Full text of DOI:10.1007/BF03343995

J. Endocrinol. Invest. 25: 229-235, 2002
Central and peripheral glucocorticoid receptor function in
abdominal obesity
T. Ljung*, M. Ottosson****, A.C. Ahlberg**, S. Edén***, B. Odén****, S. Okret*****,
M. Brönnegård******, P. Stierna******, P. Björntorp*
*Departments of Heart and Lung Diseases, **Psychiatry, ***Physiology and ****The Wallenberg Laboratory,
Sahlgrenska Hospital, University of Göteborg, Göteborg, and Departments of *****Medical Nutrition and
******Clinical Sciences, Huddinge University Hospital, Karolinska Institute, Stockholm, Sweden
ABSTRACT. Abdominal obesity seems to be as-
sociated with a moderately deranged feedback
regulation of the hypothalamic-pituitary-adrenal
(HPA) axis where central glucocorticoid recep-
tors (GR) are involved. Therefore, functions of
central and peripheral GR were compared in this
study. Furthermore, since trinucleotide repeats
in early exons of steroid hormone receptor genes
influence transcription, and therefore may influ-
ence receptor density, this was also studied. Ten
middle-aged men, 5 with abdominal obesity and
5 controls, were studied. The suppression of dex-
amethasone (dex) on serum cortisol was used in
dose-response tests to assess the function of cen-
tral GR. Abdominal adipose tissue biopsies were
incubated and exposed to cortisol in different
concentrations, and the function of the periph-
eral GR assayed as induction of lipoprotein lipase
(LPL) activity. Aberrant expansion of exonic trin-
ucleotide repeats in the first coding exon of the
GR gene was studied by sequencing of genomic
DNA. Results showed that men with abdominal
obesity showed less inhibition of serum cortisol
by dex, particularly at lower concentrations,
while in the controls cortisol secretion was in-
hibited in an apparent dose-response manner.
LPL activity in adipose tissue was lower in ab-
dominal obese men than in controls. However,
the sensitivity to cortisol was not different be-
tween the groups. There was no evidence for ex-
pansion of trinucleotide repeats. These results
suggest that the central GR and the peripheral
GR in adipose tissue exhibit functional differ-
ences in abdominal obesity.
(J. Endocrinol. Invest. 25: 229-235, 2002)
©2002, Editrice Kurtis
INTRODUCTION
ison with controls (4). These results suggest a dimini-
shed sensitivity of the central GR.
Obesity is associated with multiple endocrine abnor-
malities (1, 2). Perturbations in the regulation of the
hypothalamic-pituitary-adrenal (HPA) axis seem to be
a central endocrine disorder in abdominal obesity,
resulting in abnormal cortisol secretion (2-10). There
are indications that a diminished feedback control of
the HPA axis (6 ,7) by glucocorticoid receptors (GR) in
the central nervous system (11, 12) might be involved
as tested by dexamethasone (dex) suppression of cor-
tisol secretion. This is apparent at low doses of dex
(13), while the conventionally used dose, 1 mg, does
not reveal any differences in suppression in compar-
GR density is dependent on glucocorticoid secretion,
and elevated levels of cortisol are followed by a di-
minished number of GR in the hippocampus area (11,
12). Glucocorticoid excess has also been shown to de-
crease GR mRNA as well as GR protein levels in sub-
cutaneous fat cells (14), as well as in peripheral blood
cells (15). It is thus apparent that elevated cortisol se-
cretion may be followed by a down-regulation of GR
both in the central nervous system and in the periph-
ery. There are, however, indications of a tissue-spe-
cific variation in cortisol sensitivity, suggesting that
control of GR density may vary in different tissues (15).
In relation to a normal feedback mechanism, an im-
paired function of the central GR would be ex-
pected to be followed by elevated cortisol secre-
tion. With a normally functioning peripheral GR,
amplified effects of cortisol in peripheral tissues will
then be the expected outcome. In Cushing’s syn-
drome, with severe hypercortisolemia, a pronoun-
Key-words: Abdominal obesity, cortisol, glucocorticoid receptor, lipopro-
tein lipase, dexamethasone.
Correspondence: Dr. Thomas Ljung, Department of Heart and Lung
Diseases, Sahlgrenska University Hospital, SE-413 45 Göteborg, Sweden.
E-mail: thomas.ljung@telia.com
Accepted September 11, 2001.
229

GR function in obesity
morning at 08:00 h. All the samples were frozen at -70 C and an-
alyzed simultaneously to ascertain the levels of total cortisol using
a commercially available radioimmunoassay (Orion, Oulu, Finland).
