole
Stem cells have unlimited proliferative properties and the abil-
ity to produce functional differentiated progeny.1 Neural stem cells
(NSCs) also have the ability to self-renew in the nervous system
and to differentiate into specific cell types, including neurons and
glia.2 NSCs have been identified in the subventricular zone and
the hippocampus in the adult as well as in the developing nervous
system.3 Recent works have suggested that NSCs may be suitable
for transplantation to replace neurons lost in many neurodegener-
ative diseases such as Parkinson’s disease.4
Intrinsic regulators, such as transcription factors, can control
the fate of NSCs,5 in addition to extrinsic factors, such as retinoic
acid and ciliary neurotrophic factor (CNTF)/leukemia inhibitory
factor (LIF).6 Interestingly, NSCs isolated from different regions of
developing embryos showed specific characteristics in prolifera-
tion and differentiation and the cell fate could be modulated by ec-
topic expression of transcription factors.7 In addition, small
molecules can regulate stem cell fate efficiently and conveniently;
they also could be useful probes in the identification of key factors
involved in controlling cell fate. It has been reported that small
molecules targeting endogenous signaling pathways can modulate
NSCs differentiation.8 The pyrimidine compound KHS101, which
was found to specifically bind transforming acidic coiled-coil-con-
taining protein 3 (TACC3),9 and synthetic 4-aminothiazole com-
pounds termed neuropathiazols (KHS2)10 have been implicated
in the induction of neuronal differentiation from adult rat hippo-
campus-derived NSCs. Small molecule inhibitors of glycogen syn-
thase kinase-3 (GSK-3), such as SB-216763 and kenpaullone, are
also known to increase neurogenesis of human NSCs.11 Moreover,
many trials have been undertaken to find small molecules for dif-
ferentiation into neurons from other stem cells.8 Thus, it would be
of great interest to identify additional small molecules that can
precisely regulate NSCs or stem cell fate.
The study of astrocyte differentiation might greatly contribute
to understand how the cell fate of NSCs is regulated. In addition,
much attention has been paid to the role of astrocytes in neuro-
pathological conditions.12 An in-house chemical library was there-
fore screened to see if any could induce astrocyte differentiation of
NSCs. An image-based screen of about a thousand chemicals has
resulted in the identification of potential compounds for astrocyte
differentiation of NSCs. We carried out additional studies with the
best hit from the primary screen. Herein, we describe the identifi-
cation of small molecule regulators for astrocytogenesis of NSCs
derived from fetal rat cortex along with the brief structure–activity
relationship study.
⇑
Corresponding authors.
E-mail addresses: hyunjungkim@cau.ac.kr (H.-J. Kim), khmin@cau.ac.kr (K.H.
All tested compounds were prepared by the coupling reaction
of phenyl(5-phenyl-1,3,4-oxadiazole-2-yl)methanamine (5) or
(4-fluorophenyl)(5-phenyl-1,3,4-oxadiazole-2-yl)methanamine
Min).
These authors contributed equally to this paper.
0960-894X/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmcl.2011.09.099

D. J. Chang et al. / Bioorg. Med. Chem. Lett. 21 (2011) 7050–7053
7051
O
O
NHBoc
NHBoc
NH2
NH2
HO
HO
O
O
Ph
Ph
a
b
c
N
N
N
N
R1
R1
R1
R1
R1 = H or F
3 4
R1 = H ( ) or F ( )
1 2
1 = H ( ) or F ( )
R
5
6
R1 = H ( ) or F ( )
Scheme 1. Synthesis of disubstituted methanamines with 1,3,4-oxadiazole-core (5, 6). Reagents and conditions: (a) Boc2O, NaHCO3, water–dioxane; (b) benzohydrazide, CDI,
CBr4, PPh3, DCM, 0 °C; (c) TFA, DCM, rt.
Ph
NH2
O
Ph
N
H
N
O
Ph
N
R2
O
N
a
b
S
H
N
N
N
R3
O
O
N
O
R1
R1
R1 = H (5) or F (6)
R1
10, R1 = F, R 2 = Ph
11, R1 = F, R 2 = Bn
7
, R1 = H, R3 = Bn
8, R1 = F, R 3 = Bn
9
, R1 = F, R 3 = Ph
Scheme 2. Synthesis of sulfonamide and amide analogues with a 1,3,4-oxadiazole-core (7–11). Reagents and conditions: (a) Et3N, sulfonyl chlorides, DCM, 0 °C; (b) EDCI,
DMAP, carboxylic acids, DCM, rt.
