Novel ROR1 inhibitor ARI-1 suppresses the development of non-small cell lung cancer

Article abstract of DOI:10.1016/j.canlet.2019.05.016

Limited drug response and severe drug resistance confer the high mortality of non-small-cell lung cancer (NSCLC), a leading cause of cancer death worldwide. There is an urgent need for novel treatment against NSCLC. Receptor tyrosine kinase-like orphan receptor 1 (ROR1) is aberrantly overexpressed and participats in NSCLC development and EGFR-TKIs-induced drug resistance. Increasing evidences indicate that oncogenic ROR1 is a potential target for NSCLC therapy. However, nearly no ROR1 inhibitor was reported until now. Here, combining the computer-aided drug design and cell-based activity screening, we discover (R)-5,7-bis(methoxymethoxy)-2-(4-methoxyphenyl)chroman-4-one (ARI-1) as a novel ROR1 inhibitor. Biological evaluation demonstrates that ARI-1 specifically targets the extracellular frizzled domain of ROR1 and potently suppresses NSCLC cell proliferation and migration by regulating PI3K/AKT/mTOR signaling in a ROR1-dependent manner. Moreover, ARI-1 significantly inhibits tumor growth in vivo without obvious toxicity. Intriguingly, ARI-1 is effective to EGFR-TKIs-resistant NSCLC cells with high ROR1 expression. Therefore, our work suggests that the ROR1 inhibitor ARI-1 is a novel drug candidate for NSCLC treatment, especially for EGFR-TKIs-resisted NSCLC with high ROR1 expression.

Full text of DOI:10.1016/j.canlet.2019.05.016

Accepted Manuscript
Novel ROR1 Inhibitor ARI-1 Suppresses the Development of Non-Small Cell Lung
Cancer
Xuesha Liu, Wenchen Pu, Huaiyu He, Xin Fan, Yuanyuan Zheng, Jian-Kang Zhou,
Rui Ma, Juan He, Yuzhu Zheng, Ke Wu, Yun Zhao, Sheng-Yong Yang, Chun Wang,
Yu-Quan Wei, Xia-Wei Wei, Yong Peng
PII:
S0304-3835(19)30311-8
https://doi.org/10.1016/j.canlet.2019.05.016
CAN 14395
DOI:
Reference:
To appear in: Cancer Letters
Received Date: 29 January 2019
Revised Date: 14 May 2019
Accepted Date: 15 May 2019
Please cite this article as: X. Liu, W. Pu, H. He, X. Fan, Y. Zheng, J.-K. Zhou, R. Ma, J. He, Y. Zheng,
K. Wu, Y. Zhao, S.-Y. Yang, C. Wang, Y.-Q. Wei, X.-W. Wei, Y. Peng, Novel ROR1 Inhibitor ARI-1
Suppresses the Development of Non-Small Cell Lung Cancer Cancer Letters, https://doi.org/10.1016/
j.canlet.2019.05.016.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Abstract
Limited drug response and severe drug resistance confer the high mortality of
non-small-cell lung cancer (NSCLC), a leading cause of cancer death worldwide.
There is an urgent need for novel treatment against NSCLC. Receptor tyrosine
kinase-like orphan receptor 1 (ROR1) is aberrantly overexpressed and participats in
NSCLC development and EGFR-TKI-induced drug resistance. Increasing evidences
indicate that oncogenic ROR1 is a potential target for NSCLC therapy. However,
nearly no ROR1 inhibitor was reported until now. Here, combining the
computer-aided drug design and cell-based activity screening, we discover
(R)-5,7-bis(methoxymethoxy)-2-(4-methoxyphenyl)chroman-4-one (ARI-1) as a novel
ROR1 inhibitor. Biological evaluation demonstrates that ARI-1 specifically targets
the extracellular frizzled domain of ROR1 and potently suppresses NSCLC cell
proliferation and migration by regulating PI3K/AKT/mTOR signaling in a
ROR1-dependent manner. Moreover, ARI-1 significantly inhibits tumor growth in
vivo without obvious toxicity. Intriguingly, ARI-1 is effective to EGFR-TKIs-resistant
NSCLC cells with high ROR1 expression. Therefore, our work suggests that the
ROR1 inhibitor ARI-1 is a novel drug candidate for NSCLC treatment, especially for
EGFR-TKI-resisted NSCLC with high ROR1 expression.
.Keywords: NSCLC, ROR1, EGFR-TKIs, inhibitor, PI3K/AKT pathway

ACCEPTED MANUSCRIPT
Novel ROR1 Inhibitor ARI-1 Suppresses
the Development of Non-Small Cell Lung Cancer
Xuesha Liu1#, Wenchen Pu1#, Huaiyu He1, Xin Fan1,2, Yuanyuan Zheng1, Jian-Kang Zhou1, Rui Ma1,
Juan He1, Yuzhu Zheng1, Ke Wu1, Yun Zhao2, Sheng-Yong Yang1, Chun Wang3, Yu-Quan Wei1,
Xia-Wei Wei1* and Yong Peng1*
1State Key Laboratory of Biotherapy and Cancer Center, National Clinical Research Center for
Geriatrics, West China Hospital, Sichuan University, Chengdu 610041, China
2College of Life Science, Sichuan University, Chengdu 610065, China
3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China
#These authors contribute equally to this work.
*Corresponding author
Yong Peng, State Key Laboratory of Biotherapy and Cancer Center, National Clinical Research
Center for Geriatrics, West China Hospital, Sichuan University, Chengdu 610041, China. Renmin
South Road, Section 3-17, Chengdu 610041, China; Tel/Fax: 86-28-61105498;
E-mail:yongpeng@scu.edu.cn.
Xia-Wei Wei, State Key Laboratory of Biotherapy and Cancer Center, National Clinical Research
Center for Geriatrics, West China Hospital, Sichuan University, Chengdu 610041, China. Renmin
1

ACCEPTED MANUSCRIPT
South Road, Section 3-17, Chengdu 610041, China; Tel/Fax: 86-28-61105498; E-mail:
xiaweiwei@scu.edu.cn
Abbreviations
NSCLC: non-small cell lung cancer; EGFR: epidermal growth factor receptor; ROR1: receptor
tyrosine kinase-like orphan receptor 1; SPR: surface plasmon resonance; EGFR-TKIs: epidermal
growth factor receptor-tyrosine kinase inhibitors; PI3K: phosphatidylinositol 3 kinase; AKT: protein
kinase B; mTOR: mammalian target of rapamycin; HER3(ERBB3): human epidermal growth factor
receptor 3; IGF-IR: insulin-like growth factor 1 receptor; CAR-T: chimeric antigen receptor T cells;
CADD: computer-aided drug design; CETSA: cellular thermal shift assay; EdU:
5-ethynyl-2’-deoxyuridine; ADMET: absorption, distribution, metabolism, excretion and toxicity;
TOPKAT: toxicity prediction by komputer assisted technology; IHC: immunohistochemical; RIP3:
receptor-interacting serine/threonine-protein kinase 3.
2