The dex inhibition was calculated as the difference between the
pooled baseline cortisol data of all the 4 tests (in order to mini-
mize the considerable intraindividual variation in morning cortisol
values) and the measurement after dex administration.
Cortisol binding globulin (CBG) was determined in a sample of
baseline serum by a RIA (Medgenix Diagnostics, Fleurus, Belgium).
Unbound cortisol was calculated from total cortisol and CBG as
previously described (21). Overnight fasting blood glucose was
determined with an automatised method, and serum insulin by
RIA (Phadebas, Pharmacia, Uppsala, Sweden).
ced down-regulation of the density of peripheral
GR has been found, and yet exaggerated cortisol
effects on tissues are clearly apparent (16). Conse-
quently, the net peripheral effects of cortisol are
dependent on the function of both central and pe-
ripheral GR, as well as the prevailing cortisol secre-
tion, and cortisol metabolism in target tissues.
In an attempt to resolve the problem of putative
abnormal functions of the central and/or peripher-
al GR in abdominal obesity this study included the
function of both these receptors in the same sub-
jects. We selected men with or without abdominal
obesity, who had previously been studied with
dose-response to dex-suppression (13).
Incubation of adipose tissue
Abdominal subcutaneous adipose tissue (lateral of the umbili-
cus) was obtained by needle aspiration performed during local
anesthesia. The adipocyte diameter was measured microscopi-
cally (22). Connective tissue and blood vessels were removed.
Pieces of adipose tissue (5-20 mg each) were prepared under
sterile conditions and used for incubations in plastic tubes (50-
70 mg tissue/2 ml medium). For each incubation experiment,
adipose tissue from one subject was used.
The incubation schedule was as follows: the tissue was first prein-
cubated without cortisol for 3 days (72 2 h) in a control medium
containing 7175 pmol/l insulin as previously described (17). During
the next 2 days (48 1 h), the tissue was incubated in the control
medium without and with cortisol (1, 10, 100, 1000 and 10,000
nmol/l, hydrocortisone, Sigma, St. Louis, U.S.A.). After the 5 days
of incubation, heparin releasable LPL activity was determined.
Incubations were performed at 37 C, 90% humidity and 4.0-
5.0% CO2 in an incubator (Forma Scientific, Division of Mal-
linckrodt. Inc., Ohio, U.S.A.), and media were changed daily.
As a measurement of the function of the peripheral
GR, the induction of lipoprotein lipase (LPL) activity
in adipose tissue was studied, exposing the tissue to
cortisol in a dose-response manner. Cortisol induces
LPL activity in adipose tissue by transcriptional effects
as well as by an additional post-translational mecha-
nism (17). Blocking the GR with a glucocorticoid an-
tagonist inhibits both these mechanisms completely
(18), indicating that the effect of cortisol on LPL ac-
tivity in adipose tissue is mediated via the GR.
A difference in responsiveness of the GR might be ex-
plained by genetic differences between individuals.
To study potential differences in GR-mediated gluco-
corticoid effects we compared trinucleotide glutamine
(CAG) repeats in the second exon of the GR gene in
genomic DNA with these functional data. The first ex-
on of the GR gene is considered to be silent (19).
MATERIALS AND METHODS
LPL activity
Subjects
For heparin elution 50-70 mg tissue, in triplicate from each medi-
um in order to make representative determinations possible, was
incubated at 37 C for 45 min in 500 μl of Parker Medium supple-
mented with 10 mmol/l HEPES, 2% heat inactivated fetal calf serum
(Life Technologies Ltd., Paisley, Scotland, U.K.) and 10 U/ml hep-
arin (Løvens, Ballerup, Denmark). The method described by
Peterson et al. (23) was used to determine heparin releasable LPL
activity. In brief, 50 μl medium in duplicate from each sample were
incubated in a total volume of 200 μl at 25 C for 75 min. The pro-
cedure developed by Spooner et al. (24) served to extract fatty
acids for counting. Bovine skim milk was used as a standard to cor-
rect for inter-assay variation. Control experiments showed that the
assay was linear with the amount of sample and with time over the
range used. Activity was expressed as milliunits (mU) per gram
triglyceride (Tg). 1 mU=1 nmol of fatty acid released per min. The
amount of triglyceride in the tissue was measured after extraction
(25), and weighing after evaporation of solvents.