(6) and the appropriate sulfonyl chlorides or carboxylic acids. The
synthesis of the methanamine with a 1,3,4-oxadiazole-core is de-
scribed in Scheme 1. The amino group for the ultimate amide cou-
pling was protected with a Boc group by Boc2O and NaHCO3 in
water–dioxane solvent.13 Then, we applied one pot synthesis of
2,5-disubstituted 1,3,4-oxadiazole (3, 4) from Boc-protected amino
acid (1, 2) and benzohydrazide using carbonyl diimidazole (CDI)
for activation of the carboxylic group and CBr4 and PPh3 for dehy-
dration,14 where the N-Boc group was then deprotected by TFA to
give phenyl(5-phenyl-1,3,4-oxadiazole-2-yl)methanamine (5) or
(4-fluorophenyl) (5-phenyl-1,3,4-oxadiazol-2-yl)methanamine (6).
The synthesis of the final sulfonamide and amide with a
1,3,4-oxadiazole-core is shown in Scheme 2. The ultimate cou-
pling of the appropriate sulfonyl chlorides using Et3N to the
intermediate 5 or 6 gave the corresponding sulfonamides (10–
11), and the EDCI mediated coupling of the appropriate carbox-
ylic acids toward the final product gave the corresponding
amides (7–9).
most not affected by active compounds. These results demon-
strate that these oxadiazole compounds specifically differentiate
NSCs into astrocytes. We further evaluated compound 7 since it
effectively induced astrocytogenesis without cell death as exam-
ined by morphology and nuclei counting. Reverse transcriptase
PCR (RT PCR) revealed that 1 day of compound 7 treatment signif-
icantly induced transcription of astroglial marker, GFAP and
S100.17 Interestingly, no difference was observed in transcription
of neuronal gene bIII tubulin. When the rest of the oxadiazole
derivatives were tested, they all induced GFAP and S100 mRNA
expression without affecting bIII tubulin expression (Fig. 1). These
results indicate that oxadiazole derivatives control NSCs fate to
astrocytes.
In summary, oxadiazole derivatives could enhance astrocyto-
genesis in fetal NSCs derived from rat cortex without engagement
of neuronal differentiation. Compounds 7 and 8 showed the best
activity, approximately a two-fold increase, compared with un-
treated NSCs, in astrocyte differentiation, when determined by
immunocytochemistry and RT-PCR. Although further investigation
is required to reveal the molecular targets of the described com-
pounds, we believe that those chemicals would be useful in under-
standing the molecular mechanisms of the cell fate determination
of NSCs.
To explore the potential roles of a series of small molecules in
NSCs differentiation, NSCs derived from the developing rat cortex
at embryonic day (E) 14 were treated with 5 lM of oxadiazole
compounds. For in vitro differentiation, NSCs were cultured as
neurospheres and dissociated as single cells for plating onto
poly-D
-lysine-coated dishes.15 Four days after treatment, cells
were fixed with 4% paraformaldehyde and immunocytochemistry
assays were performed using cell type specific antibodies.16 To
identify neurons and astrocytes, anti-bIII tubulin (TuJ1) and
anti-GFAP were used, respectively. As shown in Figure 1, oxadiaz-
ole compounds significantly increased generation of astrocytes
when compared with vehicle treated control in NSCs (p <0.05).
Among them, compounds 7, 8, and 9 appeared to be more effec-
tive than compound 10, suggesting that an amide group may be
favored over a sulfonamide group for differentiation activity.
Interestingly, the number of neurons (Tuj1-positive cells) was al-
Acknowledgment
This work was supported by the R&BD program of Seoul Metro-
politan Government (ST090791).
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmcl.2011.09.099.

7052
D. J. Chang et al. / Bioorg. Med. Chem. Lett. 21 (2011) 7050–7053
Figure 1. Induction of astrogliogenesis by oxadiazole compounds. Dissociated cells of NSCs were plated and treated with either DMSO (CON) or compound 4, 7, 8, 9, 10 or 11.
