Synthesis, Biological Evaluation, and Molecular Docking of Combretastatin and Colchicine Derivatives and their hCE1-Activated Prodrugs as Antiviral Agents

Article abstract of DOI:10.1002/cmdc.201800641

Recent studies indicate that tubulin can be a host factor for vector-borne flaviviruses like dengue (DENV) and Zika (ZIKV), and inhibitors of tubulin polymerization such as colchicine have been demonstrated to decrease virus replication. However, toxicity limits the application of these compounds. Herein we report prodrugs based on combretastatin and colchicine derivatives that contain an ester cleavage site for human carboxylesterase, a highly abundant enzyme in monocytes and hepatocytes targeted by DENV. Relative to their parent compounds, the cytotoxicity of these prodrugs was reduced by several orders of magnitude. All synthesized prodrugs containing a leucine ester were hydrolyzed by the esterase in vitro. In contrast to previous reports, the phenylglycine esters were not cleaved by human carboxylesterase. The antiviral activity of combretastatin, colchicine, and selected prodrugs against DENV and ZIKV in cell culture was observed at low micromolar and sub-micromolar concentrations. In addition, docking studies were performed to understand the binding mode of the studied compounds to tubulin.

Full text of DOI:10.1002/cmdc.201800641

Accepted Article
Title: Synthesis, Biological Evaluation and Molecular Docking of
Combretastatin and Colchicine Derivatives and their hCE1-
Activated Prodrugs as Antiviral Agents
Authors: Michael Richter, Veaceslav Boldescu, Dominik K Graf, Felix
Streicher, Anatoli Dimoglo, Ralf Bartenschlager, and Christian
DP Klein
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemMedChem 10.1002/cmdc.201800641
Link to VoR: http://dx.doi.org/10.1002/cmdc.201800641
A Journal of
www.chemmedchem.org

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
Synthesis, Biological Evaluation and Molecular Docking of
Combretastatin and Colchicine Derivatives and their hCE1-
Activated Prodrugs as Antiviral Agents
Michael Richter,[a] Veaceslav Boldescu,[a, d] Dominik Graf,[a] Felix Streicher,[a] Anatoli Dimoglo,[b] Ralf
Bartenschlager[c] and Christian D. Klein[a]*
[a]
M. Richter, ORCID 0000-0002-8227-0543
Dr. V. Boldescu, ORCID 0000-0003-0709-2086
Dr. D. Graf, ORCID 0000-0002-6124-8451
F. Streicher, ORCID 0000-0002-8375-2958
Prof. Dr. C.D. Klein, ORCID 0000-0003-3522-9182
Institute of Pharmacy and Molecular Biotechnology
Heidelberg University
INF 364, D-69120 Heidelberg, Germany
*E-mail: c.klein@uni-heidelberg.de
Prof. A. Dimoglo, ORCID 0000-0001-8638-3679
Faculty of Engineering
Duzce University
Duzce, Turkey
Prof. Dr. R. Bartenschlager, ORCID 0000-0001-5601-9307
Department of Infectious Diseases, Molecular Virology,
Heidelberg University
INF 344, D-69120 Heidelberg, Germany
Dr. V. Boldescu
[b]
[c]
[d]
Laboratory of Organic Synthesis and Biopharmaceuticals
Institute of Chemistry
Academiei str. 3, MD2028 Chisinau, Moldova
Supporting information for this article is given via a link at the end of the document.
Abstract: Recent studies indicate that tubulin can be a host factor
for vector borne flaviviruses like dengue (DENV) and Zika (ZIKV)
and inhibitors of tubulin polymerization like colchicine have been
demonstrated to reduce virus replication. However, toxicity limits the
application of these compounds. Herein, we report prodrugs based
on combretastatin and colchicine derivatives that contain anan ester
cleavage site for human carboxylesterase, a highly abundant
enzyme in monocytes and hepatocytes targeted by DENV.
Compared to their parent compounds, the cytotoxicity of these
prodrugs was reduced by several orders of magnitude. All
synthesized prodrugs containing the leucine ester were hydrolyzed
by the esterase in vitro. In contrast to previous reports, the
phenylglycine esters were not cleaved by human carboxylesterase.
Antiviral activity of combretastatin, colchicine and selected prodrugs
against DENV and ZIKV in cell culture was observed at low
micromolar and submicromolar concentrations. In addition, docking
studies were performed to understand the binding mode of the
studied compounds to tubulin.
The increasing number of co-circulating flaviviruses, as well as
the emergence of new human infections caused by
arboviruses,[3] make it desirable to develop agents with broad-
spectrum activity.[4] It appears promising to target host factors,
which carry a lower risk of resistance development and have
higher potential for broad-spectrum activity.[5]
A
major
disadvantage and risk of targeting host factors, however, can
arise from interference with physiological host processes and
subsequent toxicity. One possible rationale to overcome this
disadvantage is the design of prodrugs which are specifically
activated within the virus-infected cells, or within those cells that
are preferably targeted by the virus.
The present work is based on the hypothesis that agents
influencing microtubule dynamics could be used in subcytotoxic
concentrations as systemic antiviral agents.
A
related,
successful example from clinical practice is the use of
podophyllotoxin as topical medication (Podofilox) to treat warts
that are often induced by infections with the human papilloma
virus.[6]
Tubulin ligands have the potential to inhibit the replication of
those viruses that depend on the microtubule network, such as
ZIKV and DENV.[7] Thus, these inhibitors might be suitable as
possible broad-spectrum anti-flaviviral or even broad-spectrum
antiviral agents.
We hypothesized that prodrugs of tubulin polymerization
inhibitors (TPIs) which are specifically activated in cells of the
monocyte-macrophage lineage and hepatocytes, which are
preferential targets of flaviviruses, would spare non-affected
cells and tissues from non-specific, toxic tubulin inhibition effects.
Microtubules and the cytoskeleton have been intensively
studied and found to be involved in several steps of the flaviviral
Introduction
The development of new antiviral agents against flaviviruses
remains a great necessity due to the lack of efficient vaccines or
other options for prevention or treatment of infectious diseases
caused by some of the most spread species of the Flavivirus
family – dengue, West Nile, and Zika viruses. Dengue is
considered the most common viral infection transmitted by an
arthropod with an estimated number of infections ranging from
50-100 million per year, of which 10-20 thousand are lethal.[1,2]
1
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
replication cycle, such as viral entry, intracellular transport, virion
assembly and egress.[8,9] Although the involvement of
microtubules in cell entry of DENV has been reported to be
crucial,[10,11] other reports suggest a microtubule-independent
cell entry of different DENV serotypes.[12] Also in these cases,
most potent member (combretastatin A4) has similar affinity to
tubulin as colchicine.[26] The combretastatins and their synthetic
analogues are accessible via Wittig reaction of two substituted
aromatic rings, which allows a straightforward synthesis of many
derivatives. Moreover, functional groups like amines and
carboxylic acids can be attached, rendering combretastatin an
attractive object for derivatization. As shown in Figure 2, the
hydroxyl group in position 3 of the B-ring is not essential for
activity, which makes this position attractive for the attachment
of prodrug moieties. A phosphoric acid ester attached at this
position yields a prodrug with increased aqueous solubility
(fosbretabulin) which showed potent anti-tumour activity in
clinical trials phase II.[27]
microtubules might be
a non-essential, but nevertheless
supportive factor for the infection of cells.[12]
The intracellular transport of viral particles in the host cell,
including their trafficking to assembly sites in later stages of the
infection, is performed by microtubules and their associated
proteins.[13] Tubulin was found to be 3.3-fold overexpressed in
patients with dengue haemorrhagic fever.[14] Acosta et al. have
demonstrated that inhibitors of microtubule polymerization cause
a significant reduction in virus production.[15] These authors also
suggested that the structural integrity of the microtubule network
is required for efficient entry of DENV into cells.
Tubulin structures in DENV-infected cells were described to
assist in the scaffold assembly of the virus through interactions
with the viral envelope (E) protein.[16] The microtubule-stabilizing
agent paclitaxel has been shown to reduce the viral titre of ZIKV
in Huh-7 cells, which suggests an important role of microtubule
dynamics in ZIKV replication.[17] Chen et al. have suggested that
a
microtubule destabilizing agent, colchicine, induced an
enhanced release of DENV from infected cells,[12] however the
influence on viral replication has not been explored in that study.
The main target cells for DENV are immune cells of the
macrophage-monocytic lineage (Langerhans cells, splenic
macrophages, tissue macrophages, Kupffer cells) as well as
hepatocytes and endothelial cells.[18,19] A potential activator
enzyme for prodrugs that is highly expressed in these cells is the
human carboxylesterase-1 (hCE1).[20,21] Depending on the
design of the prodrug, intracellular hydrolysis of a drug-ester
conjugate by hCE1 results in the formation of an active
compound with increased polarity, lower membrane permeability
and a tendency to accumulate within the targeted cells.[22] The
concept has already been applied to some antiarthritic[22]
compounds and imaging agents.[23] hCE1 was described to
cleave preferably at the two cleavage motifs shown in Figure 1,
the cyclopentanol esters of phenylglycine (Phg) and leucine. We
therefore chose to use these motifs in the design of hCE1
activated tubulin-ligand prodrugs.
Figure 2. Structure-activity relationships of the combretastatins. Shown is
combretastatin A-4 in the tubulin binding pocket (PDB code: 5LYJ) with the
established labelling of the carbon atoms. Essential structural elements are
marked in green: in particular, these are the four methoxy groups and the cis-
configured double bond with the surrounding hydrophobic area.[25] For reviews
of the SAR, see [28–30]
.