Ten middle-aged 46-60 yr (median 51.5) men were included in
the study. They had all previously participated in a study evaluat-
ing the relation between body fat distribution and inhibition of
cortisol secretion by dex (13). From these subjects, ten men were
selected for further detailed studies of cortisol effects on adipose
tissue. The men were divided into one group with high waist-hip
ratio (WHR) (>1.0, no. 5) and one group of controls (WHR<1.0,
no. 5). The WHR was recorded as previously described (20). Body
weight was measured to the nearest 0.1 kg, height to the nearest
0.01 m and body mass index (BMI, kg/m2) was calculated.
In the studies of CAG repeats in the GR gene 12 additional con-
trols were recruited among healthy laboratory personnel with
normal body weight.
The subjects were informed orally and in writing and the study was
approved by the Ethics Committee of the University of Göteborg.
Dexamethasone inhibition test
Genomic analyses
Dex was administered in the doses of 0.05, 0.125, 0.25 and 0.5
mg in random order at weekly intervals. Serum samples from an an-
tecubital vein were obtained in the overnight fasting state in the
morning at 08:00 h, dex was then taken at 22:00 h the same day,
and new serum samples collected in the fasting state the following
PCR were carried out using 0.5-1.0 μg genomic DNA in a reaction
volume of 100 μl containing 10 μl amplification buffer, 1.6 μl dNTP’s
(12.5 mM containing equal amounts of dATP, dCTP, dGTP and
dTTP), 10 μl DNA and 2.5 U Taq-polymerase, using the human GR
230

T. Ljung, M. Ottosson, A.C. Ahlberg, et al.
600
500
400
300
200
100
0
(hGR) specific primers 5’ CAGAAAAACACTTGATCTTACC (5’-bi-
otinylated and antisense), 5’ ATGGGAGCAGGGGACATGGCTT
(sense), and 5’GCTGCCTCT-TACTAATCGGATC (sequencing
primer). The following PCR program was used: 1 cycle of denatu-
ration at 95 C for 2 min, annealing at 55 C for 1 min, and extension
at 72 C for 2 min, followed by 29 cycles of denaturation at 95 C for
1 min, annealing at 55 C for 2 min, and extension at 72 C for 3 min,
and a final cycle of extension at 72 C for 5 min. Single stranded
DNA was obtained by the Dynabeads-streptavidin system (Dynal
AS, Norway), and DNA for automatic sequencing (BioRad, Applied
System) amplified using a ”hot-start” PCR program of 25 cycles;
96 C for 30 sec, annealing at 55 C for 15 sec, followed by extension
at 60 C for 4 min.
-100
-200
-300
Statistical analysis
Results are expressed as median (range) if not otherwise stated.
The statistical methods used were the non-parametric Mann-
Whitney U test and Spearman´s rank correlation available in the
Statview program of the Macintosh system. p-values less than 0.05
were considered significant.
0.0
0.1
0.2
0.3
0.4
0.5
Dexamethasone dose (mg)
Fig. 1 - Inhibition of serum cortisol after administration of different
doses of dexamethasone (dex). Individual values of the controls
(no. 5, open circles) and the subjects with abdominal obesity (no.
5, filled circles) are presented as well as the median values (thick
lines) in each group. The difference in inhibition between the
groups was significant at 0.125 mg and 0.5 mg dex (p<0.05).
RESULTS
Anthropometry
The controls had a WHR of 0.894 (0.835-0.918) and a
BMI of 24.6 (21.6-26.4) kg/m2. The men with ab-
dominal obesity had a WHR of 1.070 (1.025-1.125)
and a BMI of 33.8 (31.8-37.2) kg/m2 [median (range)].
The groups had significantly different WHR and BMI
values (p<0.01).
In the fasting state, the mean blood glucose value
was 4.8 for the controls and 5.6 mmol/l for the ab-
dominally obese group (p=0.028), and serum in-
sulin 8.6 and 23.0 mU/l, respectively (p=0.012).
ity was significantly lower in adipose tissue from the
group of men with abdominal obesity compared
with adipose tissue from the controls, at all the cor-
tisol concentrations tested, as well as in the absence
100
80
60
40
20
0
Dexamethasone inhibition test
Dex inhibition of serum cortisol in controls and ab-
dominally obese subjects is shown in Fig. 1 (data col-
lected as part of previous results, see reference 13).
Controls seemed to show a dose-response curve with
increasing suppression as doses of dex increased.
The abdominal obese men showed lower dex sup-
pression, significant at 0.125 and 0.5 mg dex
(p<0.05). Dex inhibition of calculated unbound serum
cortisol in the 2 groups revealed essentially the same
picture (not shown). Also regarding this cortisol frac-
tion, median dex inhibition was significantly lower in
men with abdominal obesity compared with that in
controls (p<0.05) at 0.125 and 0.5 mg dex.