ACCEPTED MANUSCRIPT
Abstract
Limited drug response and severe drug resistance confer the high mortality of non-small-cell
lung cancer (NSCLC), a leading cause of cancer death worldwide. There is an urgent need for novel
treatment against NSCLC. Receptor tyrosine kinase-like orphan receptor 1 (ROR1) is aberrantly
overexpressed and participats in NSCLC development and EGFR-TKI-induced drug resistance.
Increasing evidences indicate that oncogenic ROR1 is a potential target for NSCLC therapy.
However, nearly no ROR1 inhibitor was reported until now. Here, combining the computer-aided
drug
design
and
cell-based
activity
screening,
we
discover
(R)-5,7-bis(methoxymethoxy)-2-(4-methoxyphenyl)chroman-4-one (ARI-1) as a novel ROR1 inhibitor.
Biological evaluation demonstrates that ARI-1 specificly targets the extracellular frizzled domain of
ROR1 and potently suppresses NSCLC cell proliferation and migration by regulating
PI3K/AKT/mTOR signaling in a ROR1-dependent manner. Moreover, ARI-1 significantly inhibits
tumor growth in vivo without obvious toxicity. Intriguingly, ARI-1 is effective to
EGFR-TKIs-resistant NSCLC cells with high ROR1 expression. Therefore, our work suggests that
the ROR1 inhibitor ARI-1 is a novel drug candidate for NSCLC treatment, especially for
EGFR-TKI-resisted NSCLC with high ROR1 expression.
.Keywords: NSCLC, ROR1, EGFR-TKIs, inhibitor, PI3K/AKT pathway
3

ACCEPTED MANUSCRIPT
Introduction
Lung cancer is the leading cause of cancer-associated human death worldwide with a 5-year
survival rate of only 18% [1]. A histological subgroup collectively known as non-small cell lung
cancer (NSCLC), approximately 85% of all lung cancer cases, is usually diagnosed at an advanced
stage and had a poor prognosis [2, 3]. Epidermal growth factor receptor-tyrosine kinase inhibitors
(EGFR-TKIs), including gefitinib, afatinib and erlotinib, are FDA-approved first-line therapy for
advanced NSCLC [4]. However, limited drug response and severe drug resistance as a result of
EGFR-TKIs-induced secondary EGFR T790M or C797S mutations or alternative oncogenic gene
variations [5-7] summon new targets for NSCLC treatment.
Receptor tyrosine kinase-like orphan receptor 1 (ROR1) is a member of the receptor tyrosine
kinase family and consists of extracellular immunoglobulin-like domain, frizzled domain, kringle
domain and intracellular tyrosine kinase domain in structure [8]. Emerging evidence shows that
ROR1 is aberrantly overexpressed in various malignancies including ovarian, colorectal, lung
cancers and leukemia, playing an important role in cancer development [9-14]. For instance, ROR1
interacts with the protein TCL1 to accelerate chronic lymphocytic leukemia progression in Eꢀ-TCL1
transgenic mice [15]. The long noncoding RNA MAYA mediates the crosstalk between
ROR1-HER3 and Hippo-YAP pathways to promote bone metastasis of breast cancer [16]. ROR1 is
also crucial for lung cancer progression, where the oncogenic transcription factor NKX2-1 induces
ROR1 expression to sustain EGFR survival signaling [17]. A recent study reveals that ROR1
functions as a scaffold of cavin-1 and caveolin-1 for preventing lysosomal degradation of caveolin-1,
giving that ROR1 inhibition can overcome EGFR-TKIs resistance via bypass MET and IGF-IR
4

ACCEPTED MANUSCRIPT
signaling [18]. Therefore, ROR1 is a potential therapeutic target for NSCLC treatment, especially for
overcoming EGFR-TKIs-induced drug resistance.
The therapeutic potential of ROR1 in human cancer has been elucidated by monoclonal
antibody or chimeric antigen receptor T cells (CAR-T) based therapy. ROR1-specific monoclonal
antibodies were demonstrated to be effective to suppress breast cancer and leukemia [19-22].
Currently, the antibody Cirmtuzumab has been submitted to the phase I clinical trial in patients with
chronic lymphocytic leukemia [23]. Additionally, the immunotherapy by ROR1-specific CAR-T
cells showed significant antitumor activity for ROR1-positive tumors [24-28]. However, to the best
of our knowledge, nearly no small molecule targeting ROR1 has been reported. Although small
molecule KAN0439834 was found to induce apoptosis of chronic lymphocytic leukemia and
pancreatic carcinoma cells by targeting ROR1, the authors did not publish its chemical structure [29,
30]. Thus, the investigation of small molecule ROR1 inhibitors is still in its infancy.
In this work, we took advantage of the computer-aided drug design (CADD) and cell-based
activity screening, and discovered the small molecule ARI-1 as a potent ROR1 inhibitor targeting
ROR1 extracellular frizzled domain. ARI-1 significantly suppressed NSCLC both in vitro and in
xenograft mice, and specially overcame EGFR-TKIs resistance in a ROR1-dependent manner,
providing an attractive drug candidate for NSCLC treatment.
Materials and Methods
Homologous modeling, computer aided virtual screening and flexible docking
5

ACCEPTED MANUSCRIPT
The amino acid sequence of ROR1 frizzled domain was obtained from UniProt website
(https://www.uniprot.org, Entry: Q01973). The calculated 3D structure of frizzled domain was
simulated via homologous modeling on SWISS-MODEL website (www.swissmodel.expasy.org)
based on the amino acid sequence. In Discovery Studio v3.1 software, we established molecular
docking model, and performed virtual screening and flexible docking following GOLD docking and
Flexible docking protocols, respectively. The images of molecular docking results were processed by
PyMOL v1.8 software.
Preparation of recombinant protein
The sequence encoding the extracellular frizzled domain of ROR1 (amino acid residues of
61-393)
was
amplified
by
PCR
using
the
forward
primer
(TCGCGGATCCATGCATCACCATCACCATCACGATGAACCAATGAATAACATC) and the
reverse primer (CAGTCTCGAGTTATGAATCGCACGCTGGGATGT), and then cloned into
pFastBacTM HTb vector (Invitrogen, USA) at BamHI and XhoI sites. The resultant plasmid was
confirmed by Sanger sequencing and transformed into E. coli. DH10Bac to generate recombinant
bacmid DNA, which was then transfected into Spodoptera frugiperda (Sf9) insect cells to produce
baculovirus. After 3-round amplification, the baculovirus infected High Five cells to express the
N-terminal His-tagged frizzled domain of ROR1. The recombinant protein was purified with
Ni-NTA affinity agarose resin (GE Healthcare, USA), eluted with elution buffer (20 mM Tris-HCl,
150 mM NaCl, 300 mM imidazole, pH8.0), and further purified with Q-ion-exchange
chromatography (GE Healthcare, USA).
6