Figure 3. Outline of the most important characteristics of a molecule of
colchicine situated in a colchicine-binding site of tubulin (PDB code: 4O2B) as
identified by SAR, hydropathic analysis and 3D-QSAR. The area marked with
green colour indicates specific steric barriers of the binding site.[31]
The main problem regarding the use of colchicine and other
tubulin polymerization destabilizers as antiviral drugs is their
high systemic toxicity. Colchicine causes a complete inhibition of
tubulin assembly at substoichiometric concentrations[32] and has
strong anti-angiogenic effects, a typical feature of microtubule
disrupting agents, which is now seen to provide a promising
approach for the treatment of cancer.[33,34]
Previous attempts to decrease the systemic toxicity of
colchicine often resulted in a significant drop or total loss of
biological activity.[35] A structural analysis of the colchicine
binding site of tubulin reveals that mainly the A-ring of colchicine
Figure 1. hCE1 selective motifs according to Needham et al.[22]
:
Cyclopentyl esters of phenylglycine and leucine are hydrolyzed by human
carboxylesterase 1 to form cyclopentanol and the corresponding carboxylate.
Numerous
microtubule-stabilizing
and
-destabilizing
compounds are derived from natural products and have been
modified by partial or complete synthesis. The microtubule-
destabilizing alkaloid colchicine binds into a pocket between the
α- and β-tubulin subunits[24] and thereby inhibits tubulin
polymerization. The "colchicine binding site" is also targeted by
the combretastatins, another group of natural products[25] whose
2
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
and its substituents interact with the target whereas the B- and
especially C-ring offer potential for derivatization for the purpose
of toxicity reduction (Figure 3).
compound cytotoxicity and the way the compounds dock onto
the receptor. This correlates well with the antitumor activity of
these compounds. Other studies[47,49–52] have been devoted to
the modelling of pharmacophores, docking and virtual screening
of various tubulin inhibitors. The authors use the obtained
pharmacophore model of inhibition of tubulin to draw
conclusions on the antitumor activity relative to new potentially
active compounds.
Although sterically limited, due to the structure of the
colchicine-binding site, the most prominent position for
introducing structural alterations is the 10-methoxy group
situated in ring C. Replacements at this position and the amino
group at position 7 resulted in compounds with similar or lower
cytotoxicity as that of colchicine and higher selectivity of action
towards specific cells, e.g. cancer cells.[34,36–38] Particularly
promising is the replacement of the 10-methoxy group by amine-
containing scaffolds such as amino acids, or ammonia.[39,40]
Small substituents in that position are well tolerated, whereas
long or bulky moieties have a detrimental effect on activity.[34]
Considering the SAR outlined above, the tolerance of tubulin
towards modified ligands, and the synthetic accessibilities, we
chose position B-3 in combretastatin (see Figure 2) and
position 10 in colchicine (see Figure 3) as connecting points for
attachment of prodrug moieties. We anticipated that larger
moieties, i.e., those present in the prodrugs in these positions,
would cause a loss in tubulin affinity, rendering the prodrugs
inactive. In contrast, upon cleavage of the prodrug, we expected
the remaining attachment structures to be tolerated by tubulin.
Molecular modelling of biochemical processes makes it
possible to understand at a deeper level the mechanism of
interaction in the ligand-protein complex.[41] This knowledge can
be used to search for and synthesize new active compounds
with specific properties. Based on available experimental data
about the inhibition of tubulin polymerization, in recent years
there have been many studies related to the molecular
modelling and docking of various classes of chemical
compounds in the colchicine binding site of tubulin.[42–50]
Results and Discussion
Synthesis of Combretastatin- and Colchicine-Based
Derivatives
The hCE1-sensitive motifs used for derivatization were
obtained according to the method described by Charlton et al.[23]
with modification for the phenylglycine-based motif as described
in the Experimental Section. The obtained motifs were
connected to the active compounds via an amide bond.
Therefore, in the structure of combretastatin, the hydroxyl group
was replaced by a carboxylic acid group. To modulate activity,
toxicity and lipophilicity of the esters, alkyl spacers based on 4-
aminobutyric acid and 8-aminooctanoic acid were inserted
between combretastatin and the hCE1-sensitive motif
(Scheme 1). For the synthesis of colchicine C10-derivatives, we
chose the synthetic approaches provided in Scheme 2, using
colchicine as starting material. Modifications included
substitution of the methoxy group with amino functionalities
(ammonia or amino acid derivatives) in position 10. The formed
10-aminocolchicine or its derivatives were subjected to further
transformations via coupling reactions with the hCE1-sensitive
motif to obtain the final compounds (Scheme 2). The spacers
connecting the 10-aminocolchicine molecule to the hCE1-
sensitive motif were chosen to convey higher hydrophobicity to
the esters and thereby facilitate its penetration through the
cellular membrane and interaction with the hydrophobic pocket
of the colchicine-binding site.
In one of the first studies[42,43] devoted to the docking of
various ligands into the colchicine binding site of tubulin, it has
been shown that the binding of colchicine derivatives to the
active site of α-tubulin is due to the formation of hydrogen bonds
of colchicines with amino acids such as His28, Ser232, Cys356
and Arg320. For β-tubulin, binding occurs with Thr33 and Tyr36.
In several subsequent studies,[44–46] cytotoxic properties of
the compounds turned out to be due to their ability to inhibit the
polymerization of tubulin. Based on the results of docking, the
authors draw conclusions about the relationship between
Scheme 1. Synthesis of B-3-combretastatin derivatives: Combretastatin carboxylic acid (2) was formed in a Wittig reaction between the phosphonium salt 1
and the aromatic aldehyde. The coupling of the amino acid cyclopentyl ester and – if applicable – the alkyl spacer was performed in solution with the coupling
reagent 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate (HATU). Conditions: a = BuLi, THF, 0°C  rt, 12 h. b =
HATU, DMF, 0°C  rt, 24 h. The structural element of the amino acid (phenylglycine or leucine) is marked in red, cyclopentanol in blue.
3
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
Scheme 2. Synthesis of C10-colchicine derivatives
In conclusion, the aim of reduced toxicity was achieved by
creation of prodrugs for colchicine and combretastatin.
Cytotoxicity assay
Cytotoxicity of the studied compounds was evaluated via
Cell Titer Blue assay in HeLa and Huh7 cell lines over periods of
24 and 72 h. Attempts to measure the cytotoxicity in a 24 h
assay did not show the full cytotoxic effect of combretastatin,
colchicine and its derivatives.
Tubulin polymerization inhibition by combretastatin and
colchicine derivatives and its correlation with antiviral activity
The antiviral activity against DENV was measured after a
24 h incubation period with compound concentrations that
allowed cell viabilities greater than 80%. However, after 72 h
incubation, cytotoxicity was observed in the nanomolar
concentration range for the initial compounds (colchicine,
combretastatin) and in the micromolar range for the derivatives.
Along with the cytotoxicity, the ability of these compounds to
inhibit the polymerization of tubulin drops with increasing length
of the spacer. At a concentration of 10 µM, prodrug 7b leads to a
tubulin polymerization grade of 88% compared to the DMSO
control (Table 1). Prodrug 8b with the 4-aminobutyric acid
spacer showed almost no inhibition (95% polymerization grade),
while the most bulky prodrug 9b seems to promote tubulin
polymerization. Although this compound might act as
microtubule-stabilizer like paclitaxel, it is more likely that it either
leads to precipitation of tubulin or precipitates itself and thereby
generated a false positive signal in the tubulin polymerization
assay.
The main objective in creating prodrugs was to decrease the
cytotoxicity of combretastatin and its derivatives. Indeed, all
obtained derivatives show a cytotoxicity of at least three orders
of magnitude lower than combretastatin A-4. The prodrug with a
leucine cyclopentanol ester linked to combretastatin (7b) already
shows a large decrease in toxicity with a CC50 at about 30 µM. If
there is a spacer with a length of four carbon atoms (4-
aminobutyric acid) inserted between combretastatin and the
hCE1-sensitive motif (8b), the compounds become slightly more
toxic, perhaps due to higher permeability or stability. However,
the analogue with a C8-spacer (9b) shows reduced toxicity. We
observed the same characteristics with the phenylglycine
cyclopentanol esters 10, 11 and 12.
Analysis of the data of colchicine derivatives obtained in 72 h
treatment period shows that all 10-aminocolchicine derivatives
appear at least 100 times less toxic in comparison to the initial
10-aminocolchicine and colchicine. These data correlate very
well with the results obtained by other researchers that
demonstrated lower toxicity of the 10-alkylaminocolchicine
derivatives as compared to 10-aminocolchicine and
colchicine.[39,40]
4
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
Table 1. Combretastatin and colchicine derivatives: Effect on tubulin polymerization, cytotoxicity and susceptibility to hCE1 catalysed hydrolysis.
CC50 (72 h), µM
Tubulin
hCE1 catalysed cleavage in
vitro, %
Compound
DMSO
Structure
polymerization
at 10 µM, %
HeLa
Huh7
100
-
-
-
Combretastatin
A-4
40 ± 4
0.003 ± 0.001
0.009 ± 0.002
n.a.
2
91 ± 2
88 ± 2
> 50
> 50
n.a.
7a
7b
8a
8b
9a
9b
10
11
12
63.99 ± 1.68
39.67 ± 1.45
> 50
> 50
n.a.