C
0
1
2
3
4
The CBG concentrations in the controls [36.4 (34.3-
43.8) mg/l] were not statistically different from those
in men with abdominal obesity [38.0 (32.8-44.3) mg/l].
Log cortisol (nmol/l)
Fig. 2 - Cortisol induction of heparin releasable lipoprotein lipase
(LPL) activity in abdominal subcutaneous adipose tissue. Individual
values of the controls (no. 5, open circles) and the subjects with ab-
dominal obesity (no. 5, filled circles) are presented as well as the
median values (thick lines) in each group. The difference in in-
duction between the groups was significant at all cortisol con-
centrations as well as in the absence of cortisol (C) (p<0.05).
LPL activity
The individual induction of heparin releasable LPL
activity in abdominal adipose tissue after cortisol
exposure is shown in Fig. 2. Induction of LPL activ-
231

GR function in obesity
600
500
400
300
200
100
0
gene neither in controls nor in the abdominally
obese group, these results were pooled and were
the same results as those obtained in laboratory per-
sonnel. Data from rats and mice (26), where CAG re-
peats are found, are included for comparisons.
DISCUSSION
The anthropometric measurements indicate that
the controls had normal values while the group with
elevated WHR, by selection, were characterized by
abdominal obesity (27, 28). These men also had
higher blood glucose and serum insulin values.
Insulin is known to be a potent stimulator of LPL in
human adipose tissue (17, 29). However, by using
an insulin concentration which is much higher than
in vivo in the incubation medium, a possible insulin
resistance should have been overcome. Therefore,
it seems unlikely that the differences observed in
LPL induction between the groups were caused on-
ly by differences in insulin sensitivity.
Quantitative evaluation of dex suppression of cor-
tisol secretion is difficult because the non-inhibited
cortisol secretion is highly varying, depending on
the large peaks of secretion occurring in the morn-
ing. Therefore, four different non-inhibited morn-
ing values were used in order to minimize the in-
traindividual variation (13). Nevertheless, smooth
dose-response curves are difficult to obtain, and in-
terpretations should therefore be cautious. Dex
concentrations were not measured because previ-
ous studies have shown that circulating dex appar-
ently does not mirror dex binding to tissue recep-
tors (30).
0
10
20
30
40
50
Difference in LPL activity (mU/g Tg)
10E3-10E1 nmol/l cortisol
Fig. 3 - Inhibition of serum cortisol after administration of 0.5 mg
dexamethasone in relation to cortisol induction of lipoprotein li-
pase (LPL) activity calculated as the difference in LPL activity with
cortisol in a concentration of 10 nmol/l and 1000 nmol/l (p<0.05,
rho=0.8).
of cortisol (p<0.05). Calculations of the activity per
cell yielded similar results (not shown). Estimation of
the half maximal effects (ED 50) of cortisol was not
significantly different between groups (not shown).
Inhibition of serum cortisol after administration of
0.5 mg dex was positively correlated with cortisol
induction of adipose tissue LPL activity both re-
garding the net effect of cortisol in the range of 10-
1000 nmol/l (p<0.05, rho=0.8, Fig. 3) and the net
effect of cortisol at the maximal concentration,
10,000 nmol/l (p<0.05, rho=0.7, not shown). Similar
correlations with lower dex doses were not signifi-
cant (not shown).
The difference in dex inhibition between controls and
the abdominal obese group seems to be particular-
ly marked at the lowest doses (0.05 and 0.125 mg),
where no inhibition was found in the abdominally
obese men, while in controls a dose-dependent sup-
pression occurred (Fig. 1). These detailed results in a
small number of men are in agreement with results
in studies on a population basis showing poor sup-
pression at lower dex doses (6, 7) while maximal dos-
Genomic analysis of the GR
Table 1 shows comparisons of regions in the GR
gene between different species. Since PCR amplifi-
cation of genomic DNA did not reveal any expan-
sions of trinucleotide repeats in exon 2 in the GR
Table 1 - Comparisons of the amino acid sequence of the polyglutamine containing region of the glucocorticoid receptor (GR) gene
in men with elevated waist hip ratio (WHR), their controls, and in controls among laboratory personnel, as well as in rats and mice.
Amino acid in human GR:
WHR+controls (no. 10)
Controls, lab. pers. (no. 12)
Rats (26)
67 ꢀ
74 ꢀ
QQ
76 ꢀ
PDL
PDL
PDL
PDL
83 ꢀ
KGSVSNA
KGSVSNA
KGSTSNV
KGSASNA
SKAVS
SKAVS
SKAVS
SKAVS
QQ
QQR-(Gln)7-17...
