Photoligation of self-assembled DNA constructs containing anthracene-functionalized 2′-amino-LNA monomers

Article abstract of DOI:10.1016/j.bmc.2011.10.052

Efficient synthesis of a novel anthracene-functionalized 2′-amino-LNA phosphoramidite derivative is described together with its incorporation into oligodeoxynucleotides. Two DNA strands with the novel 2′-N- anthracenylmethyl-2′-amino-LNA monomers can be e

Full text of DOI:10.1016/j.bmc.2011.10.052

Bioorganic & Medicinal Chemistry 19 (2011) 7407–7415
Contents lists available at SciVerse ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Photoligation of self-assembled DNA constructs containing
anthracene-functionalized 20-amino-LNA monomers
Karol Pasternak a, , Anna Pasternak a, , Pankaj Gupta a, , Rakesh N. Veedu a,b, , Jesper Wengel a,
⇑
a Nucleic Acid Center, Department of Physics and Chemistry, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark
b School of Chemistry and Molecular Biosciences, The University of Queensland, St Lucia, Brisbane, Queensland 4072, Australia
a r t i c l e i n f o
a b s t r a c t
Efficient synthesis of a novel anthracene-functionalized 20-amino-LNA phosphoramidite derivative is
described together with its incorporation into oligodeoxynucleotides. Two DNA strands with the novel
20-N-anthracenylmethyl-20-amino-LNA monomers can be effectively cross-linked by photoligation at
366 nm in various types of DNA constructs. Successful application of three differently functionalized
20-amino-LNA monomers in self-assembled higher ordered structures for simultaneous cross-linking
and monitoring of assembly formation is furthermore demonstrated.
Article history:
Received 7 July 2011
Revised 13 October 2011
Accepted 17 October 2011
Available online 20 October 2011
Keywords:
Amino-LNA
Ó 2011 Elsevier Ltd. All rights reserved.
Anthracene
Photoligation
DNA cross-linking
1. Introduction
conjugating properties of 20-amino-LNA monomers25,26 to introduce
covalent junctions either in the middle or at terminal positions of
Chemical ligation and photodimerization reactions have been
implemented within synthetic chemistry, biochemistry, biomedi-
cine, and nanotechnology.1–10 Accordingly, there are numerous re-
ports concerning both chemical ligation3,7,8,11–14 and photoligation
of nucleic acid constructs.15–21 Photoligation can be considered the
more promising of these two non-enzymatic reactions for covalent
linking of nucleic acid strands as it does not require any reagents
except for the nucleic acid strands involved. Moreover, the reaction
progress can be straightforwardly controlled by the duration of
sample irradiation and the wavelength applied.3,15 As nucleic acids
can be damaged by UV-B light (280–315 nm)22 it is important for
potential in vivo applications to identify suitable photo-reactive
groups which are able to form photoadducts at a wavelength safe
for human cells. One such group of compounds that are photoac-
tive above 300 nm are 9-substituted anthracene derivatives.
Anthracene has been applied as an intercalator and fluorophore
in nucleic acid contexts23,24 and is known to form photodimers
after exposure to light of a wavelength of 366 nm.15
complementary oligonucleotides. Notably, the 20-amino group of
20-amino-LNA monomers gives the opportunity of introducing addi-
tional functional groups which has resulted in numerous novel oligo-
nucleotide derivatives with various interesting properties and
applications.26–32 Herein we report efficient synthesis of a novel 20-
amino-LNA monomer functionalized with an anthracen-9-ylmethyl
group and the versatility of such monomers for photochemically in-
duced cross-linking of complementary nucleic acid strands.
2. Results and discussion
2.1. Chemical synthesis of anthracene-functionalized 20-amino-
LNA phosphoramidite 3
50-O-(4,40-Dimethoxytrityl)-protected 20-amino-LNA nucleoside
1 was prepared according to previously described procedures.33
Reductive amination of derivative 1 with 9-anthraldehyde in the
presence of sodium triacetoxyborohydride34 gave nucleoside 2 in
76% yield. Subsequent standard phosphitylation using 2-cyano-
ethyl-N,N,N0,N0-tetraiso-propylphosphordiamidite furnished in
69% yield the anthracene-functionalized 20-amino-LNA phospho-
ramidite 3 (Scheme 1) which was used on an automated DNA syn-
thesizer to prepare oligonucleotides containing monomer T⁄
(Table 1; Scheme 2; See Section 4 for details).