ACCEPTED MANUSCRIPT
Surface plasmon resonance (SPR)
The interaction between small molecule and ROR1 frizzled domain was evaluated by surface
plasmon resonance (SPR) using a BIAcore T100 instrument (GE Healthcare, USA) following
previous procedures with minor modification [31]. In brief, purified His-tagged ROR1 frizzled
domain was immobilized on a carboxyl methylated dextran sensor chip (Sensor Chip CM3). A flow
channel blocked by ethanolamine was used as control surface. The specific interaction of samples
with the immobilized ROR1 frizzled domain was assessed. In preliminary assay for ROR1
occupation, Wnt5a protein (Wnt5a directly binds to ROR1 frizzled domain) was used as the positive
control of ROR1 occupation. All samples were analyzed at a flow rate of 30 ꢀL/min with 10 mM
HEPES running buffer and contact time of 130 s. The surface was washed and regenerated with a 10
mM glycine-HCl buffer at pH 3.0 for 30 s followed by a 30 min waiting time for dissolution after
each experiment. The analyses were performed in BIAcore T100 evaluation software, version 2.0.2
(GE Healthcare, USA).
Patient samples
Primary NSCLC tumor tissues and their adjacent normal tissues were collected from West
China Hospital (China), which was approved by the Ethics Committee of West China Hospital of
Sichuan University. Written informed consent for research purposes was provided for the patients.
The patients’ tissues were dissected into small pieces, and grounded into powder in the liquid nitrogen.
Subsequently, cell lysates were obtained by adding RIPA buffer into the powder, and sonicated to
7

ACCEPTED MANUSCRIPT
efficiently lyze the cells, followed by centrifugation at 12000 rpm for 15 minutes at 4oC. The
resultant supernatants were subjected to Immunoblotting analysis.
Cell culture and construction of stable cell lines
Human lung cancer cells (PC9, H1975, A549, H441 and H1299) were cultured at 37°C in
RPMI-1640 medium plus 10% fetal bovine serum (FBS) and antibiotics in a 5% CO2 incubator. To
prepare lentivirus, pLKO.1-derived or pLVX-puro derived lentiviral plasmids were co-transfected
into 293TN cells with the packaging plasmid pCMV-dR8.2 dvpr and the envelope plasmid
pCMV-VSVG. At 48 hours after transfection, viruses were concentrated by the PEG-it Virus
precipitation solution (System Biosciences) and used to infect human lung cancer cells. Pools of
stable transfectants were selected by puromycin selection. The sequences of shRNAs targeting
ROR1 are CCCAGTGAGTAATCTCAGT (shROR1-1) and CCCAGAAGCTGCGAACTGT
(shROR1-2).
ROR1 expression by flow cytometric analysis
Cells were seeded in a 6-well plate and cultured for 48 h, then collected and washed 3 times
with phosphate-buffered saline (PBS) containing 2% FBS. Approximately 1×106 cells were
incubated for 30 min with APC-conjugated anti-human ROR1 (Biolegend, cat#357806) or control
IgG (Biolegend, cat#400120). After washing, cells were resuspended and subject to flow cytometry
on a FACSCalibur instrument (BD Biosciences). Data were analyzed by FlowJo 7.6.2 software.
8

ACCEPTED MANUSCRIPT
MTT assay
Cells were seeded in a 96-well plate (1500/well) and cultured overnight, then the compounds
dissolved in DMSO at varied concentrations was added to the medium. After 72 h treatment, MTT
solution was added and incubated at 37°C for 4 h. DMSO was added to dissolve the MTT-formazan
crystal and the OD570nm values of each well were determined by Microplate Reader. The IC50 value
was calculated from parallel experiments via Graphpad Prism 6.0 software.
Cellular thermal shift assay (CETSA)
The CETSA assay was performed under the guidance of previous work [32,33]. The lysates of
H1299 cells stably expressing flag-tagged ROR1 were divided into smaller aliquots (35 µL) and
incubated with ARI-1 (5 ꢀM) or vehicle at different temperatures for 3 minutes in T100 Thermal
Cycler (BioRad, USA) followed by cooling for 3 min on ice. The heated aliquots were then
centrifuged at 20,000 x g for 20 min at 4°C in order to separate the soluble fractions from
precipitates. The supernatants are subjected to SDS-PAGE and immunoblotting against anti-flag
antibody. The intensity of protein was quantified by ImageJ software and normalized to the value at
54oC.
EdU assay
The EdU assay was conducted under the guidance of our previous work with some modification
[34]. After treatment with ARI-1 (15 ꢀM) for 96 h, cells were incubated with 50 µM of EdU labeling
media for 2 h in a 5% CO2 incubator at 37°C, followed by fixation with 4% paraformaldehyde for 15
9

ACCEPTED MANUSCRIPT
min at room temperature and treatment with 0.5% Triton X-100 for 10 min at room temperature.
Then cells were stained with Apollo reaction solution, washed three times with cold PBS, and further
stained with Hoechst 33342 for 30 min. After washing, the cells were analyzed under fluorescence
microscope (Olympus, Japan) and Flow cytometer (BD Biosciences, America). The EdU
incorporation rate was analyzed as the ratio of EdU-positive cells to total Hoechst 33342-positive
cells.
Colony formation assay
Approximately 3000 NSCLC cells were seeded in 6-well plates and treated with ARI-1 (15 μ
M) in a 5% CO2 incubator. After 7 days, cells were fixed with 4% polyoxymethylene and stained
with crystal violet. The images for colony formation was recorded by high-resolution scanner.
Flow cytometric analysis for apoptosis
Briefly, cells treated with ARI-1 (15 ꢀM) or vehicle for 72 h were harvested and washed with
PBS, then resuspended in 200 µL of Annexin V binding buffer and stained with
Annexin-V-fluorescein isothiocyanate (FITC) for 15 min on ice in the dark. Subsequently, cells were
incubated with 5 µL of propidium iodide (PI) solution for 5 min, and subjected to flow cytometry on
a FACSCalibur instrument (BD Biosciences). The cells in the FITC-positive fraction were regarded
as apoptotic cells.
Immunoblotting
10

ACCEPTED MANUSCRIPT
The cells were treated with ARI-1 (15 ꢀM) for 72 h. Both adherent and floating cells were
collected and lysed by RIPA buffer containing protease inhibitor and phosphase inhibitor cocktails.
After protein concentration was detemined by BCA measurements, equivalent amounts of proteins
were subjected to SDS-PAGE and electrically transferred onto PVDF membrane (Millipore, USA).
Membrane was blocked for 1 h by 5% BSA at room temperature prior to incubation with antibodies
against p-AKT, AKT, p-mTOR, mTOR, p-P38, cleaved-PARP, PCNA or actin at 4°C overnight.
After washed three times with TBST, membrane was incubated in horseradish peroxidase-conjugated
second antibody for 1 h and washed three times with TBST. Finally the enhanced
chemiluminescence detection (Amersham Biosciences, Sweden) kit was used to detect signals.
Wound-healing assay
NSCLC cells plated in 6-well plates overnight. When the cells reached 95% confluence, sterile
pipette tips were used to scratch the wound uniformly. Cell motility in presence of the compound
ARI-1 (15 μM) was assessed by measuring the migration of cells into a scraped wound. The
wound-healing was monitored at 0 h, 24 h and 48 h by measuring the remaining area. The data were
normalized the remaining area of corresponding groups at 0 h.
Transwell migration assay
NSCLC cells were seeded in the top chambers of 24-well invasion chambers with RPMI-1640
medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin sulfate in the
bottom chambers. Immediately, ARI-1 (15 ꢀM) and vehicle were added to the top chambers. After
11