88 ± 5
26.05 ± 2.45
63.32 ± 2.11
84 ± 8
> 50
n.a.
95 ± 2
0.92 ± 0.63
26.65 ± 2.59 µM
5.07 ± 4.16
6.83 ± 2.23
0.95 ± 0.72
> 50
14.99 ± 1.73
68.16 ± 3.24
112 ± 5
142 ± 22
79.4 ± 1.0
60± 2
> 50
n.a.
22.04 ± 1.55
8.52 ± 1.54
4.60 ± 1.26
11.39 ± 1.66
38.11 ± 4.64
0
0
0
93± 6
Colchicine
22 ± 8
33 ± 2
106 ± 4
0.058 ± 0.004
0.007 ± 0.005
> 50
0.003 ± 0.002
0.008 ± 0.004
> 50
n.a.
n.a.
n.a.
13
15a
5
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
CC50 (72 h), µM
Huh7
Tubulin
polymerization
at 10 µM, %
hCE1 catalysed cleavage in
vitro, %
Compound
15b
16
Structure
HeLa
86 ± 6
71 ± 11
120 ± 9
95 ± 5
1.19 ± 0.89
2.79 ± 1.25
5.40 ± 1.51
3.27 ± 1.47
0.68 ± 0.42
0.62 ± 0.39
1.19 ± 0.81
6.08 ± 1.66
> 50
17.99 ± 1.46
1.24 ± 0.86
0.96 ± 0.72
0.23 ± 0.16
0.22 ± 0.15
1.07 ± 0.85
4.62 ± 1.71
> 50
0
17a
n.a.
17b
18
13.33 ± 0.34
110 ± 6
88 ± 5
0
19a
n.a.
19b
20a
97 ± 1
35.70 ± 3.25
103 ± 3
100 ± 1
92 ± 4
n.a.
20b
21a
4.93 ± 1.85
0.73 ± 0.50
1.48 ± 1.06
4.48 ± 1.74
1.17 ± 0.78
4.95 ± 0.28
76.24 ± 11.56
n.a.
21b
118 ± 17
32.64 ± 5.37
Conditions for the tubulin polymerization assay: 4 mg/mL tubulin, 1 mM GTP, 10 µM compound, 80 mM PIPES, pH 6.9, 0.5 mM EGTA, 2 mM MgCl2, 1 h,
37°C, given is the degree of polymerization compared to the DMSO blank (100% = no inhibition). All experiments were performed in triplicate.
Hydrolysis assay: [hCE1] = 100 nM, [compound] = 10 µM in phosphate buffer, pH 7.4, incubated for 2 h at 37°C (if no cleavage was observed under these
conditione, then the incubation was repeated for 24 h). All experiments performed in triplicate.
“Com” = Combretastatin residue; “Col” = Colchicine residue; “n.a.” = not applicable (i.e., molecule has no cleavage site)
The same correlation between the length of the spacer and
the potency to inhibit tubulin polymerization is observed with the
phenylglycine cyclopentanol esters 10, 11 and 12. Yet, these
compounds show overall higher polymerization inhibition, with
11 being the most active one, reducing the rate of tubulin
polymerization to 60%. After hydrolysis, the toxicity of the
hydrolyzed peers 7a, 8a and 9a is lower than in their precursors,
perhaps because of pharmacokinetic effects, such as lower
permeability of the carboxylate.
The hydrolyzed prodrugs show similar effects on tubulin
polymerization as their precursors. For the pair 8a/b, a moderate
increase in activity could be found after hydrolysis. Nevertheless,
6
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
the concept of intracellular prodrug cleavage by ester hydrolysis
does not require an increase of activity, because the hydrolyzed
carboxylate drug can be anticipated to have low passive
membrane permeability and thereby accumulate in the target
cell.
The hydrolyzed analogues of the colchicine prodrugs with
shorter spacers like γ-amino-β-hydroxybutyric and γ-
aminobutyric acid are less active in the tubulin polymerization
assay than the respective prodrugs, possibly because of higher
polarity of the residue in position 10 as compared to other
colchicine derivatives . This property is probably not compatible
with the membrane-bound P-glycoprotein (P-gp, ABCB1, MDR1),
which is overexpressed in several different tumour types and is
associated with poor response to chemotherapy (various
microtubule disrupting compounds are substrates for P-gp, and
colchicine is one of them), might be one of the effects that could
influence the cell viability and antiviral response. However, it has
been detected before[53] that minimal size of the colchicine
derivative molecule is important for the interaction with P-gp,
which means that derivatization with bigger substituents can
affect it. According to Tang-Wai et al.[53] presence of rings B and
C is also crucial, which means that colchicine’s biphenyl
with binding to hydrophobic regions in the colchicine-binding site. analogues, like combretastatin, lack this interaction.
The only colchicine derivative for which its hydrolyzed peer has
shown higher inhibitory activity on tubulin polymerization than
the initial prodrug was compound 21b. In this case the polarity of
the carboxylic group in the motif is counterbalanced by the non-
polar aromatic ring.
Combretastatin, colchicine and some of the colchicine
derivatives were tested on their antiviral activity against dengue
and Zika virus (Table 2). The activity (EC50) of combretastatin
and colchicine against dengue replication was 870 nM, and
150 nM, respectively. The colchicine prodrug 21b showed
considerable antiviral activity despite its marginal effect on
tubulin polymerization, possibly due to an effect on microtubule
dynamics or due to interactions with other host cellular or viral
mechanisms.
Table 2. Antiviral activity in Huh7-cells against DENV or ZIKV. Given is
either the virus titre reduction in
% at a certain concentration or the
concentration where virus titre was reduced by 50% (EC50), determined after
an exposure time of 24 h. Also, for the sake of comparison the CC50 in Huh7
cells at 24 h is provided.
Hydrolysis of combretastatin and colchicine derivatives by
hCE1
CC50
(24 h),
µM, Huh7
Virus titre
reduction
Compound
Structure
The active site cavity of hCE1 is very large (~1300 Å3 in
volume), mostly flexible and is lined mainly by hydrophobic
residues, with the exception of the catalytic triad. The enzyme is
therefore considered to be relatively promiscuous and capable
of interacting with a variety of diverse ligands[54] preferring those
with small alcoholic group and a bulky acyl group, such as
oseltamivir, clopidogrel[55] and enalapril.[56]
Nevertheless, a clear structure-cleavability-relationship for
hCE1 substrates is observed in the present study. All
combretastatin prodrugs that contain the leucine cyclopentyl
moiety were hydrolyzed by the carboxyl esterase (Table 1). High
resolution ESI mass spectrometry detected the resulting
carboxylic acids and the ratio of hydrolyzed prodrug was
quantified by HPLC-UV. The conversion was less effective for
derivatives containing a long alkyl spacer. The 8-aminooctanoic
acid analogue (9b) had the lowest ratio of cleavage. This might
be due to steric hindrance by the C8-chain. The prodrugs with a
4-aminobutyric acid based spacer and with no spacer at all were
cleaved more effectively. Conversion rates after 1 h of
incubation were between 60-70%.
DENV:
Combreta-
statin A-4
EC50=870 nM
ZIKV: 70% at
5 µM
38.30
29.91
DENV:
EC50=150 nM
Colchicine
ZIKV: 89.67% at
5 µM
DENV: 37.04%
at 0.78 µM
13
16.84
32.54
ZIKV:
EC50=878 nM
17b
DENV: 20.00%
at 3.125 μM
19b
20b
16.25
8.95
On the other hand, all phenylglycine cyclopentyl ester
combretastatins were inert against hydrolysis by hCE1. This
contradicts the results by Needham et al.[22] who presented the
phenylglycine cyclopentyl moiety as an hCE1 sensitive motif.
After incubation, no cleavage products could be detected by
HPLC-UV or ESI-MS.
DENV: 40.00%
at 3.125 μM
DENV: 52.94%
at 0.78 μM
Out of all colchicine derivatives with esterase-sensitive
motifs tested for cleavability, only those containing leucine
cyclopentyl ester were hydrolyzed by hCE1. In the row of
derivatives with spacers ranging from γ-aminobutyric acid to ε-
aminocaproic acid and 8-aminooctanoic acid the average
conversion rate increased from 17.99 ± 1.46%to 35.70 ±
3.25%and 76.24 ± 11.56%, respectively. Hydrolysis could not be
observed for the phenylglycine cyclopentyl esters moieties. As
for the combretastatin analogues, the lack of hydrolysis of the
21b
10.98
ZIKV:
EC50=1.851 µM
“Com” = Combretastatin residue; “Col” = Colchicine residue
The fact that toxicity and activity of the microtubule
disrupting agents have been assayed in tumour cell lines might
bring one artefact interaction that would be avoided in healthy
cells. Thus, the possible interaction of the obtained compounds
7
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
phenylglycine cyclopentyl ester by hCE1 is in conflict with the
data presented by Needham et al.[22]
similar conditions of solid-phase peptide synthesis[57] or steric
hindrance as it could be in the case of tert-Bu derivatives.[21]
However, one of the stereoisomers should still fit the enzyme
hydrolytic pocket and, at least, partial hydrolysis should take
place. Only 4-formylbenzoic acid based spacer in colchicine
derivatives gave the prodrugs that are inactive before cleavage
and get activated after cleavage. Introduction of alkyl spacers
resulted in compounds with good inhibition of tubulin
polymerisation in uncleaved form lower inhibition in cleaved form.