There are only few reports describing formation of covalent bonds
between nucleic acid strands via anthracene photo-dimer forma-
tion,15,16,18 and photoligation between anthracene rings has mostly
involved derivatives attached via linkers to oligonucleotide 50- and
30-ends. We decided to combine the photochemical properties of 9-
substituted anthracene derivatives with the duplex-stabilizing and
2.2. Photoligation studies
⇑
Corresponding author. Tel: +45 6550 2510; fax: +45 6550 4385.
E-mail address: jwe@ifk.sdu.dk (J. Wengel).
Tel.: +45 6550 2510; fax: +45 6617 8760.
The sequences of the oligonucleotide substrates used in photo-
ligation reactions and the expected constructs formed upon
0968-0896/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2011.10.052

7408
K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
Scheme 1. Synthesis of 9-methylanthracene 20-amino-LNA O30-phosphoramidite derivative 3.
Table 1
Names and sequences of oligonucleotides used in photoligation studies containing methylanthracene 20-amino-LNA (T⁄), and schematic structures of the DNA constructs studied
Oligonucleotide name
Sequence (50–>30)
Construct
ON1
ON2
CGTTTATATATCACG
T⁄AAACG
CGTGATAT⁄
CGTTTAATATCACG
ON3
ON4
GCAT⁄ATCAC
GTGAT⁄ATGC
ON5
ON6
GCATAT⁄CAC
ON7
ON8
ON9
CTGCAACGCAACGCAACGTC
T⁄GCAG
T⁄GCGT⁄
GACGT⁄
ON10
ON11
T⁄CCGCAAAAGCGGAACCGGT⁄
ON12
hybridization are shown in Table 1. ON2 and ON3 contain mono-
mer T⁄ at the 50- and 30-end, respectively, and are designed to bind
ON1 or ON4. Hybridization between these oligonucleotides results
in the formation of three-stranded constructs A and B with a dis-
continuity in the central region. The monomers T⁄ of constructs
A and B were positioned to evaluate the ability to link between
the two anthracene-functionalized monomers in two oligonucleo-
tides hybridizing with a one nucleotide gap (construct A) or juxta-
positioned (construct B) on a template oligonucleotide. The second
group of constructs C and D were designed to study cross-linking
between two oligonucleotides together forming a duplex having
one T⁄ monomer in each strand at internal positions. From our ear-
lier results on the formation of interstrand contacts between pyr-
ene units attached to 20-amino-LNA monomers29 we anticipated
suitable orientation of the anthracene moieties of monomers T⁄
in constructs C and D for photochemical ligation and thus inter-
strand cross linking. Additional constructs studied are E formed
by five oligonucleotides, and F formed by the self-complementary
ON12.
eties (at 325–400 nm).35 Formation of the expected products was
also tested using ion exchange HPLC and by thermodynamic stabil-
ity studies. Reversibility of photoligation was tested by heating the
products at 90 °C for 4 and 16 h.
Irradiation of construct A at 366 nm for 5 min resulted in forma-
tion of a minor amount of photoadduct. As expected the efficiency
of photoligation increased over time and after 60 min almost full
conversion was reached (Fig. 1a). In case of construct B with two
juxtapositioned anthracene-functionalized 20-amino-LNA mono-
mers, the formation of a photoadduct was likewise observed. The
reaction progress, as evaluated by UV–vis spectroscopy in the
325–400 nm region, was similar to that observed for construct A,
although a slightly faster photoligation reaction for construct B
was indicated (Fig. 1b). This difference indicates the importance
of preorganizing the anthracene moieties in close proximity for
efficient photodimerization. Formation of the photoadducts was
also confirmed by HPLC chromatograms (Supplementary data
Fig. 4).