ACCEPTED MANUSCRIPT
24 hours, migration was terminated and the filters were fixed with 4% paraformaldehyde for 20 min
and stained with crystal violet for 10 min. Graphic images were recorded using microscope. The data
were normalized the corresponding migrated cells treated with vehicle.
Xenograft experiment
All animal experiments were performed according to the institutional ethical guidelines of
animal care. BALB/c nude mice were sub-cutaneously implanted with 3×106 H1975 cells in 50%
matrigel (injection volume of 100 μL/mouse). When the tumor volume reached about 150-200
mm3, nude mice were randomly assigned into control and treatment groups (n = 5/group). The
control group was given vehicle alone, and the treatment group received ARI-1 administration at the
dosage of 5 mg/kg via intravenous injection every two day for 14 days. The tumor volume was
calculated as follows: tumor volume = (length × width2)/2.
Histopathology and immunohistochemistry
BALB/c nude mice bearing tumors were treated with ARI-1 (5 mg/kg) or vehicle as described
above. After 14 days of dosing, individual mice were humanely euthanized, the samples of mice
organs were collected and fixed with formalin and embedded in paraffin. Sections measuring 4-8 ꢀm
in thickness were prepared for hematoxylin and eosin (H&E) staining and immunostaining with
antibody (anti-RIP3, Abcam). The liver of mice administrated with carbon tetrachloride was used as
positive control in immunohistochemistry. The images were acquired on an Olympus digital camera
attached to a light microscope.
12

ACCEPTED MANUSCRIPT
Statistical analysis
All values are expressed as mean ± SD. Raw data were analyzed using Graphpad Prism 6.0
software. The statistical significance between experimental group and control was determined by
Student’s t-test or Wilcoxon’s test. P values < 0.05 were considered statistically significant.
Results
ROR1 is a therapeutic target for NSCLC therapy
ROR1 is overexpressed in diverse types of human cancers and acts as an oncogene to promote
cell proliferation and migration [35]. To confirm the therapeutic potential of ROR1, we analyzed
ROR1 expression in NSCLC tumors and their adjacent normal tissues by immunoblotting analysis.
The results indicated that ROR1 was aberrantly overexpressed in NSCLC (Figure 1A and 1B).
Furthermore, we established the stable PC9 and H1975 cells with ROR1-knockdown by shRNAs
(Figure 1C). Consistent with previous results [36], ROR1 knockdown remarkably reduced cell
proliferation in both PC9 and H1975 cells (Figure 1D), suggesting that ROR1 is a promising target
for NSCLC therapy.
Computer-aided screening and chemical synthesis of ROR1 inhibitors
ROR1 consists of the extracellular immunoglobulin-like domain, the frizzled domain, the
kringle domain and the intracellular tyrosine kinase domain in structure [8]. Upon recognizing its
ligand Wnt5a, the extracellular frizzled domain of ROR1 activates its downstream oncogenic
13

ACCEPTED MANUSCRIPT
signaling pathways, indicating that the frizzled domain is a key motif for ROR1 function (Figure 2A)
[37-40]. However, its 3D structure was not dissected until now. Our bioinformatics analysis shows
that the amino acid sequence of ROR1 frizzled domain have high identity with that of MUSK
(muscle, skeletal receptor tyrosine-protein kinase), therefore we simulated the 3D structure of ROR1
frizzled domain via homology modeling in SWISS-MODEL website using MUSK as template [41].
The simulative 3D structure composed of four α-helixes and a β-sheet (Figure 2B). Small molecules
in a library containing 15133 compounds were screened in silico through GOLD molecular docking.
Higher GoldScore.Fitness value implies higher potential affinity between protein and small
molecules. Top-30 ranking hits were then submitted to the cell-based activity assay to evaluate their
inhibitory activity in NSCLC cells. The results suggested several hits had desirable activity (Figure
2C). Intriguingly, a majority of bioactive hits shared a common “(R)-2-phenylchroman-4-one”
skeleton, also known as (R)-flavanone (Figure 2D). Thus, we speculated that (R)-flavanone
derivatives were favorable to inhibit ROR1 function.
To verify this speculation, a series of (R)-flavanone derivatives synthesized by asymmetric
1,4-addition of phenylboronic acids to chromones catalyzed by Pd(TFA)2/(S)-tBuPyOX system [42,
43]. Starting from diverse substituted arylboronic acids and chromone, the enantiomeric compounds
1-20 were successfully prepared for the surface plasmon resonance (SPR) assay and the MTT assay
at the sample concentrations of 5 ꢀM and 50 ꢀM, respectively (Figure 2E and S1). Recombinant
extracellular ROR1 proteins were expressed in baculovirus expression system and purified by
affinity chromatography (Figure 2F). Compound 3 exhibited both good affinity to ROR1 frizzled
14

ACCEPTED MANUSCRIPT
domain and potent inhibitory activity against H1975 cells (Figure 2G, Table 1), providing a
favorable lead structure for ROR1 inhibitor.
To obtain better bioactive molecules based on compound 3, we next synthesized compounds
21-40
by
Pd(TFA)2/(S)-tBuPyOX-catalyzed
asymmetric
conjugate
addition
of
4´-methoxylphenylboronic acid to diverse chromones (Figure 2E and S2). Compounds 41 and 42
were afforded by the deprotection from compound 39 and 40 (Figure 2E and S2). The results of SPR
assay
and
MTT
assay
suggested
compound
39
((R)-5,7-bis(methoxymethoxy)-2-(4-methoxyphenyl)chroman-4-one, thereafter referred as ARI-1)
was the most potent and bioactive ROR1 inhibitor with 88.07% of ROR1 occupation at 5 ꢀM and
93.44% of NSCLC inhibition at 50 ꢀM (Figure 2H and 2I, Table 2), giving a potential lead
compound for NSCLC treatment.
ARI-1 directly interacts with the ROR1 frizzled domain
To further check the in vitro interaction between ROR1 and ARI-1, we performed cellular
thermal shift assay (CETSA) and SPR assay to characterize the protein-small molecule interaction.
The stable H1299 cells with Flag-ROR1 overexpression were established for CETSA experiments
(Figure 3A). As shown in Figure 3B and 3C, ARI-1 significantly increased the thermal stability of
ROR1 with a temperature shift of 1.715oC, indicating the direct binding of ARI-1 with ROR1.
Moreover, SPR assays further confirmed the strong binding affinity of ARI-1 with ROR1 in vitro
with a dissociation constant (Kd value) of 0.468 ꢀM (Figure 3D). To interpret the structural basis of
ROR1-ARI-1 interaction, we simulated the binding pattern of ROR1 and ARI-1 via the flexible
15