Remaining uncleaved and active these compounds cannot be
classified as prodrugs but only as active compounds.
Considering this conflicting evidence, we studied whether
compounds with the Phg-Cyp motif inhibit the hydrolytic activity
of hCE1. Compounds 10, 11, 12 and 18 were therefore assayed
for inhibition of hCE1 activity. However, these compounds did
not reduce the hydrolysis of the substrate p-nitrophenyl acetate
by hCE1.
Another possible reason for the lack of derivatives’
hydrolysis was the inability of their ester moieties to enter the
hydrolytic site of the enzyme, which could have been caused by
racemization of the Phg that has been previously detected in
Figure 4. 2D diagram (ligand interactions) and 3D interactions with the tubulin binding site for Col (right) and Com (left). Blue shows the position of ligands taken
from crystalline PDB data; 4O2B and 5LYJ.
contributions of hydrogen bonds, as well as ionic, hydrophobic
Molecular modelling studies
and van der Waals interactions.
The predicted energies of binding between the protein and
Col or Com were 16.84 kcal/mol and 15.12 kcal/mol,
respectively, which is in accordance with their inhibiting effect on
the polymerization of tubulin. The best docking positions for Col
(right) and Com (left) with amino acid residues of the active site
are shown in Figure 4.
To rationalize the binding mode of the compounds, docking
of some of them was performed in the colchicine binding site of
tubulin. Initially, the parent compounds combretastatin (Com)
and colchicine (Col) were docked into the colchicine binding site
of tubulin to validate the docking procedure.
The protonated ligand structures were optimized within the
binding site in the crystal structure of tubulin (PDB; 4O2B-for the
Col derivatives[58] and 5LYJ for the Com derivatives[25]). In the
process of docking, the active site around the bound inhibitor in
the molecular structure of tubulin was determined with the radius
of 8 Å. Values of free energies of binding between the protein
and the ligand were calculated taking into account the
The performed docking calculations are in agreement with
the experimental x-ray structures. This indicates a correct choice
of parameters for docking and the force field calculations. Let us
briefly consider some features of the interaction of the base
molecules Com and Col that is important for further analysis of
the results of docking in regard of their derivatives. As can be
seen from the results of docking, both molecules bind to the
colchicine binding site via hydrogen bonds and hydrophobic
8
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
interactions. The molecule Col is orientationally fixed in a
hydrophobic pocket consisting of Val181α (3.05 Å) and Ala180α
(3.26 Å). The stabilization of the Col molecule is due to the H-
acceptor interaction with the carbonyl group of the seven-
membered ring of colchicine. The H-donor interaction is
observed between the amino acid residues Met259β (3.71 Å),
Thr179α (3.47 Å) and the methoxytropone ring. 3- and 4-OCH3-
methoxyphenyl can form hydrogen bonds with Cys241β (3.56
and 4.68 Å).
Com binding also occurs in the colchicine binding site of
tubulin, with the only difference that amino acid residues taking
part in the formation of the ligand-protein complex are a bit
different (See Figure 4 below). The molecule Com is loosely
located in the pocket of tubulin and forms strong hydrophobic
interactions with residues Leu248β, Ala354β and Val181α of the
active centre of the protein. As seen from Figure 4, the strong
binding of compounds to the protein determines their inhibiting
activity as to the polymerization of tubulin that corresponds to
the experimental results of the studies on the inhibition of tubulin
polymerization.
from Figure 5, several binding interactions different from Com
appear between the Com derivative 8a and the amino acid
residues of the active site. For example, the formation of a
strong hydrogen bond between Asn349β (2.27 Å) and the
hydroxyl group is observed in the 4-aminobutyric acid fragment.
At the opposite end of the molecule, a new close contact
appears between the 3-methoxy group of 8a and the carbonyl
group of Cys241β (2.75 Å) and Val238β (3.03 Å). It should be
noted that the interaction with the receptor occurs predominantly
through the β-subunit of the protein. Hydrophobic interactions of
the molecule at distances from 3.47 to 3.95 Å arise with Lys352β,
Ala354β, Thr179α and Val181α. The predicted binding energy of
8a with the target is 10.37 kcal/mol, considerably lower than for
Com. This suggests a weaker interaction of 8a with the target.
The next step in molecular modelling was to study the
binding mode of the Com and Col derivatives to tubulin. To this
end, we examined the docking of the molecules 8a, 17a and 21a
which are representatives of the synthesized series of the Com
and Col basic structures, to the colchicine-binding site of tubulin.
Figure 6. 2D diagram and 3D interactions with the tubulin binding site for 17a.
The results of docking of the Col derivative 17a compound
are shown in Figure 6. As seen from the 2D diagram, the
molecule forms several hydrogen bonds with the target. The
strongest interaction is observed for Glu183α (2.41 Å) and
Pro173α (1.79 Å). Similar to 8a, the main contributions to the
binding arise from the terminal parts of the molecule (4-
aminobutyric acid and 3,4,5-trimethoxiphenyl-methoxytropone
ring). Formation of the hydrogen bond Pro173α with the
Figure 5. 2D diagram and 3D interactions with the tubulin-binding site for 8a
The increase in size and volume of the molecule directly
affects the character of binding to the receptor. Figure 5
presents a 2D-diagram and the 3D arrangement of molecules
bound to the colchicine-binding site of tubulin. As can be seen
9
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
acetamide group of the seven-membered ring is characteristic
for 17a.
hydrogen bond formation with participation of the amide
fragment is characteristic for most compounds exhibiting
biological activity. The aromatic ring does not participate in direct
binding to the receptor.
On the other hand, as noted above, the linker can
significantly affect the spatial orientation of a ligand. Due to the
presence of the conformationally flexible alkyl linkers - (CH2-)n -
the possibility of changing the spatial orientation of the head (Col
The linker (-CH2-)n attached to the acetamide group does not
radically affect the character of binding of the root (head) part of
the molecule (Col and Com) to the active site of the protein.
Differences are observed in the spatial arrangement of these
molecules in the receptor pocket and in their specific binding to
the amino acids of the protein. All this leads to a decrease in
predicted energy of binding to the target for 17a (11.27 kcal/mol), and Com) and tail (4-aminobutyric acid) of the molecule
compared to the unsubstituted molecule (Col - 16.84 kcal/mol).
The exit of a bulk molecule from the colchicine-binding site
can be one of the factors reducing the inhibitory activity of the
molecule as to the tubulin polymerization, and in some cases
(see 9a and 17a) it can even accelerate its polymerization. The
introduction of the phenyl group into the base molecule as a
linker is illustrated by the example of the Col derivative 21a. The
docking pose of 21a in the binding site of tubulin is shown in
Figure 7.
increases significantly (see 8a, 9a, and 17a). The addition of the
'hard' phenyl ring to the Col molecule makes the 21a compound
more flat and stiff, due to the presence of the stabilizing π-bonds
in the Col-NH-CO-Ph fragment. The predicted energy of binding
with the target for both 21a and 17a amounts to 11.25 kcal/mol,
and is significantly lower than for Col.
In conclusion, it should be noted that the Col and Com
derivatives obtained in this work form less interactions with the
colchicine binding site of tubulin and inhibit the polymerization of
the protein to a lesser extent. At the same time, they are less
toxic, compared to non-substituted Col and Com.
Conclusions
The main pharmacological property and disadvantage of the
TPIs regarding their use for antiviral therapy is their high
cytotoxicity. As a result of the designed modifications in the
structure of two TPIs, colchicine and combretastatin, a group of
less toxic derivatives with an hCE1 sensitive motif in their
structure was obtained. It could be demonstrated that only Leu-
based derivatives were subjected to hydrolysis by hCE1
whereas the Phg-containing analogues remained uncleaved,
contrary to the findings of Needham et al.[22] The Leu- and Phg-
based derivatives were less cytotoxic than their parent
compounds colchicine and combretastatin. Docking studies of
the compounds within the colchicine-binding site of tubulin
indicated several reasons for the lower affinity towards tubulin.
The most active compounds in viral replication assays were the
parent compounds colchicine and combretastatin, but some
derivatives like 21b and 17b also showed good activity while
being much less toxic. The lack of correlation between tubulin
binding, cytotoxicity and the antiviral activity of the initial
compounds and their derivatives indicates that tubulin binding is
not the only mechanism of antiviral activity of the latter.
Moreover, the lack of significant difference between the
cytotoxicity of cleavable and non-cleavable compounds indicates
that the hCE1 selective motif does not influence the toxicity.
Further exploration of this topic could elucidate alternative
mechanisms of antiviral activity of the obtained derivatives
besides tubulin binding.
Experimental Section
Chemistry. All chemicals for the synthesis were of analytical grade and
purchased from Sigma-Aldrich (Germany), Carbolution (Germany), TCI
(Belgium), Carl Roth GmbH (Germany), and Acros Organics (Belgium).
Chemicals were used without further purification unless otherwise stated.
All solvents were purchased from commercial sources. Dry solvents were
stored over molecular sieves. NMR spectra were recorded on a Varian
NMR instrument at 300 MHz, 298 K in CDCl3, CD3OD or DMSO-d6.
Figure 7. 2D diagram and 3D interactions with the tubulin binding site for 21a.