Constructs C and D also formed photoadducts. The changes in
band intensities in the 325–400 nm region of the UV-vis spectra
indicated that the progress of the photoligation was slightly faster
for construct C than for D (Fig. 1c and d), although in both cases the
To study the progress of the photochemical ligation reactions,
that is, anthracene photodimer formation, we have followed the
decrease of band intensities originating from the anthracene moi-

K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
7409
Scheme 2. Chemical structures of 20-N-amino-LNA monomers (a-c) and asymmetric doubler (d).
reactions reached full completion after irradiation for 60 min. The
analysis of ion exchange HPLC chromatograms of constructs C and
D after photoligation revealed formation of two main products in-
stead of one (Supplementary data Fig. 5), probably due to the fact
that 9-substituted anthracene derivatives can photodimerize
according to ‘head-to-tail’ or ‘head-to-head’ geometries.36 We next
proceeded to testing photoligation of the higher-ordered self-
assembled DNA constructs E and F. In both cases UV spectra con-
firmed successful formation of photodimers (Fig. 1e and f), and in
case of construct F its formation was confirmed also by MALDI-
MS (See Supplementary data).
The main objective of the thermodynamic analysis was to show
differences in thermodynamic stability of modified constructs be-
fore and after irradiation. Analyses of the corresponding unmodi-
fied DNA counterparts of constructs A, B, C and D were made as
reference for the remaining data. Unexpectedly, the melting pro-
files of non-ligated constructs A and B, each composed of three
strands, were characterized by a single transition. Presumably
strong inter-strand stacking interactions involving the anthracene
moieties induce the two short strands to melt cooperatively. Ther-
modynamic studies of DNA complexes before and after irradiation
at 366 nm revealed decrease in thermodynamic stability of photo-
ligated products (Table 2). Destabilization of both structures A and
B after formation of anthracene photoadducts might be caused by
generation of local distortions in the structure induced by the no-
vel covalent linkage or loss of aromatic character of the anthracene
rings after photoligation, what causes loss of stacking interactions
between those systems. Photodimerization of duplexes C and D
caused stronger decrease of thermodynamic stability (Table 2),
what indicates a more prominent influence of the photoproduct
when placed centrally in constructs, presumably due not only to
the loss of stacking interactions between anthracene rings but
most probably also to additional structural perturbations.
2.3. Thermodynamics
Although many anthracene-formed photodimers are thermally
unstable37 we found photoadducts formed from constructs A–D
to be thermally stable. We incubated photoligation products at
90 °C in the buffer solution used during irradiation, but no indica-
tions of reversibility in photodimer formation, even after 16 h, was
indicated (Supplementary data Fig. 6). We therefore decided to cal-
culate thermodynamic parameters for those photoadducts.

7410
K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
Figure 1. UV spectra of DNA constructs A (a), B (b), C (c) D (d), E (e) and F (f). Time of exposure to 366 nm UV light: 0 min–black, 5 min–red, 10 min–green, 30 min–blue,
60 min–cyan.
2.4. Formation and analysis of anthracene-based photoadducts
in the presence of different 20-amino-LNA modified monomers
duplex segment of the construct contains two T⁄ monomers for
photoligation (here duplex cross-linking), another segment two
20-N-(pyren-1-ylcarbonyl)amino-LNA monomers28 (TPyCO) and the
To illustrate the applicability of the novel photoligation
reactions we incorporated the anthracene-functionalized 20-ami-
no-LNA monomers T⁄ into ON14 and ON15 (Table 3). The four
branched oligonucleotides ON13–ON16 were designed to hybrid-
ize to form the simple dendrimer-like construct I (Table 3). One
third two 20-N-(pyren-1-ylmethyl)amino-LNA monomers29 (TPyMe
)
(see Scheme 2 for structures of monomers). As positioned in con-
struct I, the TPyMe and TPyCO monomers should signal hybridization,
and thus construct formation, by excimer-band formation and
monomer fluorescence light-up, respectively.28,29

K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
7411
The previous series of experiments revealed complete photoli-
gation after 60 min which we therefore applied here. UV-spectra
upon mixing of ON14+ON15, ON13+ON14+ON15 and ON13+O-
N14+ON15+ON16 and subsequent irradiation at 366 nm demon-
strated the ability to photodimerize the two anthracene units in
all three cases (Fig. 2a–c, respectively). Next we showed that
photoligation is possible regardless of system complexity. This is
presented in Figure 3 as no anthracene signals are observed above
350 nm after photoligation subsequent to mixing two
(ON14+ON15), three (ON13+ON14+ON15) or four (ON13+O-
N14+ON15+ON16) components of construct I.