ACCEPTED MANUSCRIPT
docking in Discovery Studio software. The data showed that ARI-1 directly bound to the ROR1
frizzled domain through the amino acid residues of Lys314 and His427 by hydrogen bond and
π-cation interaction, respectively (Figure 3E). Furthermore, residue Leu429 was also pivotal, because
it gave steric hindrance for the ROR1-ARI-1 binding. Therefore, these data provide the experimental
and in silico evidences for the ROR1-ARI-1 interaction.
ARI-1 inhibits cell proliferation and induces apoptosis by blocking PI3K/AKT/mTOR pathway
With the ROR1 inhibitor ARI-1 in hand, we subsequently assessed its cellular function in
NSCLC cells. In MTT assays, ARI-1 significantly suppressed cell proliferation in H1975, PC9 and
H441 cells (with high ROR1 expression), but was insensitive to H1299 and A549 cells (with low
ROR1 expression) (Figure 4A and S3, Table S1), suggesting that ARI-1 specifically targets ROR1.
Moreover, EdU assays and colony formation experiments indicated that ARI-1 treatment remarkably
inhibited DNA replication and cell growth in both H1975 and PC9 cells (Figure 4B, 4C and S4),
giving additional evidence for the NSCLC inhibitory function of ARI-1. To check the specificity of
ARI-1 to ROR1, the stable H1975 and PC9 cells with or without ROR1 knockdown were treated
with different concentration of ARI-1, and the results showed that ROR1 knockdown dramatically
attenuated the anti-proliferative activity of ARI-1 (Figure 4D and 1C), further supporting ARI-I
specificity toward ROR1. As H1975 cells were gefitinib-resistant NSCLC cells, ARI-1 could
overcame gefitinib resistance when ROR1 was overexpressed, indicating a clue to overcome
gefitinib resistance in NSCLC cells.
16

ACCEPTED MANUSCRIPT
Blockade of ROR1 signaling was reported to inhibit proliferation and also induce apoptosis of
cancer cells via PI3K/AKT/mTOR signaling pathway [36, 44]. Thus, to investigate the mechanism of
ARI-1, we performed flow cytometry and immunoblotting. The flow cytometry experiments using
annexin V-FITC/PI staining showed that NSCLC cells treated with ARI-1 had an increased
proportion of apoptosis cells (from 4.89% to 33.27% in H1975 cells, from 0.49% to 12.43% in PC9
cells) (Figure 4E), indicating that ARI-1 significantly induced apoptosis in NSCLC cells. But its
apoptosis-inducing function was inactive in H1299 and A549 cells (with low ROR1 level) (Figure
S5). Immunoblotting analysis revealed that ARI-1 decreased the level of phosphorylated-AKT, AKT,
phosphorylated-mTOR and mTOR, and increased the level of cleaved-PARP, p-P38 (apoptosis
markers) and PCNA (proliferation marker) in H1975 and PC9 cells (Figure 4F and S6), suggesting
that ARI-1 may suppress NSCLC by preventing the PI3K/AKT/mTOR signaling. However, ARI-1
nearly had no effect on PI3K/AKT/mTOR signaling in H1299 and A549 cells (Figure 4F and S6),
indicating the ROR1-dependence of ARI-1 in NSCLC cells. Therefore, these results demonstrated
that ARI-1 inhibits cell growth and induces apoptosis in NSCLC cells by blocking
PI3K/AKT/mTOR signaling pathway.
ARI-1 suppresses cell migration in a ROR1-dependent manner in NSCLC cells
When H1299 cells stably transfected with ROR1-overexpressing (H1299-ROR1) and control
(H1299-NC) vectors (Figure 3A), we found that ROR1 obviously promoted cell migration in
wound-healing assay (Figure 5A and S7). ROR1 inhibition by ARI-1 reduced the migratory ability
of H1299-ROR1 cells, but H1299-NC cells were nearly unchanged upon ARI-1 incubation (Figure
17

ACCEPTED MANUSCRIPT
5A and S7), suggesting that the inhibitory activity of ARI-1 depended on ROR1 level in NSCLC
cells. Moreover, ARI-1 suppressed cell migration in native PC9 and H1975 cells with high ROR1
expression (Figure 5B and S8). In accordance with the results of wound-healing assays, Transwell
migration assays also indicated NSCLC cell migration was obviously inhibited by ARI-1 when
ROR1 was highly expressed (Figure 5C, 5D and S9). These data indicated that ARI-1 can suppress
NSCLC cell migration in a ROR1-dependent manner.
ARI-1 suppresses tumor growth in xenograft mice
To evaluate the antitumor function of ARI-1 in vivo, we firstly performed in silico ADMET
Descriptors and Toxicity Prediction (TOPKAT) calculations. The results indicated that ARI-1
showed no or low toxicity in most toxicity prediction models (Table S2), exhibiting acceptable
druggability. In xenograft model of nude mice, ARI-1 significantly inhibited H1975 tumor growth at
the dosage of 5 mg/kg (Figure 6A, 6B and 6C). Because ARI-1 has little effect on the body weights
of BALB/c nude mice (Figure 6D), so the tumor weight/body weight ratios were also suppressed
upon ARI-1 administration (Figure 6E). To examine the in vivo toxicity of ARI-1, we collected the
liver tissues of nude mice injected with ARI-1 or vehicle, and performed immunohistochemical
(IHC) analysis against RIP3 antibody (RIP3 is a biomarker of tissue necrosis). The positive control
of liver necrosis was induced by the administration of carbon tetrachloride. As shown in Figure 6F,
ARI-1 did not cause obvious liver necrosis in nude mice. Moreover, the histopathology test revealed
that ARI-1 had no remarkable toxicity to heart, liver, spleen, lung and kidney of nude mice (Figure
18

ACCEPTED MANUSCRIPT
6G). Together, these results demonstrate that ARI-1 had an attractive antitumor activity in xenograft
model, providing a potential small moleuclar inhibitor for NSCLC treatment.
Discussion
NSCLC is the leading cause of cancer-related human death worldwide [2]. Currently,
ROR1-targeted therapies based on monoclonal antibodies [19-23] and CAR-T cells [25-29] display
remarkable antitumor activity against leukemia or solid tumors, demonstrating the therapeutic role of
ROR1 in human cancer, especially the potential to overcome EGFR-TKIs-induced drug resistance
[18]. However, to the best of our knowledge, except for KAN0439834 (the author did not publish its
structure) [29, 30], no small molecule is reported as ROR1 inhibitors until now. Our work discovers
ARI-1 as a novel small molecule-type ROR1 inhibitor. Experimental data indicate that ARI-1
potently inhibits NSCLC cells both in vitro and in xenograft model following a ROR1-dependent
manner (Figure 4-6). Importantly, ARI-1 is sensitive to NSCLC cells with high ROR1 level (Figure
4A, 4D and 5), even though the cells are resistant to gefitinib, suggesting a drug candidate for the
therapy of NSCLC with EGFR-TKIs resistance.
Structurally, ROR1 contains the immunoglobulin-like domain, the frizzled domain, the kringle
domain and the tyrosine kinase domain [45]. Among them, the frizzled domain associates with
Wnt5a to facilitate oncogenic signaling transduction and is crucial for cancer progression [37, 46].
However, there is no report about the therapy targeting the frizzled domain. We took advantage of
the computer-aided drug modeling and cell-based activity screening to find that (R)-flavanones are
preferable to locate into frizzled domain with high potential affinity and the structural-matching hits
19