QQR-(Gln)9...
Mice (26)
232

T. Ljung, M. Ottosson, A.C. Ahlberg, et al.
es inhibit cortisol secretion efficiently (4). Recent ob-
servations in abdominal obesity of a poor control of
cortisol secretion during the active phase of HPA ax-
is regulation as well as during food intake (31) might
be consequences of insensitivity of the central feed-
back control, seen particularly when the GR gene lo-
cus is polymorphic (32). Taken together these obser-
vations suggest a diminished sensitivity of the cen-
tral GR in abdominal obesity resulting in a moder-
ately blunted control of cortisol secretion.
In a recently published study (33) we found no sta-
tistically significant difference in dex inhibition when
abdominally obese men were compared with men
with a more even distribution of excess fat. In that
study, the measurements of cortisol concentrations
were different. Furthermore, and probably more
important, the group for comparisons was obese.
Different studies measuring CBG concentrations in
obesity show conflicting results. CBG concentra-
tions have previously been reported to be inverse-
ly related to BMI (34), positively associated with
WHR (35), and lower in morbidly obese compared
to normal-weight controls (36). When lean, obese,
and obese subjects with glucose intolerance were
compared, in a recent study, CBG concentrations
were reported to be increased in obese subjects
with glucose intolerance (37). In the present study,
CBG concentrations were similar in the lean group
and in the abdominally obese group.
The LPL induction in adipose tissue was performed
with low to pharmacological concentrations of corti-
sol. There were clear differences between abdominal
obese men and controls with essentially no overlap
of results (Fig. 2). Inspection of the results in Fig. 2
suggests that there is a dose-response up to 100
nmol/l cortisol, with an apparent saturation at 1000
nmol/l, which is a high concentration in vivo. The
highest concentration used is about 10-fold above
physiological concentrations, and the LPL activity
here is probably induced by other than physiological
mechanisms. Calculations of sensitivity to cortisol
gave no evidence for a diminished sensitivity in the
men with elevated WHR, when calculated as half
maximal dose. These results were similar with or
without adjusting for the elevated LPL induction in
the absence of cortisol. This is, however, an uncertain
observation due to the few cortisol concentrations
within the physiological range.
tral GR in abdominal obesity might preclude such
an association. These results suggest differences in
sensitivity of central and peripheral GR, but similar
responsiveness. Taken together these results then
open up the possibility that abdominally obese men
seem to have a diminished sensitivity of the central
GR, but not of the peripheral GR.
The lower but highly variable induction of LPL in the
abdominal obese men might be due to individually
different functional down-regulation of the peripher-
al GR (38) due to in vivo conditions. This would not be
expected to change sensitivity of the receptor in
agreement with the results. The parallel responsive-
ness of central and peripheral GR suggests that such
down-regulation might also have occurred with the
central GR density. This does, however, not explain
the apparent diminished sensitivity of the central GR
in abdominal obesity. Tissue-specific function of the
GR has been described (15) and might have conse-
quences for glucocorticoid effects in different tissues.
Furthermore, tissue specificity of cortisol metabolism
may be involved (39, 40).
New dimensions to regulatory abnormalities in
steroid hormone receptor genes have been added
by recent studies. It is believed that there is a varia-
tion in target tissue specific responsiveness to glu-
cocorticoids, which is the result of not only mutations
and polymorphisms in the gene of the GR, but also
in genes that are involved in the glucocorticoid sig-
nal transcription pathway, i.e. coactivators or core-
pressors (41). These normal variations might be
harmful or protective depending on the gene and
the direction of the variation, and may provide the
physiological basis for individual and tissue-specific
glucocorticoid sensitivity. There is considerable in-
formation on disease consequences of expansion of
the long CAG repeat in the first exon of the X-linked
human androgen receptor (42), and the severity of
disease seems to be proportional to the length of
these expanded trinucleotide repeats (43).
In contrast to the human androgen receptor gene,
CAG repeats are few in the human GR. There are
species variations with fewer glutamine sequences
in the human and mouse than rat GR gene (26). It is
not known whether expansions of trinucleotide re-
peats in the human GR gene exist in different dis-
eases as it has been reported for the human an-
drogen receptor. Such expansions would be ex-
pected to interfere with GR function or with tran-
scription of the GR gene, particularly when local-
ized near the regulating domain of the gene, as
seen with the trinucleotide repeats in the androgen
receptor.