Fluorescence-based detection of self-assembly of branches
ON13 and ON16 with ON14 was possible due to hybridiza-
tion-induced changes in fluorescence spectra, that is, emergence
of an excimer band in the region 450-550 nm for the TPyMe con-
taining duplex segment and increased pyrene monomer fluores-
cence signals in the region 370–410 nm for the TPyCO containing
segment, respectively.28,29 The fluorescence picture during
sequential addition of the individual branched oligonucletides
to form construct
I is depicted in Figure 5. The starting
branched oligonucleotide ON13 shows only low fluorescence
intensity as expected (black line). After hybridization with
ON14, the emergence of a strong eximer signal is observed
which can be explained by interstrand communication between
the two pyrene units of the TPyMe monomers (red line). Es ex-
pected, further addition of ON15 does not modulate the fluores-
cence (green line). Addition finally of ON16 induces a significant
intensity increase in the pyrene monomer fluorescence signals
according to the expectation with two TPyCO monomers posi-
tioned as in ON16 (dark blue line). All together, the fluorescence
changes described above testify to successful self-assembly of
construct I. Eventually, photoligation was induced by UV light
irradiation for 60 min which did not significantly change the
fluorescence fingerprint of the mixture (light blue line) which
indicates that photoligation takes place without disrupting the
self-assembled construct I (Fig. 4).
3. Conclusions
A novel 20-N-amino-LNA anthracene-functionalized phospho-
ramidite monomer has been synthesized and successfully incor-
porated into oligonucleotides using automated DNA synthesis.
Efficient anthracene photodimer-formation was achieved in dif-
ferent DNA-based constructs leading to covalent interstrand
crosslinks upon irradiation at 366 nm. Photodimer formation
seems to be independent of oligonucleotide sequence, and can
be realized even in higher-order constructs. The results described
herein open new ways of constructing and designing covalently
linked higher-ordered DNA constructs.
4. Experimental section
4.1. General methods
All reagents were used as purchased. Reactions under anhy-
drous conditions were carried out under an atmosphere of argon
or nitrogen. Solvents were of HPLC grade, of which dichlorometh-
ane and dichloroethane were dried over 4 Å molecular sieves and
acetonitrile over 3 Å molecular sieves. Progress in reactions was
monitored by thin-layer chromatography (TLC) on analytical
Merck silica gel TLC aluminium plates (60 F254) with fluorescence
indicator. For column chromatography, Merck silica gel 60 (0.040–
0.063 mm) was used. After column purification, fractions contain-
ing product were combined, dried over Na2SO4, filtrated, and
evaporated to dryness at reduced pressure. 1H NMR spectra were

7412
K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
Table 3
PyMe
Sequences of branched oligonucleotides and scheme of 3-way junction nanoconstruct formed. Modified monomers: 20-N-(pyren-1-yl)methyl-20-amino-LNA thymine (
),
(T )
2 for
PyCO
20-N-(anthracene-9-yl)methyl-20-amino-LNA thymine
structures of modified monomers
), 20-N-(pyren-1-yl)carbonyl-20-amino-LNA thymine
(
), asymmetric doubler ((AD)). See Scheme
)
(T*)
(
(T
Branched oligonucleotides
Name of oligonucleotide
Sequence
Construct
ON13
ON14
ON15
ON16
Figure 2. UV spectra comparisons before/after photoligation of systems ON14 and ON15 (a), ON13, ON14 and ON15 (b), and ON13, ON14, ON15 and ON16 (c).