ACCEPTED MANUSCRIPT
as ROR1 inhibitors (Figure 2C and 2D). The results of SPR assay and CETSA assay reveal the direct
binding of ARI-1 to the frizzled domain of ROR1 (Figure 3B and 3D). And this interaction is
mediated by the amino acid residues Lys314, His427 and Leu429 of ROR1 (Figure 3E). Considering
the wide natural occurrence and effective synthetic methodology, (R)-flavanone is an ideal lead
structure for compound optimization and drug development in future.
Increasing endeavor has been devoted to analyze the molecular behavior of ROR1 in cancer.
Upon Wnt5a association, ROR1 activates NF-κB signaling and enhances the survival of chronic
lymphocytic leukemia cells [47]. Moreover, ROR1 appears to participate in sustainment of
EGF-induced signaling through the EGFR-ERBB3-PI3K axis, which is further upheld by ROR1
downstream through its kinase dependent c-Src activation [17]. Recent studies suggest several
pathways including ERK, Hippo-YAP signaling pathways are also regulated by ROR1 [16].
Nevertheless, the molecular mechanism of ROR1 in promoting tumorigenesis and cancer progression
remains obscure. So, the discovery of ARI-1 also provides a valuable molecular tool to probe the
downstream signaling of ROR1, facilitating the clarification of the ROR1 mechanism in cancer.
In summary, we discovered ARI-1 as a novel ROR1 inhibitor directly targeting the frizzled
domain with high binding affinity. Moreover, ARI-1 can potently inhibit NSCLC cell proliferation
and migration through blocking PI3K/AKT/mTOR signaling pathway in a ROR1-dependent manner.
Importantly, ARI-1 exhibits significant antitumor effect without obvious toxicity in vivo. Intriguingly,
ARI-1 is effective to EGFR-TKIs-resistant NSCLC cells with high ROR1 expression. Hence, our
study provides an attractive drug candidate for NSCLC treatment, especially for highly
ROR1-expressed/EGFR-TKI-resistant NSCLC.
20

ACCEPTED MANUSCRIPT
Funding: This work was supported by National Key R&D Program of China (No.2016YFA0502204
and 2017YFA0504304 to YP), National Natural Science Foundation of China (No.81772960 and
81572739 to YP; No.81702980 to WP), China Postdoctoral Science Foundation (No.2018M640925
to WP), Post-Doctor Research Project, West China Hospitial, Sichuan University
(No.2018HXBH014 to WP), the Sichuan Science and Technology Program (No. 2019JDTD0013)
and the 1.3.5 Project for Disciplines of Excellence (No. ZYJC18030), West China Hospital, Sichuan
University.
Competing interests
The authors declare no competing financial interests.
References
[1] R.L. Siegel, K.D. Miller, A. Jemal. Cancer statistics, 2018, CA Cancer J Clin. 67 (2018) 7-30.
[2] R.S. Herbst, D. Morgensztern, C. Boshoff. The biology and management of non-small cell lung
cancer, Nature. 553 (2018) 446-454.
[3] M. Reck, K.F. Rabe. Precision diagnosis and treatment for advanced non-small-cell lung cancer,
N Engl J Med. 377 (2017) 849-861.
[4] Z. Chen, C.M. Fillmore, P.S. Hammerman, C.F. Kim, K.K. Wong. Non-small-cell lung cancers: a
heterogeneous set of diseases, Nat Rev Cancer. 14 (2014) 535-546.
[5] S. Niessen, M.M. Dix, S. Barbas, Z.E. Potter, S. Lu, O. Broadsky, et al. Proteome-wide map of
targets of T790M-EGFR-directed covalent inhibitors, Cell Chem Biol. 24 (2017) 1388-1400.e7.
[6] J.F. Gainor, A.T. Shaw. Emerging paradigms in the development of resistance to tyrosine kinase
inhibitors in lung cancer, J Clin Oncol. 31 (2013) 3987-3996.
21

ACCEPTED MANUSCRIPT
[7] K.S. Thress, C.P. Paweletz, E. Felip, B.C. Cho, D. Stetson, B. Dougherty, et al. Acquired EGFR
C797S mutation mediates resistance to AZD9291 in non-small cell lung cancer harboring EGFR
T790M, Nat Med. 21 (2015) 560-562.
[8] G. Rebagay, S. Yan, C. Liu, N.K. Cheung. ROR1 and ROR2 in human malignancies: potentials
for targeted therapy, Front Oncol. 2 (2012) 34.
[9] M.P. O'Connell, K. Marchbank, M.R. Webster, A.A. Valiga, A. Kaur, A. Vultur, et al. Hypoxia
induces phenotypic plasticity and therapy resistance in melanoma via the tyrosine kinase receptors
ROR1 and ROR2, Cancer Discov. 3 (2013) 1378-1393.
[10] B. Cui, E.M. Ghia, L. Chen, L.Z. Rassenti, C. DeBoever, G.F.2nd Widhopf, et al. High-level
ROR1 associates with accelerated disease progression in chronic lymphocytic leukemia, Blood. 128
(2016) 2931-2940.
[11] A. Balakrishnan, T. Goodpaster, J. Randolph-Habecker, B.G. Hoffstrom, F.G. Jalikis, L.K.
Koch, et al. Analysis of ROR1 protein expression in human cancer and normal tissues, Clin Cancer
Res. 23 (2017) 3061-3071.
[12] Y.Z. Zheng, R. Ma, J.K. Zhou, C.L. Guo, Y.S. Wang, Z.G. Li, et al. ROR1 is a novel prognostic
biomarker in patients with lung adenocarcinoma, Sci Rep. 6 (2016) 36447.
[13] J.K. Zhou, Y.Z. Zheng, X.S. Liu, Q. Gou, R. Ma, C.L. Guo, et al. ROR1 expression as a
biomarker for predicting prognosis in patients with colorectal cancer, Oncotarget. 8 (2017)
32864-32872.
[14] A. Gentile, L. Lazzari, S. Benvenuti, L. Trusolino, P.M. Comoglio. tumorigenesis, Cancer Res.
71 (2011) 3132-3141.
[15] G.F.2nd Widhopf, B. Cui, E.M. Ghia, L. Chen, K. Messer, Z. Shen, et al. ROR1 can interact
with TCL1 and enhance leukemogenesis in Eꢀ-TCL1 transgenic mice, Proc Natl Acad Sci USA. 111
(2014) 793-798.
[16] C. Li, S. Wang, Z. Xing, A. Lin, K. Liang, J. Song, et al. A ROR1-HER3-lncRNA signalling
axis modulates the Hippo-YAP pathway to regulate bone metastasis, Nat Cell Biol. 19 (2017)
106-119.
[17] T. Yamaguchi, K. Yanagisawa, R. Sugiyama, Y. Hosono, Y. Shimada, C. Arima, et al.
NKX2-1/TITF1/TTF-1-Induced ROR1 is required to sustain EGFR survival signaling in lung
adenocarcinoma, Cancer Cell. 21 (2012) 348-361.
22