As in the case of 17a, the H-acceptor interactions of the
amide group (-NH-) with Glu183α (2.45 Å) and of the 4-OCH3-
groups with Tyr224α (2.62 Å) are observed for 21a. The
10
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
Chemical shifts (δ) are given in parts per million (ppm). Proton peaks of
residual non-deuterated solvents were used for calibration. Coupling
constants (J) are given in Hertz (Hz). Multiplicity is given as s (singlet), d
(doublet), t (triplet), q (quartet) or m (multiplet). Mass spectra were
measured on a Bruker micrOTOF-Q II (HR-ESI) instrument. Flash
chromatography was performed on a Biotage Isolera One purification
system using silica gel (0.060-0.200 mm) cartridges (KP-Sil) and UV
monitoring at 254 nm and 280 nm. Preparative HPLC was performed on
an ÄKTA Purifier, GE Healthcare (Germany), with an RP-18 pre and
main column (Reprospher, Dr. Maisch GmbH, Germany, C18-DE, 5 µM,
30 mm x 16 mm and 120 mm x 16 mm). Analytical HPLC was performed
on an Agilent 1200 HPLC system with a UV detector on an RP-18
column (ReproSil-Pur-ODS-3, Dr Maisch GmbH, Germany, 3 µm, 50 mm
x 2 mm).
2. Combined yield 96.6 mg (0.281 mmol, 59%). 1H NMR (CDCl3): cis-
isomer: δ = 8.15 (d, 2.0 Hz, 1 H), 7.45 (dd, J = 8.8 Hz, J = 2.0 Hz, 1 H),
6.89 (d, J = 8.8 Hz, 1 H), 6.57 (d, J = 12.1 Hz, 1 H), 6.50 (d, J = 12.1 Hz,
1 H), 6.45 (s, 2 H), 4.05 (s, 3 H), 3.85 (s, 3 H), 3.69 (s, 6 H). trans-
isomer: δ = 8.37 (d, J = 2.0 Hz, 1 H), 7.68 (dd, J = 8.6 Hz, J = 2.0 Hz, 1
H), 7.07 (m, 1 H), 7.06 (d, J = 16.6 Hz, 1 H), 6.97 (d, J = 16.6 Hz, 1 H),
6.74 (s, 2 H), 4.11 (s, 3 H), 3.92 (s, 6 H), 3.87 (s, 3 H). HRMS-ESI (m/z):
[M + Na]+ calcd for C19H20O6Na: 367.1158, found: 367.1186.
General procedure for amide coupling of compounds (3, 4, 7b, 8b,
9b, 10, 11, 12). In a dry round bottom flask, 1 eq carboxylic acid, 1.05 eq
O-(7-azabenzo-triazole-1-yl)-N,N,N',N'-tetramethyluronium
hexafluoro-
phosphate (HATU) and 1.1 eq 1-hydroxy-7-azabenzotriazole (HOAt)
were dissolved in 3 mL dry DMF. The solution was cooled to 0°C and
1.3 eq diisopropylethylamine (DIPEA) were added. The resulting yellow
solution was stirred for 3 minutes, then 1 eq amine was added and the
reaction was stirred overnight at room temperature. After completion, the
reaction was quenched with ice and the solvent was evaporated in vacuo.
The residue was purified by preparative HPLC (10%-80% methanol in
water).
Synthesis of 1. 3 g (15.3 mmol, 1 eq) 3,4,5-trimethoxybenzaldehyde
were dissolved in 50 mL methanol. 1.17 g (30.6 mmol, 2 eq) NaBH4 were
added in portions. The solution was stirred for 30 minutes at room
temperature. Upon completion, the solvent was removed under reduced
pressure and the residue was dissolved in dichloromethane, washed with
water, dried over MgSO4 and concentrated in vacuo. Yield 2.44 g
1
3 HRMS-ESI (m/z): [M + Na]+ calcd for C23H27NO7Na: 452.1680, found:
(12.32 mmol, 81%). H NMR (CDCl3): δ = 6.61 (s, 2 H), 4.64 (d, J = 4.4
Hz, 2 H), 3.87 (s, 6 H), 3.84 (s, 3 H), 1.64 (t, J = 4.4 Hz, 1 H).
452.1680.
4 HRMS-ESI (m/z): [M + Na]+ calcd for C27H35NO7Na: 508.2311, found:
508.2497
2.4 g (3,4,5-trimethoxyphenyl)methanol were dissolved in 100 mL
dichloromethane and cooled to 0°C. 1.25 mL (13.3 mmol, 1.1 eq) PBr3
were added dropwise. The solution was stirred for 30 minutes. Upon
completion, the reaction was quenched with ice-cold water and the
product was extracted with dichloromethane. The combined organic
extracts were dried over MgSO4 and concentrated in vacuo. Yield 2.7 g
(10.4 mmol, 86%). 1H NMR (CDCl3): δ = 6.62 (s, 2 H), 4.46 (s, 2 H), 3.87
(s, 6 H), 3.84 (s, 3 H).
7b HRMS-ESI (m/z): [M + Na]+ calcd for C30H39NO7Na: 548.2619, found:
548.2602.
8b HRMS-ESI (m/z): [M + Na]+ calcd for C34H46N2O6Na: 633.3146, found:
633.3171.
In a round bottom flask, 2.7 g (10.4 mmol, 1 eq) 3,4,5-trimethoxy-
benzylbromide and 2.7 g (10.4 mmol, 1 eq) PPh3 were dissolved in
chloroform. The solution was refluxed at 65°C for 24 h. The solvent was
removed under reduced pressure. The oily residue was collected in
cyclohexane and evaporated again, yielding a white solid. The crude
product was purified by recrystallization in EtOH. Yield 5.4 g (10.4 mmol,
100%). 1H NMR (CDCl3): δ = 7.80-7.73 (m, 9 H), 7.66-7.62 (m, 6 H), 6.46
(d, J = 2.7 Hz, 2 H), 5.40 (d, J = 13.9 Hz, 2 H), 3.76 (s, 3 H), 3.51 (s, 6 H).
9b HRMS-ESI (m/z): [M + Na]+ calcd for C38H54N2O8Na: 689.3772, found:
689.3775.
10 HRMS-ESI (m/z): [M + Na]+ calcd for C32H35NO7Na: 568.2306, found:
568.2285.
11 HRMS-ESI (m/z): [M + Na]+ calcd for C36H42N2O8Na: 653.2833, found:
653.2863.
General procedure for Wittig reaction of combretastatin A-4 and 2.
In a dry and nitrogen-purged round bottom flask, 500 mg (0.955 mmol,
2 eq) 1 were suspended in 10 mL dry THF and cooled to 0°C. 955 µL
(2.38 mmol, 5 eq) of a 2.5 M n-butyllithium solution in hexane were
added dropwise. The suspension should maintain an orange colour for at
least 30 minutes. Then, the corresponding benzaldehyde (0.477 mmol,
1 eq) was added in one portion. The reaction mixture was allowed to
warm to room temperature and stirred overnight. Upon completion, the
reaction was quenched with ice-cold water. The aqueous phase was
neutralized with 1 M HCl and the product was extracted three times with
ethyl acetate. The combined organic extracts were dried over MgSO4 and
evaporated to give the crude product that contained the cis- and the
trans-isomer. The desired cis-product (combretastatin A-4) or a mixture
of cis- and trans-product respectively (2) was isolated by flash
chromatography (10%-60% ethyl acetate in cyclohexane for
12 HRMS-ESI (m/z): [M + Na]+ calcd for C40H50N2O8Na: 709.3459, found:
709.3457.
Synthesis of the hCE1-sensitive motif tosylate salt of cyclopentyl L-
leucinate (5). Cyclopentanol (28.00 mL, 305 mmol) and p-toluene
sulfonic acid (6.43 g, 33.3 mmol) were added to a suspension of L-
leucine (4.062 g, 30.5 mmol) in cyclohexane (150 mL). The vessel was
fitted with a Dean-Stark receiver and slowly heated to 120°C for complete
dissolution of the reactants. Temperature was maintained at 120°C for a
period of 12 hours. The reaction was then cooled to room temperature,
which lead to precipitation of a white solid. The solid was filtered and
washed with EtOAc before drying in vacuo using a desiccator. Yield
9.630 g (85%); 1H NMR (300 MHz, DMSO-d6, δ, ppm, J/Hz): 7.63 - 7.77
(m, 2 H, tosyl protons), 7.23 (dd, J=8.7, 0.7, 2 H, tosyl protons), 5.26 -
5.32 (m, 1 H), 3.95 (t, J=6.9, 1 H), 2.37 (s, 3 H), 1.85 - 2.00 (m, 2 H), 1.60
- 1.83 (m, 8 H, cyclopentyl protons), 0.99 (dd, J=5.8, 6 H, leucine);
HRMS-ESI (m/z): [M + H]+ calcd for C11H21NO2: 200.1645, found:
200.1700.
combretastatin A-4 and 10% methanol in ethyl acetate for
2
respectively).
1
Combretastatin A-4. Yield 56 mg (0.177 mmol, 37%). H NMR (CDCl3):
δ = 6.92 (d, J = 1.8 Hz, 1 H), 6.79 (dd, J = 8.3 Hz, J = 1.8 Hz, 1 H), 6.73
(d, J = 8.3 Hz, 1 H), 6.52 (s, 2 H), 6.47 (d, J = 12.1 Hz, 1 H), 6.41 (d, J =
12.1 Hz, 1 H), 5.52 (bs, 1 H), 3.86 (s, 3 H), 3.84 (s, 3 H), 3.70 (s, 6 H).
HRMS-ESI (m/z): [M + Na]+ calcd for C18H20O5Na: 339.1203, found:
339.1210.