recorded at 300 MHz, 13C NMR spectra at 75.5 MHz and 31P NMR
spectra at 121.5 MHz. Chemical shifts are reported in ppm relative
to either tetramethylsilane or the deuterated solvent (dH: CDCl3
7.26 ppm; dC: CDCl3 77.0 ppm) as internal standard for 1H NMR
and 13C NMR, and relative to 85% H3PO4 as an external standard
for 31P NMR. Assignments of NMR spectra, when given are based
on 2D NMR experiments (the assignments of methylene protons/
methylene carbons may be interchanged). Coupling constants
(J values) are given in Hz. MALDI-HRMS spectra were recorded in
positive ion mode on an Ion Spec Fourier transform mass
spectrometer. MALDI-MS analysis of oligonucleotides was
performed on a Perseptive Voyager STR (Applied Biosystems)
MALDI-time-of-flight apparatus using 3-hydroxypicolinic acid as
matrix in positive ion mode using delayed ion extraction.

K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
7413
Figure 5. Fluorescence changes upon stepwise addition of branched oligonucleo-
tides to form construct I. See text for explanation.
Figure 3. UV spectra comparison of order of photoligation of systems
(ON14+ON15)600+ON13+ON16 (black), (ON13+ON14+ON15)600+ON16 (red) and
(ON13+ON14+ON15+ON16)600(green); UV induced photoadduct formation was
performed after addition of two, three and four oligonucleotides, respectively, as
indicated by underlining above, whereupon addition of the remaining strands (if
relevant) was performed.
6.19 (1H, s, H10), 5.24 (1H, s, 30-OH), 5.16–4.91 (2H, m, Ar-CH2),
4.26 (1H, d, J = 4.29, H-20), 3.84 (1H, br s, H-30), 3.71 (6H, s,
2 ꢂ OCH3), 3.24–3.13 (2H, m, H-50), 2.58–2.40 (2H, m, H-500), 1.55
(3H, s, CH3); 13C NMR (CDCl3) d 164.0, 158.5, 150.0, 144.4, 135.4,
135.3, 135.1, 131.3, 130.5, 130.0, 129.9, 129.2, 128.9, 127.9,
127.8, 126.9, 126.0, 124.8, 124.0, 113.1, 110.3, 88.7, 86.3, 82.8,
70.3, 67.2, 59.4, 55.1, 54.7, 45.4, 12.6; ESI-MS m/z 784.30
[M+Na]+ (calcd for C47H43N3O7, 784.30).
4.2. (1R,3R,4R,7S)-5-(Anthracen-9-ylmethyl)-1-(4,40-
dimethoxytrityloxymethyl)-7-hydroxy-3-(thymin-1-yl)-2-oxa-
5-azabicyclo[2.2.1]heptane (2)
DMT protected 20-amino-LNA nucleoside 133 (200.0 mg,
0.35 mmol) was dissolved in anhydrous dichloroethane (4 ml)
and 9-anthraldehyde (76.3 mg, 0.37 mmol) and sodium triacetoxy-
borohydride (111.0 mg, 0.52 mmol) were added. The mixture was
stirred under an argon atmosphere at room temperature for 2 h.
A saturated aqueous solution of sodium bicarbonate was added
and the resulting mixture was extracted three times with dichloro-
methane. The combined organic phase was dried with anhydrous
sodium sulphate, filtered and concentrated to dryness under re-
duced pressure to give a yellow foam. Purification of this residue
by silica gel column chromatography (0–1% v/v MeOH/CH2Cl2)
afforded nucleoside 2 (201.9 mg, 0.266 mmol, 76.0%) as a white
foam. 1H NMR (CDCl3) d 9.31 (1H, s, NH), 8.37ꢀ6.73 (23H, m, Ar),
4.3. (1R,3R,4R,7S)-5-(Anthracen-9-ylmethyl)-7-(2-
cyanoethoxy(diisopropylamino)phosphinoxy)-1-(4,40-
dimethoxytrityloxymethyl)-3-(thymin-1-yl)-2-oxa-5-
azabicyclo[2.2.1] heptane (3)
To a solution of compound 2 (167 mg, 0.22 mmol) in anhydrous
dichloromethane (4 ml) were added N,N-diisopropylammonium
tetrazolide (75 mg, 0.44 mmol) and 2-cyanoethyl-N,N,N0,N0-tetra-
isopropylphosphoramidochloridite (153 ll, 80 mg, 0.48 mmol).