Significant correlations between the measurements
of dex suppression and LPL induction were found at
0.5 mg dex, but not with lower doses. This proba-
bly means that the function of the peripheral and
central GR is parallel at higher doses of dex only
when the central GR is near maximally activated. At
lower dex doses the blunted sensitivity of the cen-
Differences in trinucleotide CAG repeats in the first
coding exon of the GR gene do not seem to be in-
233

GR function in obesity
3. Moyer A.E., Rodin J., Grilo C.M., Cummings N., Larson L.M.,
Rebuffé-Scrive M. Stress-induced cortisol response and fat
distribution in women. Obes. Res. 1994, 2: 255-261.
volved in putative dysfunctions of the GR in ab-
dominal obesity, because neither of the groups with
different WHR showed any expansion of such re-
peats in comparison with each other and with con-
trols.
4. Mårin P., Darin N., Amemiya T., Andersson B., Jern S.,
Björntorp P. Cortisol secretion in relation to body fat distri-
bution in obese premenopausal women. Metabolism 1992,
41: 882-886.
Recently a polymorphism of the GR has been found
with restriction fragment length polymorphism
technique, utilizing the restriction enzyme BclI. This
polymorphism is associated with a poor control of
cortisol secretion suggesting that central regulato-
ry mechanisms of GR are involved. This is more pro-
nounced in homozygotes than heterozygotes (32),
and is associated with abdominal obesity, insulin
resistance and elevated blood pressure (15, 32, 44,
45). The functional importance of this polymor-
phism is uncertain because it is localized in the first
intron, but might interfere with splicing of primary
mRNA. It may also indicate functionally significant
polymorphisms in the adjacent regulatory domain
of the gene. Another polymorphism in the 5-prime
flanking region of the gene is also associated with
abnormal regulation of cortisol secretion (46).
Taken together, this study has indicated a down-
regulation of GR function in abdominal obesity in
men. There was an apparent decrease of the sen-
sitivity of the function of the central, but not of the
peripheral GR, while responsiveness seems to have
decreased both in the central and in the peripher-
al GR. These results are in agreement with less de-
tailed studies on a population basis, and suggest
that the sensitivity of the feedback regulation of
cortisol secretion is moderately diminished in ab-
dominal obesity. This might have a genetic basis,
suggested by polymorphisms in the GR gene, as-
sociated with poor control of cortisol secretion.
Expansion of repeats in the first coding exon of the
GR gene are, however, not involved.
5. Pasquali R., Cantobelli S., Casimirri E., et al. The hypotha-
lamic-pituitary-adrenal axis in obese women with different
patterns of body fat distribution. J. Clin. Endocrinol.
Metab. 1993, 77: 341-346.
6. Rosmond R., Dallman M.F., Björntorp P. Stress-related cor-
tisol secretion in men: relationships with abdominal obesity
and endocrine, metabolic and hemodynamic abnormali-
ties. J. Clin. Endocrinol. Metab. 1998, 83: 1853-1859.
7. Rosmond R., Björntorp P. The interactions between hy-
pothalamic-pituitary-adrenal axis activity, testosterone, in-
sulin-like growth factor I and abdominal obesity with
metabolism and blood pressure in men. Int. J. Obes. Relat.
Metab. Disord. 1998, 22: 1184-1196.
8. Vague J., Boyer J., Vague P. In: Rodrigues R. et al., (Eds.),
Anthropometry of obesity, hypercortisolism and diabetes.
Exc. Med. Int. Congr. 1970, no. 209 (abstr. 266): 118.
9. Björntorp P. Abdominal obesity and the development of
noninsulin-dependent diabetes mellitus. Diabetes Metab.
Rev. 1988, 4: 615-622.
10. Björntorp P. Endocrine abnormalities of obesity. Meta-
bolism 1995, 44 (Suppl. 3): 21-23.
11. Sapolsky R.M., Krey L.C., McEwen B.S. Glucocorticoid-sen-
sitive hippocampal neurons are involved in terminating the
adrenocortical stress response. Proc. Natl. Acad. Sci. USA.
1984, 81: 6174-6177.
12. Sapolsky R.M., Krey L.C., McEwen B.S. Stress down-regu-
lates corticosterone receptors in a site-specific manner in
the brain. Endocrinology 1984, 114: 287-292.
13. Ljung T., Andersson B., Bengtsson B.Å., Björntorp P., Mårin
P. Inhibition of cortisol secretion by dexamethasone in re-
lation to body fat distribution: a dose-response study.
Obes. Res. 1996, 4: 277-282.
14. Brönnegård M., Reynisdottir S., Marcus C., Stierna P.,
Arner P. Effect of glucocorticosteroid treatment on gluco-
corticoid receptor expression in human adipocytes. J. Clin.