ACCEPTED MANUSCRIPT
[18] T. Yamaguchi, C. Lu, L. Ida, K. Yanagisawa, J. Usukura, J. Cheng, et al. ROR1 sustains
caveolae and survival signalling as a scaffold of cavin-1 and caveolin-1, Nat Commun. 7 (2016)
10060.
[19] A.H. Daneshmanesh, M. Hojjat-Farsangi, A.S. Khan, M. Jeddi-Tehrani, M.M. Akhondi, A.A.
Bayat, et al. Monoclonal antibodies against ROR1 induce apoptosis of chronic lymphocytic leukemia
(CLL) cells, Leukemia. 26 (2012) 1348-1355.
[20] B. Cui, S. Zhang, L. Chen, J. Yu, G.F.2nd Widhopf, J.F. Fecteau, et al. Targeting ROR1 inhibits
epithelial-mesenchymal transition and metastasis, Cancer Res. 73 ( 2013) 3649-3660.
[21] J.T. Patterson, S. Asano, X. Li, C. Rader, C.F.3rd Barbas. Improving the serum stability of
site-specific antibody conjugates with sulfone linkers, Bioconjug Chem. 25 (2014) 1402-1407.
[22] J. Yu, L. Chen, B. Cui, C. Wu, M.Y. Choi, Y. Chen, et al. Cirmtuzumab inhibits Wnt5a-induced
Rac1 activation in chronic lymphocytic leukemia treated with ibrutinib, Leukemia, 31 (2017)
1333-1339.
[23] M.Y. Choi, G.F.2nd Widhopf, E.M. Ghia, R.L. Kidwell, M.K. Hasan, J. Yu, et al. Phase I Trial:
Cirmtuzumab inhibits ROR1 signaling and stemness signatures in patients with chronic lymphocytic
leukemia, Cell Stem Cell. 22 (2018) 951-959.e3.
[24] M. Hudecek, T.M. Schmitt, S. Baskar, M.T. Lupo-Stanghellini, T. Nishida, T.N. Yamamoto, et
al. The B-cell tumor-associated antigen ROR1 can be targeted with T cells modified to express a
ROR1-specific chimeric antigen receptor, Blood. 116 (2010) 4532-4541.
[25] M. Hudecek, M.T. Lupo-Stanghellini, P.L. Kosasih, D. Sommermeyer, M.C. Jensen, C. Rader,
et al. Receptor affinity and extracellular domain modifications affect tumor recognition by
ROR1-specific chimeric antigen receptor T cells, Clin Cancer Res. 19 ( 2013) 3153-3164.
[26] C. Berger, D. Sommermeyer, M. Hudecek, M. Berger, A. Balakrishnan, P.J. Paszkiewicz, et al.
Safety of targeting ROR1 in primates with chimeric antigen receptor-modified T cells, Cancer
Immunol Res. 3 (2015) 206-216.
[27] M. Hudecek, D. Sommermeyer, P.L. Kosasih, A. Silva-Benedict, L. Liu, C. Rader, et al. The
nonsignaling extracellular spacer domain of chimeric antigen receptors is decisive for in vivo
antitumor activity, Cancer Immunol Res. 3 (2015) 125-135.
23

ACCEPTED MANUSCRIPT
[28] J. Qi, X. Li, H. Peng, E.M. Cook, E.L. Dadashian, A. Wiestner, et al. Potent and selective
antitumor activity of a T cell-engaging bispecific antibody targeting a membrane-proximal epitope of
ROR1, Proc Natl Acad Sci USA. 115 ( 2018) e5467-e5476.
[29] M. Hojjat-Farsangi, A.H. Daneshmanesh, A.S. Khan, J. Shetye, F. Mozaffari, P. Kharaziha, et
al. First-in-class oral small molecule inhibitor of the tyrosine kinase ROR1 (KAN0439834) induced
significant apoptosis of chronic lymphocytic leukemia cells, Leukemia. 32 (2018) 2291-2295.
[30] A.H. Daneshmanesh, M. Hojjat-Farsangi, A. Ghaderi, A. Moshfegh, L. Hansson, J. Schultz, et
al. A receptor tyrosine kinase ROR1 inhibitor (KAN0439834) induced significant apoptosis of
pancreatic cells which was enhanced by erlotinib and ibrutinib, PLoS One. 13 (2018) e0198038.
[31] D. Sun, J.K. Zhou, L. Zhao, Z.Y. Zheng, J. Li, W. Pu, et al. Novel curcumin liposome modified
with hyaluronan targeting CD44 plays an anti-leukemic role in acute myeloid leukemia in vitro and
in vivo, ACS Appl. Mater. Interfaces. 9 (2017) 16857-16868.
[32] D. Martinez Molina, R. Jafari, M. Ignatushchenko, T. Seki, E.A. Larsson, C. Dan, et al.
Monitoring drug target engagement in cells and tissues using the cellular thermal shift assay,
Science. 341 (2013) 84-87.
[33] W. Pu, J. Li, Y. Zheng, X. Shen, X. Fan, J.K. Zhou, et al. Targeting Pin1 by inhibitor API-1
regulates microRNA biogenesis and suppresses hepatocellular carcinoma development, Hepatology.
68 (2018) 547-560.
[34] Q. Gou, L. Gao, X. Nie , W. Pu, J. Zhu, Y. Wang, et al. Long noncoding RNA AB074169
inhibits cell proliferation via modulation of KHSRP-mediated CDKN1a expression in papillary
thyroid carcinoma, Cancer Res. 78 (2018) 4163-4174.
[35] N. Borcherding, D. Kusner, G.H. Liu, W. Zhang. ROR1, an embryonic protein with an
emerging role in cancer biology, Protein Cell. 5(2014) 496-502.
[36] Y. Liu, H. Yang, T. Chen, Y. Luo, Z. Xu, Y. Li, et al. Silencing of receptor tyrosine kinase
ROR1 inhibits tumor-cell proliferation via PI3K/AKT/mTOR signaling pathway in lung
adenocarcinoma, PLoS One. 10 (2015) e0127092.
[37] A. Sato, H. Yamamoto, H. Sakane, H. Koyama, A. Kikuchi. Wnt5a regulates distinct signaling
pathways by binding to Frizzled2, EMBO J. 29 (2010) 41-54.
24