The resulting mixture was stirred for 12 h at room temperature. A
saturated aqueous solution of sodium bicarbonate was added
and the resulting mixture was extracted three times with
Figure 4. Fluorescence spectra before and after photoligation of systems ON13+ON14+ON15 (a) and ON14+ON15+ON13+ON16 (b).

7414
K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
dichloromethane containing 1% (v/v) of triethylamine. The organic
phases were combined, dried with anhydrous sodium sulfate and
concentrated to dryness under reduced pressure. The residue was
purified by silica gel column chromatography using as eluent cyclo-
hexane containing 1% (v/v) of triethylamine and a gradually increas-
ing fraction of ethyl acetate (from 0% to 50%) furnishing product 3 as
a white foam (144.4 mg, 68.5%). 31P NMR (CDCl3) d 149.84 and
149.13. ESI-MS m/z: 984.41 [M+Na]+ (calcd for C56H60N5O8P,
984.41).
at 366 nm for 5, 10, 30, and 60 min using a high pressure mercury
lamp (Philips, HPL, 125 W). The mixtures were analyzed by IC and
UV–vis spectroscopy.
4.7. UV–vis spectra
7.5 lM solutions of each duplex were prepared and analyzed in
1 mM phosphate buffer containing 1 M NaCl, and 0.5 mM Na2EDTA
at pH 7.0. The spectra were recorded in the 200–500 nm wavelength
range at 25 °C on a Beckman DU 800 spectrophotometer equipped
with a six position microcell holder and thermoprogrammer.
4.4. Oligonucleotide synthesis
Modified oligonucleotides were synthesized using a standard
DNA synthesis protocol with 15 min coupling time for the modified
phosphoramidites 3 and AD (Schemes 1 and 2) and 30 minutes
coupling times for the known phosphoramidites28,29 correspond-
ing to 20-amino-LNA monomers TPyMe and TPyCO (Scheme 2) on a
Biosystems Expedite automated DNA synthesizer instrument in
4.8. Fluorescence steady-state emission spectra
Steady-state fluorescence emission spectra (kem = 350–600 nm)
of given samples were recorded using Perkin Elmer LS 55 lumines-
cence spectrometer with a temperature controller in 1 mM phos-
phate buffer containing 1 M NaCl and 0.5 mM Na2EDTA, pH 7.0
using an excitation wavelength of kex = 350 nm at 20 °C. For
0.2 lM scale. Coupling efficiencies varied from 70% in case of the
AD amidite to 98% in case of 20-N-amino-LNA derivatives. The pro-
cedure of asymmetric branching provided by the supplier (Glen
Research) was used to enable synthesis of branched structures
with the central AD monomer linking three different oligonucleo-
tide strands. Cleavage of synthesized oligonucleotides from solid
supports as well as removal of protecting groups was accom-
plished using standard conditions (32% aqueous ammonia, 55 °C,
12 h). Such DMT-ON prepared oligonucleotides were purified by
RP–HPLC (Waters Prep LC 4000) followed by standard removal
(80% AcOH, 20 min) of DMT protecting groups and precipitation
(Acetone, ꢀ20 °C, 12 h). The composition of oligonucleotide prod-
ucts was verified by MALDI-TOF mass spectrometry and the con-
recording spectra 0.1
lM concentration of duplexes and 0.2–
0.3 M concentrations of the constructs involving branched con-
l
structs were used. Steady state fluorescence emission spectra were
obtained as an average of five scans using an emission wavelength
of 343 nm and a scan speed of 120 nm/min.