Endocrinol. Metab. 1995, 80: 3608-3612.
ACKNOWLEDGEMENTS
We thank Dr. Gunilla Olivecrona, Department of Medical Bio-
chemistry and Biophysics, University of Umeå (Umeå, Sweden) for
providing the bovine skim milk LPL standard, and Carola
Gustafsson for her excellent technical assistance. This study was
supported by grants from the Swedish National Board of Health
and Welfare, and from the Swedish Medical Research Council
(13507 and 00749-35 C9).
15. Panarelli M., Holloway C.D., Fraser R., et al. Glucocor-
ticoid receptor polymorphism, skin vasoconstriction, and
other metabolic intermediate phenotypes in normal hu-
man subjects. J. Clin. Endocrinol. Metab. 1998, 83:
1846-1852.
16. Peeke P.M., Oldfield E., Alexander H.R., et al. Glucocor-
ticoid receptor expression in patients with Cushing syn-
drome. North American Society for the Study of Obesity,
Minneapolis, Minnesota, 1993 (abstract).
REFERENCES
1. Glass A.R., Burman K.D., Dahms W.T., Boehm T.M. Endocrine
function in human obesity. Metabolism 1981, 30: 89-104.
17. Ottosson M., Vikman-Adolfsson K., Enerbäck S.,
Olivecrona G., Björntorp P. The effects of cortisol on the
regulation of lipoprotein lipase activity in human adipose
tissue. J. Clin. Endocrinol. Metab. 1994, 79: 820-825.
2. Björntorp P., Edén S. Hormonal influences on human body
composition. In: Roche A.F., Heymsfield S.B., Lohman T.G.
(Eds.), Human body composition. Human Kinetic, Cham-
paign, 1995, p. 329-344.
234

T. Ljung, M. Ottosson, A.C. Ahlberg, et al.
18. Ottosson M., Mårin P., Karason K., Elander A., Björntorp P.
Blockade of the glucocorticoid receptor with RU 486: ef-
fects in vitro and in vivo on human adipose tissue lipopro-
tein lipase activity. Obes. Res. 1995, 3: 233-240.
33. Ljung T., Holm G., Friberg P., et al. The activity of the hy-
pothalamic-pituitary-adrenal axis and the sympathetic ner-
vous system in relation to waist/hip circumference ratio in
men. Obes. Res. 2000, 8: 487-495.
19. Encio I.J., Detera-Wadleigh S.D. The genomic structure of
the human glucocorticoid receptor. J. Biol. Chem. 1991,
266: 7182-788.
34. Lapidus L., Lindstedt G., Lundberg P.A., Bengtsson C.,
Gredmark T. Concentrations of sex-hormone binding glob-
ulin and corticosteroid binding globulin in serum in relation
to cardiovascular risk factors and to 12-year incidence of
cardiovascular disease and overall mortality in post-
menopausal women. Clin. Chem. 1986, 32: 146-152.
20. WHO. Measuring obesity; classification and description of
anthropometric data: Report on a WHO consultation on
the epidemiology of obesity. EUR/HFA target 16. Regional
office in Europe, Copenhagen: Nutrition Unit, World
Health Organization; 1988, 1-22.
35. Raison J., Bonithon-Kopp C., Egloff M., Ducimetiere P.,
Guy-Grand B. Hormonal influences on the relationships
between body fatness, body fat distribution, lipids,
lipoproteins, glucose and blood pressure in French work-
ing women. Atherosclerosis 1990, 85: 185-192.
21. Coolens J.L., Van Baelen H., Heyns W. Clinical use of un-
bound plasma cortisol as calculated from total cortisol and
corticosteroid-binding globulin. J. Steroid. Biochem. Mol.
Biol. 1987, 26: 197-202.
36. Vila R., Gutierrez R., Luisa Granada M., et al. Hormonal al-
terations on young morbid obese women. Med. Clin. (Barc)
2001, 10: 321-323.
22. Smith U., Sjöström L., Björntorp P. Comparison of two
methods for determining human adipose cell size. J. Lipid
Res. 1972, 13: 822-824.
37. Fernandez-Real J.M., Grasa M., Casamitjana R., Pugeat M.,
Barret C., Ricart W. Plasma total and glycosylated corticos-
teroid-binding globulin levels are associated with insulin se-
cretion. J. Clin. Endocrinol. Metab. 1999, 84: 3192-3196.