Four days after treatment cells were fixed and immunostained with anti-GFAP and Cy3-conjugated secondary antibody. To count the total cell number, 4,6-diamidino-2-
phenylindole (DAPI) staining was performed. (A) Quantification of GFAP and TuJ1 positive cells in the control and oxadiazole compounds treated NSCs. GFAP-positive and
TuJ1-positive cells were counted, and the ratio of positive cells to total cells was calculated and divided to that of CON to yield fold changes. The values are presented as the
mean standard error of mean from independent experiments (n = 6). Statistical analysis was carried out by Student’s t-test. ⁄The values are significantly different from the
control group (P <0.05). (B) Representative immunofluorescence images of GFAP (astrocyte marker, red) and DAPI (nuclei, blue) of control (0.05% DMSO treated) and indicated
compound (5
lM) treated NSCs. Scale bar = 50
lm. (C) Increased GFAP and S100 mRNA expression by oxadiazole compounds in NSCs. NSCs were cultured with either DMSO
(CON) or indicated compound (5
lM) for 2 days. Total RNA was prepared, and cDNA was synthesized, and subjected to semiquantitative RT-PCR with GFAP, S100, and bIII-
tubulin. The transcripts of GAPDH were used to normalize the loading amount. (D) Graphs show the relative intensities of GFAP and S100 mRNA levels analyzed by band
densitometry.
13. Kuo, F.; Clodfelter, D.; Priest, T.; Kau, D. J. Labelled Compd. Radiopharm. 2004, 47,
References and notes
599.
14. Rajapakse, H.; Zhu, H.; Young, M.; Mott, B. Tetrahedron Lett. 2006, 47, 4827.
1. (a) Hall, P. A.; Watt, F. M. Development 1989, 106, 619; (b) Weissman, I. L. Cell
15. NSCs culture. We cultured NSCs from cortices of rat (Sprague–Dawley rats)
2000, 100, 157; (c) Kim, H. J. Biochim. Biophys. Acta 2011, 1812, 1.
embryos at E14. The NSCs (200,000/ml) were expanded as neurospheres for
2. (a) Cattaneo, E.; McKay, R. Nature 1990, 347, 762; (b) Brustle, O.; Jones, K. N.;
7 days in Dulbecco’s modified Eagle’s medium (DMEM)/F12 media (Gibco,
Learish, R. D.; Karram, K.; Choudhary, K.; Wiestler, O. D.; Duncan, I. D.; McKay,
Carlsbad, CA) supplemented with 2% B27 (Invitrogen), 20 ng/ml epidermal
R. D. Science 1999, 285, 754.
growth factor (EGF; Chemicon, CA), and 20 ng/ml FGF-2 (Chemicon, CA). The
3. (a) Gage, F. H. Science 2000, 287, 1433; (b) Temple, S. Nature 2001, 414, 112.
media was replaced every 2 days. For differentiation, neurospheres were
4. (a) Jin, K.; Peel, A. L.; Mao, X. O.; Xie, L.; Cottrell, B. A.; Henshall, D. C.;
dispersed into a single-cell suspension with accutase for 10 min at 37 °C,
Greenberg, D. A. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 343; (b) Freed, C. R.;
plated onto 0.01% poly-D-lysine and 10 lg/ml laminin (Sigma-Aldrich, MO)
Greene, P. E.; Breeze, R. E.; Tsai, W. Y.; DuMouchel, W.; Kao, R.; Dillon, S.;
Winfield, H.; Culver, S.; Trojanowski, J. Q.; Eidelberg, D.; Fahn, S. N. Eng. J. Med.
2001, 344, 710.
with no growth factors but supplemented with 2% B27. The cells treated with
chemicals or DMSO were maintained at 37 °C in 5% CO2 incubators and cell
differentiation was assessed 4 days thereafter.
5. Alvarez-Buylla, A.; Lim, D. A. Neuron 2004, 41, 683.
16. Immunocytochemistry and cell counting. For immunocytochemistry, cell
cultures were fixed with 4% paraformaldehyde for 30 min and washed with
phosphate-buffered saline (PBS). Fixed cells were blocked with 5% normal goat
serum and 0.2% Triton X-100 in PBS and incubated with TuJ1(monoclonal;
1:1000; Sigma-Aldrich, MO), GFAP (polyclonal; 1:1000; Dako, Carpinteria, CA).