Acknowledgements
The Nucleic Acid Center is a research center of excellence
funded by the Danish National Research Foundation for studies
on nucleic acid chemical biology. We gratefully acknowledge
financial support by The Danish National Research Foundation.
centrations were determined using
a
Beckman DU 800
spectrophotometer. The purity (>80%) of synthesized oligonucleo-
tides was verified by ion-exchange HPLC (LaChrom L-7000 system
equipped with a Dionex PA100 column using a gradient of 2–80%
NaClO4 in 0.2 M NaOH pH 12).
A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2011.10.052.
4.5. UV melting studies
References and notes
Thermal denaturation studies involved duplex meltings in
1 mM phosphate buffer containing 1 M NaCl and 0.5 mM Na2EDTA
at pH 7.0. Such high ionic strength of the buffer was used in order
to stabilize short, unligated oligonucleotides as well as it has been
used in the literature.22 Oligonucleotide single strand concentra-
tions were calculated from the absorbance above 80 °C and extinc-
1. Rozkiewicz, D. I.; Gierlich, J.; Burley, G. A.; Gutsmiedl, K.; Carell, T.; Ravoo, B. J.;
Reinhoudt, D. N. ChemBioChem 2007, 8, 1997.
2. Seeman, N. C. Annu. Rev. Biophys. Biomol. Struct. 1998, 27, 225.
3. Xu, Y.; Kool, E. T. J. Am. Chem. Soc. 2000, 122, 9040.
4. El-Sagheer, A. H.; Cheong, V. V.; Brown, T. Org. Biomol. Chem. 2011, 9, 232.
5. Seo, T. S.; Bai, X.; Ruparel, H.; Li, Z.; Turro, N. J.; Ju, J. Proc. Natl. Acad. Sci. U.S.A.
2004, 101, 5488.
tion coefficients were approximated by
a nearest–neighbour
6. El-Sagheer, A. H.; Kumar, R.; Findlow, S.; Werner, J. M.; Lane, A. N.; Brown, T.
ChemBioChem 2008, 9, 50.
model.38,39 Complementary oligonucleotides were mixed at a 1:1
ratio. Absorbance vs. temperature melting curves were measured
at 260 nm with a heating rate of 1 °C/min from 5 to 95 °C on a
Beckman DU 800 spectrophotometer equipped with a six-position
microcell holder and thermoprogrammer. The measurements were
taken for nine different concentrations of each duplex. Melting
curves were analyzed and thermodynamic parameters calculated
according to the two-state model with the program MeltWin 3.5.
7. Le Droumaguet, B.; Velonia, K. Macromol. Rapid Commun. 2008, 29, 1073.
8. Moses, J. E.; Moorhouse, A. D. Chem. Soc. Rev. 2007, 36, 1249.
9. Kolb, H. C.; Sharpless, K. B. Drug Discovery Today 2003, 8, 1128.
10. Moran, N.; Bassani, D. M.; Desvergne, J.-P.; Keiper, S.; Lowden, P. A. S.; Vyle, J.
S.; Tucker, J. H. R. Chem. Commun. 2006, 5003.
11. Kocalka, P.; El-Sagheer, A. H.; Brown, T. ChemBioChem 2008, 9, 1280.
12. Ihara, T.; Mukae, M. Anal. Sci. 2007, 23, 625.
13. Morvan, F.; Meyer, A.; Pourceau, G.; Vidal, S.; Chevolot, Y.; Souteyrand, E.;
Vasseur, J.-J. Nucleic Acids Symp. Ser. (Oxf) 2008, 52, 47.
14. Paredes, E.; Das, S. R. ChemBioChem 2011, 12, 125.
15. Ihara, T.; Fujii, T.; Mukae, M.; Kitamura, Y.; Jyo, A. J. Am. Chem. Soc. 2004, 126,
8880.
16. Ihara, T.; Mukae, M.; Tabara, M.; Kitamura, Y.; Jyo, A. Nucleic Acids Symp. Ser.
(Oxf) 2005, 49, 41.
17. Liu, J.; Taylor, J. S. Nucleic Acids Res. 1998, 26, 3300.
18. Arslan, P.; Ihara, T.; Mukae, M.; Jyo, A. Nucleic Acids Symp. Ser. (Oxf) 2007, 51,
237.