23. Peterson J., Olivecrona T., Bengtsson-Olivecrona G.
Distribution of lipoprotein lipase and hepatic lipase be-
tween plasma and tissues: effect of hypertriglyceridemia.
Biochim. Biophys. Acta 1985, 837: 262-270.
38. Bamberger C.M., Schulte H.M., Chrousos G.P. Molecular de-
terminants of glucocorticoid receptor function and tissue sen-
sitivity to glucocorticoids. Endocr. Rev. 1996, 17: 245-261.
24. Spooner P.M., Garrison M.M., Scow R.O. Regulation of
mammary and adipose tissue lipoprotein lipase and blood
triacylglycerol in rats during late pregnancy. Effects of
prostaglandins. J. Clin. Invest. 1977, 60: 702-708.
39. Ricketts M.L., Verhaeg J.M., Bujalska I., Howie A.J., Rainey
W.E., Stewart P.M. Immunohistochemical localization of
type 1 11 beta-hydroxysteroid dehydrogenase in human
tissues. J. Clin. Endocrinol. Metab. 1998, 83: 1325-1335.
25. Dole V.P., Meinertz H. Microdetermination of long-chain
fatty acids in plasma and tissues. J. Biol. Chem. 1960, 235:
2595-2599.
40. Bujalska I.J., Kumar S., Stewart P.M. Does central obesity
reflect ”Cushing’s disease of the omentum”? Lancet 1997,
349: 1210-1213.
26. Danielsen M., Northrop J.P., Ringold G.M. The mouse glu-
cocorticoid receptor: mapping of functional domains by
cloning, sequencing and expression of wild-type and mu-
tant receptor proteins. EMBO J. 1986, 5: 2513-2522.
41. Xu J., Qiu Y., DeMayo F.J., Tsai S.Y., Tsai M.J., O’Malley
B.W. Partial hormone resistance in mice with disruption of
the steroid receptor coactivator-1 (SRC-1) gene. Science
1998, 279: 1922-1925.
27. Obesity. Preventing and managing the global epidemic.
Report of a WHO Consultation on Obesity, Geneva, 3-5
June, 1997. WHO/NUT/NCD 98.1, 1998.
42. Riggins G.J., Lokey L.K., Chastain J.L., et al. Human genes
containing polymorphic trinucleotide repeats. Nat. Genet.
1992, 2: 186-191.
28. James W.P.T. The epidemiology of obesity. In: Chadwich
D.J., Cardew G.C. (Eds.), The origins and consequences
of obesity. Ciba Foundation Symposium 201. Wiley, Chi-
chester, 1996, p. 1-16.
43. La Spada A.R., Wilson E.M., Lubahn D.B., Harding A.E.,
Fischbeck K.H. Androgen receptor gene mutations in X-
linked spinal and bulbar muscular atrophy. Nature 1991,
352: 77-79.
29. Fried S.K., Russell C.D., Grauso N.L., Brolin R.E. Lipopro-
tein lipase regulation by insulin and glucocorticoid in sub-
cutaneous and omental adipose tissues of obese women
and men. J. Clin. Invest. 1993, 92: 2191-2198.
44. Weaver J.U., Hitman G.A., Kopelman P.G. An association
between a BclI restriction fragment length polymorphism
of the glucocorticoid receptor locus and hyperinsulinaemia
in obese women. J. Mol. Endocrinol. 1992, 9: 295-300.
30. Wiedemann K., Holsboer F. The effect of dexamethasone
dosage upon plasma cortisol and dexamethasone during
the DST. J. Affect. Disord. 1990, 19: 133-137.
45. Buemann B., Vohl M.C., Chagnon M., et al. Abdominal vis-
ceral fat is associated with a BclI restriction fragment length
polymorphism at the glucocorticoid receptor gene locus.
Obes. Res. 1997, 5: 186-192.
31. Rosmond R., Holm G., Björntorp P. Food-induced cortisol
secretion in relation to anthropometric, metabolic and
haemodynamic variables in men. Int. J. Obes. Relat.
Metab. Disord. 2000, 24: 416-422.
46. Rosmond R., Chagnon Y.C., Chagnon M., Perusse L.,
Bouchard C., Björntorp P. A polymorphism on the 5´-flank-
ing region of the glucocorticoid receptor gene locus is as-
sociated with basal secretion of cortisol in men. Meta-
bolism 2000, 49: 1197-1199.
32. Rosmond R., Chagnon Y.C., Holm G., et al. A glucocorti-
coid receptor gene marker is associated with abdominal
obesity, leptin, and dysregulation of the hypothalamic-pi-
tuitary-adrenal axis. Obes. Res. 2000, 8: 211-218.
235