Following rinsing with PBS, the cells were incubated for 30 min with secondary
antibodies conjugated to Cy3 (1:1000, Molecular Probes, CA). DAPI (1:10,000 in
PBS) was added for 5 min after completion of the secondary antibody
incubation as a nuclear stain. The images were obtained with an inverse
fluorescence microscopy (DMIL; Leica, Wetzlar). To avoid biased results, we
took photos randomly and either GFAP or TuJ1 positive cells were counted
from 3–6 independent experiments. To calculate the total cell number, DAPI
stained nuclei were use. The numbers of either GFAP-positive cells or TuJ1
positive cells were divided by DAPI positive cells to get the percentage. The
percentage values of each chemical treated groups were divided by that of
control to get the fold increase. All cell-count data were expressed as
means SEM and statistics were analyzed using the Student’s t-test.
6. (a) Okada, Y.; Shimazaki, T.; Sobue, G.; Okano, H. Dev. Biol. 2004, 275, 124; (b)
Shimazaki, T.; Shingo, T.; Weiss, S. J. Neurosci. 2001, 21, 7642.
7. (a) Kim, H. J.; Sugimori, M.; Nakafuku, M.; Svendsen, C. N. Exp. Neurol. 2007,
203, 394; (b) Kim, H. J.; McMillan, E.; Han, F.; Svendsen, C. N. Stem Cells 2009,
27, 390.
8. (a) Lyssiotis, C. A.; Lairson, L. L.; Boitano, A. E.; Wurdak, H.; Zhu, S.; Schultz, P. G.
Angew. Chem., Int. Ed. 2011, 50, 200; (b) Xu, Y.; Shi, Y.; Ding, S. Nature 2008, 453,
338.
9. Wurdak, H.; Zhu, S.; Min, K. H.; Aimone, L.; Lairson, L. L.; Watson, J.; Chopiuk,
G.; Demas, J.; Charette, B.; Halder, R.; Weerapana, E.; Cravatt, B. F.; Cline, H. T.;
Peters, E. C.; Zhang, J.; Walker, J. R.; Wu, C.; Chang, J.; Tuntland, T.; Cho, C. Y.;
Schultz, P. G. Proc. Natl. Acad. Sci. U.S.A. 2010, 107, 16542.
10. Warashina, M.; Min, K. H.; Kuwabara, T.; Huynh, A.; Gage, F. H.; Schultz, P. G.;
Ding, S. Angew. Chem., Int. Ed. 2006, 45, 591.
11. Lange, C.; Mix, E.; Frahm, J.; Glass, A.; Muller, J.; Schmitt, O.; Schmole, A. C.;
Klemm, K.; Ortinau, S.; Hubner, R.; Frech, M. J.; Wree, A.; Rolfs, A. Neurosci. Lett.
2011, 488, 36.
17. Semi-quantitative RT-PCR. The total RNA was extracted using TRIzol reagent
12. Allaman, I.; Belanger, M.; Magistretti, P. J. Trends Neurosci. 2011, 34, 76.
(Invitrogen, MD). First-strand cDNA was synthesized from 2 lg of total RNA in

D. J. Chang et al. / Bioorg. Med. Chem. Lett. 21 (2011) 7050–7053
7053
a 20
l
l reaction with oligo (dT) primers and RevertAid reverse transcriptase
The housekeeping gene GFAP was used for the internal control. cDNA was
amplified by an initial incubation at 94 °C for 5 min followed by 26 cycles of
94 °C for 0.5 min, 55–58 °C for 0.5 min, 72 °C for 0.5 min, and a final extension
at 72 °C for 10 min. The PCR products were then separated by electrophoresis
on a 1.5% agarose gel and visualized by ethidium bromide staining.
(Fermentas). The following primer sets were used to amplify cDNA. for bIII
tubulin, agccctctacgacatctgct (forward) and attgagctgaccagggaatc (reverse); for
GFAP, agcggctctgagagagattc (forward) and agcaacgtctgtgaggtctg (reverse); for
GAPDH, agttcaacggcacagtcaag (forward) and gtggtgaagacgccagtaga (reverse).