The majority of
D
H° values derived from TꢀM1 versus ln (CT/4) plots
was within 15% of those derived from averaging the fits to individ-
ual melting curves (data not shown) as expected if a two-state
model is valid.
4.6. Photoligation
19. Fujimoto, K.; Yoshimura, Y.; Ikemoto, T.; Nakazawa, A.; Hayashi, M.; Saito, I.
Chem. Commun. 2005, 3177.
Solutions of constructs (7.5 lM of each oligonucleotide) were
20. Ami, T.; Fujimoto, K. ChemBioChem 2008, 9, 2071.
21. Mukae, M.; Ihara, T.; Tabara, M.; Jyo, A. Org. Biomol. Chem. 2009, 7, 1349.
22. Sinha, R. P.; Häder, D.-P. Photochem. Photobiol. Sci. 2002, 1, 225.
23. Yamana, K.; Aota, R.; Nakano, H. Tetrahedron Lett. 1995, 36, 8427.
24. Ranasinghe, R. T.; Brown, T. Chem. Commun. 2005, 5487.
25. Koch, T. J. Phys.: Condens. Matter 2003, 15, S1861.
prepared in 1 mM phosphate buffer containing 1 M NaCl and
0.5 mM Na2EDTA, pH 7.0. Complementary strands were annealed
for two minutes at 100 °C, whereupon the resulting mixture was
slowly cooled to room temperature, cooled to 0 °C and irradiated

K. Pasternak et al. / Bioorg. Med. Chem. 19 (2011) 7407–7415
7415
26. Wengel, J. Org. Biomol. Chem. 2004, 2, 277.
34. Abdel-Magid, A. F.; Carson, K. G.; Harris, B. D.; Maryanoff, C. A.; Shah, R. D. J.
Org. Chem. 1996, 61, 3849.
35. Tucker, J. H. R.; Bouas-Laurent, H.; Marsau, P.; Riley, S. W.; Desvergne, J.-P.
Chem. Commun. 1997, 13, 1165.
36. Greene, F. D.; Misrock, S. L.; Wolfe, J. R. J. Am. Chem. Soc. 1955, 77, 3852.
37. Bouas-Laurent, H.; Castellan, A.; Desvergne, J.-P.; Lapouyade, R. Chem. Soc. Rev.
2000, 29, 43.
27. Lindegaard, D.; Madsen, A. S.; Astakhova, I. V.; Malakhov, A. D.; Babu, B. R.;
Korshun, V. A.; Wengel, J. Bioorg. Med. Chem. 2008, 16, 94.
28. Hrdlicka, P. J.; Babu, B. R.; Sørensen, M. D.; Harrit, N.; Wengel, J. J. Am. Chem.
Soc. 2005, 127, 13293.
29. Hrdlicka, P. J.; Babu, B. R.; Sørensen, M. D.; Wengel, J. Chem. Commun. 2004,
1478.
30. Højland, T.; Babu, B. R.; Bryld, T.; Wengel, J. Nucleosides, Nucleotides Nucleic
Acids 2007, 26, 1411.
31. Babu, B. R.; Hrdlicka, P. J.; McKenzie, C. J.; Wengel, J. Chem. Commun. 2005,
1705.
38. Richards, E. G. In Handbook of Biochemistry and Molecular Biology Nucleic Acids;
Fasman, G. D., Ed., third ed.; OH CRS Press: Cleveland, 1975; pp 596–603. Vol. 1.
39. Borer, P. N. In Handbook of Biochemistry and Molecular Biology Nucleic Acids;
Fasman, G. D., Ed., third ed; OH CRS Press: Cleveland, 1975; pp 589–595. Vol. 1.
32. Umemoto, T.; Hrdlicka, P. J.; Babu, B. R.; Wengel, J. ChemBioChem 2007, 8, 2240.
33. Rosenbohm, C.; Christensen, S. M.; Sørensen, M. D.; Pedersen, D. S.; Larsen,
L.-E.; Wengel, J.; Koch, T. Org. Biomol. Chem. 2003, 1, 655.