Synthesis of the hCE1-sensitive motif chloride salt of cyclopentyl L-
phenylglycinate (6). To a slurry of L-phenylglycine (3.054 g, 20 mmol) in
cyclopentanol (20 mL) in an ice bath, thionyl chloride (5.19 mL, 70 mmol)
was added dropwise over the period of 5 min from an automatic pipette
with a polyethylene tip. The resulting mixture was kept at 0°C for
approximately 15 min before it was gently heated to 120°C (using an oil
11
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
bath) for 12 h. Then it was left over night at RT for crystallization. The
solid was filtered and washed with EtOAc before drying in vacuo in a
desiccator. Yield 1.910 g (37%); 1H NMR (300 MHz, DMSO-d6, δ, ppm,
J/Hz): 8.99 (br. s., 3 H, -NH3+), 7.37 - 7.53 (m, 5 H, phenyl), 5.13 - 5.20
(m, 2 H), 1.31 - 1.94 (m, 8 H, cyclopentyl protons); HRMS-ESI (m/z): [M +
H]+ calcd for C13H18NO2: 220.1332, found: 220.1378.
14b Yield 0.149 g (77%). 1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.38
(d, J=11.4 Hz, 1 H), 7.27 (s, 1 H), 6.82 (d, J=11.6 Hz, 1 H), 6.68 (s, 1 H),
4.49 (dd, J=11.9, 6.1 Hz, 1 H), 3.87 (s, 3 H, -OCH3), 3.86 (s, 3 H, -OCH3),
3.53 (s, 3 H, -OCH3), 2.48 - 2.58 (m, 1 H), 2.11 - 2.32 (m, 3 H), 1.99 ppm
(s, 3 H, -NAc). HRMS-ESI (m/z): [M + Na]+ calcd for C25H30N2O8Na:
509.1894, found: 509.1898.
General procedure for synthesis of metabolites (7a, 8a, 9a). In a
round bottom flask, 1 eq free carboxylic acid, 1.05 eq O-(7-azabenzo-
triazole-1-yl)-N,N,N',N'-tetramethyluronium hexafluoro-phosphate (HATU)
and 1.1 eq 1-hydroxy-7-azabenzotriazole (HOAt) were dissolved in 3 mL
dry DMF. The solution was cooled to 0°C and 2.3 eq
diisopropylethylamine (DIPEA) were added. The resulting yellow solution
was stirred for 3 minutes, then 1 eq L-leucine tert-butyl ester
hydrochloride was added and the reaction was stirred overnight at room
temperature. After completion, the reaction was quenched with ice. The
resulting precipitate was filtered and dissolved in a 1:1 mixture of DCM
and TFA. This solution was stirred for 15 minutes at room temperature,
and then the solvents were removed in vacuo. The residue was purified
by preparative HPLC (10%-80% methanol in water).
14c Yield 0.032 g (52%). 1H NMR (300 MHz, CDCl3 δ, ppm, J/Hz):  =
7.51 (s, 1 H), 7.44 (d, J=11.3 Hz, 1 H), 6.63 (d, J=11.4 Hz, 1 H), 6.52 (s,
1 H), 4.67 (dd, J=11.8, 5.9 Hz, 1 H), 3.91 (s, 3 H), 3.87 (s, 3 H), 3.58 (s, 3
H), 2.40 - 2.51 (m, 1 H), 2.15 - 2.38 (m, 4 H), 1.97 (s, 3 H), 1.62 - 1.83
(m, 5 H), 1.43 - 1.55 ppm (m, 2 H). HRMS-ESI (m/z): [M + Na]+ calcd for
C27H33N2O7Na: 521.2264, found: 521.2232.
14d Yield 0.151 g (96%). 1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.43
(d, J=11.4 Hz, 1 H), 7.26 (s, 1 H), 6.82 (d, J=11.4 Hz, 1 H), 6.70 (s, 1 H),
4.49 (dd, J=12.1, 6.2 Hz, 1 H), 3.88 (s, 3 H, -OCH3), 3.87 (s, 3 H, -OCH3),
3.54 (s, 3 H, -OCH3), 1.99 (s, 3 H, -NAc), 1.74 (quin, J=7.1 Hz, 2 H), 1.61
(quin, J=7.2 Hz, 2 H), 1.31 - 1.50 ppm (m, 8 H). HRMS-ESI (m/z): [M +
Na]+ calcd for C29H38N2O7Na: 549.2571, found: 549.2639.
7a HRMS-ESI (m/z): [M + Na]+ calcd for C25H31NO7Na: 480.1993, found:
General procedure for the synthesis of compounds 15b, 16, 17b, 18,
480.1989.
19b, 20b by coupling hCE1-sensitive motifs with
a
C-10-
demethoxyolchicine amino acid derivative. The carboxylic acid (14a-
d) was dissolved in 3 mL of dry DMF by stirring at RT. A double,
respectively threefold molar equivalent of diisopropylethylamine (DIPEA)
was added by syringe and stirred 10 minutes. Then a double molar
equivalent of O-(7-azabenzo-triazole-1-yl)-N,N,N',N'-tetramethyluronium
hexafluoro-phosphate (HATU) was added as a solid and the resulting
clear solution was stirred for 10 min at RT. The appropriate hCE1-
sensitive motif (1,2) was added in a surplus (up to fivefold molar
equivalent) and the resulting solution was stirred 24 h. Completion of the
reaction was monitored by TLC. Then the solution was diluted with water
and extracted with 3 x 15 mL EtOAc. The received extract was then dried
over MgSO4, filtered and the resulting solution was checked by TLC again.
In the following, the compound was purified by flash column
chromatography and finally dried in vacuo, using a vacuum desiccator for
approximately 24 h.
8a HRMS-ESI (m/z): [M - H]- calcd for C29H37N2O8: 541.2555, found:
541.2557.
9a HRMS-ESI (m/z): [M - H]- calcd for C33H45N2O8: 597.3170, found:
597.3173.
Synthesis of 10-demethoxy-10-aminocolchicine (13). 0.399 g
(1 mmol) of colchicine were mixed with 2 mL of NH4OH 25% and 0.5 mL
of 96% ethanol. The mixture was placed in a 10 mL microwave reaction
tube and placed for 15 min, at 110°C and 1200 rpm in a MW reactor.
After that it was checked by TLC, diluted with water and extracted with
EtOAc. The extract was dried over MgSO4, filtered and resulting solution
checked by TLC again. Afterwards, the compound was purified by flash
column chromatography with evaporation of the solvent at rotary
evaporator and finally dried in vacuo, using a vacuum desiccator for
15b Yield 0.015 g (38%). 1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.97
(s, 1 H), 7.44 (d, J=11.3 Hz, 1 H), 7.26 (s, 1 H), 6.87 (d, J=11.4 Hz, 1 H),
6.71 (s, 1 H), 4.50 (dd, J=12.2, 6.2 Hz, 1 H), 4.32 - 4.39 (m, 1 H), 3.88 (s,
3 H, -OCH3), 3.86 (s, 3 H, -OCH3), 3.54 (s, 3 H, -OCH3), 2.01 - 2.49 (m, 6
H), 1.99 (s, 3 H, -NAc), 1.52 - 1.97 (m, 8 H, cyclopentyl protons), 0.90
ppm (dd, J=11.2, 6.4 Hz, 6 H, 2CH3 leucine protons). HRMS-ESI (m/z):
[M + H]+ calcd for C36H49N3O8: 652.3592, found: 652.3696; [M + Na]+
calcd for C36H49N3O8Na: 674.3412, found: 674.3520.
1
approximately 24 h. Yield 0.289 g (75%). H NMR (300 MHz, CD3OD, δ,
ppm, J/Hz): 7.12 (1 H, s) 6.74 (1 H, s) 3.91 (3 H, s) 3.89 (3 H, s) 3.57 (3
H, s) 2.02 (3 H, s). HRMS-ESI (m/z): [M + Na]+ calcd for C21H24N2O5Na:
407.1577, found: 407.1837.
General procedure for the synthesis of colchicine-amino acid
derivatives (14a-d). To a solution of colchicine (80/160 mg) in 0.5 mL of
96% EtOH , the 10-fold molar equivalent of the appropriate amino acid ɣ-
aminobutyric acid (for 15b, 16), (S)-(-)-4-amino-2-hydroxybutyric acid (for
17b, 18), ɛ-aminocaproic acid (for 19b), 8-aminooctanoic acid (for 20b)
and 0.6 mL 1 M NaOH in 1.55 mL distilled water were added. The
resulting mixture was then stirred for 24 h at 1000 rpm. The end of the
occurring reaction was confirmed by TLC. As a next step, the mixture
was acidulated with 1 M HCl until it reached a pH-value of 5-6 depending
on the acid used. Then the organic solvent was carefully removed in
vacuo in a rotary evaporator and the water layer extracted with 3 x 15 mL
EtOAc. The obtained extract was then dried over MgSO4, filtered and
resulting solution checked by TLC again. In the following, the compound
was purified by flash column chromatography with evaporation of the
solvent at rotary evaporator and finally dried in vacuo, using a vacuum
desiccator for approximately 24 h.
1
16 Yield 0.015 g (37%). H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.97
(s, 1 H), 7.46 - 7.30 (m, 5 H, phenylglycine aromatic protons), 6.85 (dd,
J=11.4, 2.3 Hz, 1 H), 6.71 (s, 1 H), 5.39 (s, 1 H), 3.88 (s, 3 H, -OCH3),
3.86 (s, 3 H, -OCH3), 3.53 (s, 3 H, -OCH3), 2.02 - 2.47 (m, 6 H), 1.98 (s, 3
H, -NAc), 1.43 - 1.78 ppm (m, 8 H, cyclopentyl protons). HRMS-ESI
(m/z): [M + H]+ calcd for C38H45N3O8: 672.3279, found: 672.3339; [M +
Na]+ calcd for C38H45N3O8Na: 694.3099, found: 694.3167.