ACCEPTED MANUSCRIPT
[38] M.K. Hasan, J. Yu, L. Chen, B. Cui, G.F. Widhopf Ii, L. Rassenti, et al. Wnt5a induces ROR1
to complex with HS1 to enhance migration of chronic lymphocytic leukemia cells, Leukemia, 31
(2017) 2615-2622.
[39] J. Yu, L. Chen, Y. Chen, M.K. Hasan, E.M. Ghia, L. Zhang, et al. Wnt5a induces ROR1 to
associate with 14-3-3ζ for enhanced chemotaxis and proliferation of chronic lymphocytic leukemia
cells, Leukemia, 31 (2017) 2608-2614.
[40] M.K. Hasan, J. Yu, G.F. Widhopf, L.Z. Rassenti, L. Chen, Z. Shen, et al. Wnt5a induces ROR1
to recruit DOCK2 to activate Rac1/2 in chronic lymphocytic leukemia, Blood. 132 (2018) 170-178.
[41] Homology modeling of ROR1 frizzled domain on SWISS-MODEL website at
https://www.swissmodel.expasy.org/.
[42] X. Wang, B. Liu, X. Searle, C. Yeung, A. Bogdan, S. Greszler, et al. Discovery of
4-[(2R,4R)-4-({[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropyl]carbonyl}
amino)-7-(difluoromethoxy)-3,4-dihydro-2H-chromen-2-yl]benzoic acid (ABBV/GLPG-2222), a
potent cystic fibrosis transmembrane conductance regulator (CFTR) corrector for the treatment of
cystic fibrosis, J Med Chem. 61 (2018) 1436-1449.
[43] J.C. Holder, A.N. Marziale, M. Gatti, B. Mao, B.M. Stoltz. Palladium-catalyzed asymmetric
conjugate addition of arylboronic acids to heterocyclic acceptors, Chem Eur J. 19 (2013) 74−77..
[44] A.H. Daneshmanesh, M. Hojjat-Farsangi, A. Moshfegh, A.S. Khan, E. Mikaelsson, A.
Österborg, et al. The PI3K/AKT/mTOR pathway is involved in direct apoptosis of CLL cells induced
by ROR1 monoclonal antibodies, Br. J. Haematol. 169 (2015) 455-458.
[45] M. Hojjat-Farsangi, A. Moshfegh, A.H. Daneshmanesh, A.S. Khan, E. Mikaelsson, A.
Osterborg, et al. The receptor tyrosine kinase ROR1--an oncofetal antigen for targeted cancer
therapy, Semin. Cancer Biol. 29 (2014) 21-31.
[46] J. Cao, X. Wang, T. Dai, Y. Wu, M. Zhang, R. Cao, et al. Twist promotes tumor metastasis in
basal-like breast cancer by transcriptionally upregulating ROR1, Theranostics. 8 (2018) 2739-2751.
[47] T. Fukuda, L. Chen, T. Endo, L. Tang, D. Lu, J.E. Castro, et al. Antisera induced by infusions of
autologous Ad-CD154-leukemia B cells identify ROR1 as an oncofetal antigen and receptor for
Wnt5a, Proc. Natl. Acad. Sci. USA. 105 (2008) 3047-3052.
25

ACCEPTED MANUSCRIPT
Figure Legends
Figure 1. ROR1 is a potential therapeutic target for NSCLC therapy. (A) Immunoblotting
analysis and (B) quantification of ROR1 expression in NSCLC tumor tissues (T) and their adjacent
normal tissues (N). Coomassie brilliant blue staining of the lysates of tumor and normal tissues was
used as loading control. (C) Flow cytometric analysis of ROR1 expression in PC9 (left) and H1975
(right) cells transfected with ROR1-knockdown or control vectors. (D) Cell proliferation measured
by MTT assays of PC9 (left) and H1975 (right) cells with or without ROR1 knockdown.
Figure 2. Computer-aided drug screening and chemical synthesis of ROR1 inhibitors. (A)
ROR1 consists of extracellular immunoglobulin-like domain, frizzled domain, kringle domain and
intracellular tyrosine kinase domain. (B) 3D structure of ROR1 frizzled domain via homology
modeling based on the amino acid sequence. (C) Cell proliferation of H1975 (left) and PC9 (right)
cells treated with hit compounds (H1-H30) at the concentration of 50 ꢀM. The red-colored
compounds are (R)-flavanones. (D) Chemical structure of (R)-flavanones. (E) Synthesis of
(R)-flavanones via asymmetric conjugate addition of substituted acids to chromones and
deprotection. (F) Coomassie brilliant blue staining of purified extracellular ROR1 frizzled domain.
(G, H) Biological screening of ROR1 inhibitors by SPR and MTT assays. Compound 3 (green in G)
and compound 39 (red in H) are the optimal inhibitors, respectively. (I) Chemical structure of
compound 39 (ARI-1).
Figure 3. ARI-1 directly binds to the frizzled domain of ROR1. (A) Flow cytometric analysis of
H1299 cells stably transfected with flag-ROR1-overexpressing (H1299-ROR1) and control
26

ACCEPTED MANUSCRIPT
(H1299-NC) vectors. (B) Cellular thermal shift assays (CETSA) from 54-66°C in the
flag-ROR1-overexpressed H1299 cell lysates with or without ARI-1 (5 μM) incubation. The
representative images were obtained by immunoblotting against anti-flag antibody. (C)
Quantification of CETSA from 54-66°C in flag-ROR1-overexpressed H1299 cell lysates with or
without ARI-1 (5 μM) incubation. The data were normalized to the intensity of protein at 54°C. (D)
Surface plasmon resonance (SPR) assays of the immobilized extracellular ROR1 frizzled domain
toward varied concentrations of ARI-1. (E) The representative image of flexible docking between
ROR1 frizzled domain and ARI-1.
Figure 4. ARI-1 inhibits cell proliferation and induces apoptosis by blocking
PI3K/AKT/mTOR pathway. (A) MTT assays of lung cancer cells (H1975, PC9, H441, H1299 and
A549) treated with or without varied concentrations of ARI-1. (B,C) Effect of ARI-1 (15 ꢀM)
treatment on cell growth in H1975 and PC9 cells, measured by EdU cell proliferation assay and
colony formation assay. (D) Measurement of cell proliferation by MTT assay of ROR1-knockdown
or control H1975 (left) or PC9 (right) cells treated with varied concentration of ARI-1. (E) Flow
cytometric analysis of apoptotic cells after ARI-1 (15 ꢀM) treatment in H1975 and PC9 cells. (F)
Immunoblotting analysis on the levels of p-AKT, AKT, p-mTOR, mTOR, p-P38, cleaved-PARP,
PCNA and actin in H1975, PC9, H1299 and A549 cells upon ARI-1 (15 ꢀM) treatment.
Figure 5. ARI-1 suppresses cell migration in a ROR1-dependent manner in NSCLC cells. (A)
The representative images of wound-healing assay in ROR1-overexpressing or negative control
H1299 cells with or without ARI-1 (15 ꢀM) incubation. (B) The representative images of H1975 and
27

ACCEPTED MANUSCRIPT
PC9 cells treated with or without ARI-1 (15 ꢀM) in wound-healing assay. (C) The representative
images of Transwell migration assay in ROR1-overexpressing or negative control H1299 cells with
or without ARI-1 (15 ꢀM) incubation. (D) The representative images of H1975 and PC9 cells treated
with or without ARI-1 (15 ꢀM) in Transwell migration assay.
Figure 6. ARI-1 suppresses NSCLC tumor growth without obvious toxicity. (A) The images of
Balb/c nude mice tumor with or without the administration of ARI-1 for 14 days at the dosage of 5
mg/kg every two days. (n = 5 per group). (B) The nude mice tumor volumes measured for 14 days
and (C) tumor weights of NSCLC xenograft tumors with or without ARI-1 administration (5 mg/kg).
(D) Body weights of nude mice during the treatment of vehicle and ARI-1 (5 mg/kg) for 14 days. (E)
Tumor weight/body weight ratios of xenograft nude mice upon vehicle and ARI-1 (5 mg/kg) for 14
days. (F) The representative images of immunohistochemistry analysis of liver from nude mice with
or without ARI-1 (5 mg/kg) treatment for 14 days. The liver of mice administrated with carbon
tetrachloride was used as positive control. (G) Histopathology test of liver, lung, spleen, kidney, and
heart of nude mice with or without ARI-1 (5 mg/kg) injection for 14 days.
28