17b Yield 0.013 g (28%).1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.48
(d, J=11.3 Hz, 1 H), 7.29 (s, 1 H), 6.87 (d, J=11.3 Hz, 1 H), 6.74 (s, 1 H),
3.92 (s, 3 H, -OCH3), 3.90 (s, 3 H, -OCH3), 3.57 (s, 3 H, -OCH3), 3.02 (d,
J=0.3 Hz, 1 H), 2.88 (d, J=0.7 Hz, 1 H), 2.55 - 2.65 (m, 1 H), 2.21 (br. s.,
4 H), 2.02 (s, 3 H, -NAc), 1.48 - 1.92 (m, 8 H), 0.88 ppm (dd, J=11.2, 6.3
Hz, 6 H, 2CH3 leucine protons). HRMS-ESI (m/z): [M + H]+ calcd for
14a Yield 0.140 g (74%). 1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.40
(d, J=11.4 Hz, 1 H), 7.25 (s, 1 H), 6.82 (d, J=11.4 Hz, 1 H), 6.67 (s, 1 H),
4.47 (dd, J=12.0, 6.2 Hz, 1 H), 3.85 (s, 3 H, -OCH3), 3.84 (s, 3 H, -
OCH3), 3.52 (s, 3 H, -OCH3), 3.42 (t, J=7.0 Hz, 2 H), 2.35 (t, J=7.0 Hz, 2
H), 2.07 - 2.30 (m, 2 H), 1.99 ppm (s, 3 H, -NAc). HRMS-ESI (m/z): [M +
H]+ calcd for C25H30N2O7: 471.2126, found: 471.2442; [M + Na]+ calcd for
C25H30N2O7Na: 493.1945, found: 493.2273.
C36H49N3O9: 668.3542, found: 668.3609; [M
C36H49N3O9Na: 690.3361, found: 690.3427.
+
Na]+ calcd for
18 Yield 0.012 g (25%).1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.28 -
7.41 (m, 5 H, phenylglycine aromatic protons), 6.89 (d, J=11.4 Hz, 1 H),
6.74 (s, 1 H), 3.92 (s, 3 H, -OCH3), 3.90 (s, 3 H, -OCH3), 3.57 (s, 3 H, -
12
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
1
OCH3), 3.02 (d, J=0.3 Hz, 1 H), 2.05 (s, 3 H, -NAc), 2.02 (s, 3 H), 1.42 -
1.95 ppm (m, 8 H, cyclopentyl protons). HRMS-ESI (m/z): [M + H]+ calcd
for C38H45N3O9: 688.3229, found: 688.3282; [M
C38H45N3O9Na: 710.3048, found: 710.3125.
17a H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.44 (d, J=11.3 Hz, 1 H),
7.26 (s, 1 H), 6.82 (d, J=11.4 Hz, 1 H), 6.71 (s, 1 H), 3.88 (s, 3 H, -OCH3),
3.87 (s, 3 H, -OCH3), 3.55 (s, 3 H, -OCH3), 1.99 (s, 3 H, -NAc), 1.51 -
1.66 (m, 3 H), 0.85 ppm (dd, J=11.7, 6.3 Hz, 6 H, 2CH3 leucine protons).
HRMS-ESI (m/z): [M - H]- calcd for C35H41N3O8: 630.2821, found:
630.2729.
+
Na]+ calcd for
19b Yield 0.066 g (91%). 1H NMR (300MHz, CDCl3 δ, ppm, J/Hz):  =
6.60 (d, J=11.4 Hz, 1 H), 6.54 (s, 1 H), 6.10 (d, J=8.1 Hz, 1 H), 3.94 (s, 3
H, -OCH3), 3.90 (s, 3 H, -OCH3), 3.62 (s, 3 H, -OCH3), 2.00 (s, 3 H, -
NAc), 1.44 - 1.96 (m, 18 H, cyclopentyl and caproic acid protons), 0.94
ppm (J=11.1, 6.4 Hz, 6 H, CH3 leucine protons). HRMS-ESI (m/z): [M +
Na]+ calcd for C38H53N3O8Na: 702.3730, found: 702.3807.
1
19a H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.44 (d, J=11.3 Hz, 1 H),
7.27 (s, 1 H), 6.83 (d, J=11.4 Hz, 1 H), 6.70 (s, 1 H), 3.88 (s, 3 H, -OCH3),
3.87 (s, 3 H, -OCH3), 3.54 (s, 3 H, -OCH3), 1.99 (s, 3 H, -NAc), 0.91 ppm
(dd, J=6.2, 1.2 Hz, 6 H, 2CH3 leucine protons). HRMS-ESI (m/z): [M - H]-
calcd for C33H45N3O8: 610.3134, found: 610.3158.
20b Yield 0.040 g (94%). 1H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.47
(d, J=11.3 Hz, 2 H), 7.28 (s, 1 H), 6.85 (d, J=11.4 Hz, 2 H), 6.73 (s, 2 H),
3.91 (s, 3 H, -OCH3), 3.90 (s, 3 H, -OCH3), 3.57 (s, 3 H, -OCH3), 2.01 (s,
3 H, -NAc), 1.54 - 1.92 (m, 8 H, cyclopentyl protons), 1.33 - 1.53 (m, 8 H,
octanoic acid protons), 0.92 ppm (J=11.1, 6.4 Hz, 6 H, 2CH3 leucine
protons). HRMS-ESI (m/z): [M + Na]+ calcd for C40H57N3O8Na: 730.4038,
found: 730.4071.
20a HRMS-ESI (m/z): [M - H]- calcd for C35H49N3O8: 638.3447, found:
638.3443.
1
21a H NMR (300 MHz, CD3OD δ, ppm, J/Hz): 7.97 - 8.04 (m, J=8.4 Hz,
2 H, aromatic protons), 7.62 - 7.69 (m, J=8.4 Hz, 2 H, aromatic protons),
7.52 (s, 1 H), 7.48 (d, J=10.8 Hz, 1 H), 6.75 (s, 1 H), 3.90 (s, 3 H, -
OCH3), 3.89 (s, 3 H, -OCH3), 3.61 (s, 3 H, -OCH3), 2.00 ppm (s, 3 H, -
NAc), 0.94 ppm (dd, J=6.2, 1.2 Hz, 6 H, 2CH3 leucine protons). HRMS-
ESI (m/z): [M - H]- calcd for C31H41N3O9: 598.2770, found: 598.2762.
Synthesis of 21b: First, to a solution of 4-carboxybenzylaldehyde
(348 mg, 2.25 mmol) in THF (25 mL) was added tosylate salt of
cyclopentyl L-leucinate (5) (890 mg, 2.25 mmol) or chloride of cyclopentyl
L-phenylgycinate (6) (0.581 mg, 2.25 mmol), stirred for 60 min, and then
portion-wise sodium triacetoxyborohydride (1192 mg, 4.5 mmol). The
mixture was stirred for 18 h at RT. Then it was diluted with EtOAc and
dried over MgSO4, filtered and the resulting solution was checked by TLC
again. In the following, the compound was purified by flash column
chromatography and finally dried in vacuo, using a vacuum desiccator for
approximately 24 h. 99 mg (0.3 mmol) of the obtained cyclopentyl N-(4-
Expression and Purification of the Human Carboxylesterase 1.
Human carboxylesterase was expressed in Sf9 insect cells using the
baculovirus expression system. In brief, the coding sequence of hCE1
was amplified from cDNA of HeLa cells and cloned into pFASTBac1
vector by
a PCR-based cloning approach using the primer pair
RF_hCE_FW (CACCATCGGGCGCGGATATGTGGCTCCGTGCCT) and
RF_hCE_REV (GCTGATTATGATCCTCTAGTACTTCTCGACAAGCTA
GTGATGGTGATGGTGATGCAGCTCTATGTGTTCTGTCTGG). E. coli
DH10Bac cells were transformed with the resulting plasmid, pFastBac1-
hCE1, in order to generate recombinant bacmid. The extracted
recombinant bacmid DNA was transfected into Sf9 cells using Cellfectin
transfection reagent (Thermo Fisher Scientific) according to the supplier’s
instruction manual in order to generate recombinant baculoviruses. After
72 h, supernatant was harvested and viral titre was determined by plaque
assay. For expression of hCE1, Sf9 cells were infected with recombinant
baculovirus with a multiplicity of infection (MOI) of 10 and incubated for
72 h at 27°C. After harvesting the cells by centrifugation with 1000 x g for
15 min, cells were lysed by adding lysis buffer (50 mM HEPES, pH 7.5,
150 mM NaCl, 5 mM 2-mercaptoethanol, 0.05% Triton-X-100) and
sonication. Insoluble components were separated by centrifugation at
4°C with 45000 x g for 45 min. The hCE1 protein was subsequently
carboxybenzyl)-L-leucinate
or
105 mg
of
cyclopentyl
N-(4-
carboxybenzyl)-L-phenylglycinate dissolved in 2 mL DCM and added
several drops DMF. Then 22 μL SOCl2 were added and the mixture was
refluxed for 1 h. After this, the solution of 0.058 g 13 in 1 mL of pyridine
was added and the mixture was stirred at RT for 2 h more. The organic
solvent was washed with water and evaporated under reduced pressure
and the water phase extracted three times with 5 mL EtOAc. The extract
was dried over MgSO4, filtered and the resulting solution checked by TLC
again. In the following, the compound was purified by flash column
chromatography and finally dried in vacuo, using a vacuum desiccator for
approximately 24 h.
21b Yield 0.050 g (48%). 1H NMR (300 MHz, CDCl3 δ, ppm, J/Hz): 7.87 -
8.15 (m, 4 H), 7.62 - 7.69 (m, 2 H, aromatic protons), 7.46 - 7.59 (m, 2 H,
aromatic protons), 6.53 - 6.56 (m, 1 H), 3.97 (s, 3 H, -OCH3), 3.94 (s, 3
H), 3.66 (s, 3 H, -OCH3), 2.09 (s, 3 H, -NAc), 1.56 - 1.94 (m, 13 H), 0.91
ppm (dd, J=17.1, 6.5 Hz, 6 H, 2CH3 leucine protons). HRMS-ESI (m/z):
[M + H]+ calcd for C40H49N3O8: 700.3592, found: 700.3835; [M + Na]+
calcd for C40H49N3O8Na: 722.3412 found: 722.3659.
purified
by
Ni-affinity chromatography and size
exclusion
chromatography.
Virus Titre Reduction Assay (Plaque Assay). Huh-7 and Vero E6 cells
were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM)
supplemented with 10% fetal bovine serum, 100 units penicillin G per mL
and 0.1 mg/mL streptomycin (DMEMcplt) at 37°C, 5% CO2 and 95%
relative humidity. For assessing cytotoxicity, 104 Huh-7 cells per well
were seeded into 96-well plates in 50 µL DMEMcplt and incubated
overnight at 37°C. On the next day, the cells were infected with wild type
DENV serotype 2 with a multiplicity of infection (MOI) of 1 in presence of
the respective concentration of the tested compound in triplicates. After
incubation for 48 h at 37°C the medium was harvested, the triplicates
were pooled and stored at -80°C until further usage. 50 µl of fresh
DMEMcplt was added to the cells and cell viability was determined using
Cell-Titer Glo Luminescent Viability Assay (Promega). For measurement
of virus titres by plaque assay, Vero E6 cells were seeded into 24-well
plates with a density of 2.5 x 105 cells per well. After overnight incubation
at 37°C, the cells were infected with the harvested virus supernatant. The
virus containing medium was diluted with DMEMcplt ranging from 10-1 to
10-6 prior to infection. After incubation of the cells with 100 µl of the virus
dilution at 37°C with agitation for 1 h, the medium was removed and 1 mL
of plaque medium was added. After further incubation for 7 days at 37°C
the cells were fixed with 5% (v/v) formaldehyde for 2 h, stained with
General procedure for the synthesis of metabolites (15a, 17a, 19a,
20a, 21a) The metabolites of the studied compounds were synthesized
according to the procedures provided above, but replacing the
cyclopentyl esters of Leu and Phg with tert-butyl esters of the same
amino acids. The obtained tert-butyl derivatives were subjected to
hydrolysis with aqueous phosphoric acid as follows: 0.045 mmol of the
respective tert-butyl ester were dissolved in 3 mL CH2Cl2 and 0.116 mL
of 85% aqueous phosphoric acid were added dropwise at room
temperature. The mixture was vigorously stirred for 3 h and the reaction
checked by HPLC. Then 5 mL of water was added and the mixture was
cooled to 0°C. A saturated solution of NaHCO3 was added slowly to
adjust the pH to 8. The mixture was then extracted with EtOAc. The
combined organic phase was dried over magnesium sulfate and
concentrated in vacuo to obtain the product.
15a HRMS-ESI (m/z): [M - H]- calcd for C31H41N3O8: 582.2821, found:
582.2821.
13
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
crystal violet and plaques were counted. Titre reduction was calculated
compared to a control treated with DMSO alone.
VB is very grateful for a very generous funding under the Georg
Forster Research Fellowship received from the Alexander von
Humboldt Foundation.
Toxicity Assay. Determination of cell viability was performed using the
Cell Titer Blue assay with HeLa or Huh7 cells. All tested compounds
were diluted in a dilution series from 50 µM down to 3.2 nM in a sterile
flat-bottom 96-well plate with a zero compound control. HeLa and Huh7-
cells are cultivated in Dulbecco’s modified Eagle Medium (DMEM). After
splitting, the cells were diluted with DMEM and 5000 HeLa cells or 7000
Huh7 cells were put into each well of the initial plate and incubated for 24
and 72 h at 37°C. After the incubation, the medium was removed with a
vacuum pump and 100 µL of a mixture of 20% Resazurin and 80%
DMEM was aliquoted into the wells. The dye was incubated for 2 h at
37°C. Afterwards, the percentage of cell viability was calculated by the
difference of absorption at 570 nm and 600 nm. CC50 values were
obtained after plotting cell viability versus the logarithmic concentration
and applying a dose-response fit in GraphPad Prism 7.
The authors thankfully acknowledge the technical assistance of
Stephanie Kallis for the ZIKV antiviral assay, Natascha Stefan
for the help in cell culture and Heiko Rudy for the mass spectral
data.
MR thanks Torben LangHeinrich for his assistance in the
synthesis of compound 9a.
Keywords: tubulin ligand, dengue, Zika, combretastatin,
colchicine, prodrug
References:
Hydrolysis of compounds by hCE1. The biochemical assay was
performed in a 96-well U-bottom plate. In assay buffer (20 mM phosphate
pH 7.4 with 40 mM KCl), a 10 mM compound stock solution in DMSO
was diluted to 10 µM. hCE1 solution was added to a final concentration
of 100 nM. The plate was incubated at 37°C for 2 h. Subsequently, the
assay was quenched with the addition of 30 µL acetonitrile per well. The
relative concentration of the compound was then determined by
integration of HPLC signals and compared to a control without enzyme.
In cases where no cleavage was observed in 2 h, the compounds were
incubated for 24 h in order to confirm the lack of cleavage.
[1]
S. Bhatt, P. W. Gething, O. J. Brady, J. P. Messina, A. W. Farlow, C.
L. Moyes, J. M. Drake, J. S. Brownstein, A. G. Hoen, O. Sankoh, et
al., Nature 2013, 496, 504–507.
[2]
J. D. Stanaway, D. S. Shepard, E. A. Undurraga, Y. A. Halasa, L. E.
Coffeng, O. J. Brady, S. I. Hay, N. Bedi, I. M. Bensenor, C. A.
Castañeda-Orjuela, et al., Lancet Infect. Dis. 2016, 16, 712–723.
S. C. Weaver, W. K. Reisen, Antiviral Res. 2010, 85, 328–345.
V. Boldescu, M. A. M. Behnam, N. Vasilakis, C. D. Klein, Nat. Rev.
Drug Discov. 2017, 16, 565–586.
[3]
[4]
Tubulin Polymerization Assay. The assay was performed in a 96-well
flat-bottom plate using a porcine tubulin polymerization assay kit by tebu-
bio GmbH (Germany). To prepare the 5 mg/mL stock solution of tubulin 4
mg of lyophilized tubulin was dissolved in 800 µL of cold "general tubulin
buffer" (GTB, 80 mM PIPES, 0.5 mM EGTA, 2 mM MgCl2, pH 6.9).
100 µM stock solutions of the analysed compounds were prepared by
diluting 0.1 mL of the 10mM DMSO based solution of the compound in
9.9 mL GTB. In each analytical well 80 μL of tubulin solution in GTB,
10 μL 10X compound solution in GTB, 10 μL GTP solution in GTB were
added reaching the respective final concentrations of 4 mg/mL tubulin,
10 µM compound, and 1 mM GTP. In each control well 80 μL of tubulin
solution in GTB, 10 μL of DMSO in GTB (0.1 mL in 9.9 mL), and 10 μL
GTP in GTB were added to yield final concentrations of 4 mg/mL for
tubulin and 1 mM for GTP. Procedure: The plate was incubated at 37°C
for 30 min with added solutions of tubulin and the test compound,
followed by chilling to 0°C to depolymerize formed microtubules.
Subsequently, GTP solution was added. Immediately after the addition of
GTP, the read-out began. For read-out, the absorption at 340 nm and
37°C was measured by a microtiter plate reader (BMG labtech Omega).
[5]
S. H. E. Kaufmann, A. Dorhoi, R. S. Hotchkiss, R. Bartenschlager,
Nat. Rev. Drug Discov. 2018, 17, 35–56.
[6]
[7]
W. MacRae, J. Hudson, G. Towers, Planta Med. 1989, 55, 531–535.
M. Cortese, S. Goellner, E. G. Acosta, C. J. Neufeldt, O. Oleksiuk,
M. Lampe, U. Haselmann, C. Funaya, N. Schieber, P. Ronchi, et al.,
Cell Rep. 2017, 18, 2113–2123.
[8]
M. Satake, R. B. Luftig, J. Gen. Virol. 1982, 58, 339–349.
K. Y. Foo, H. Chee, Biomed Res. Int. 2015, 2015, 1–6.
E. G. Acosta, V. Castilla, E. B. Damonte, J. Gen. Virol. 2008, 89,
474–484.
[9]
[10]
[11]
[12]
M. S. Paingankar, M. D. Gokhale, D. N. Deobagkar, Arch. Virol.
2010, 155, 1453–1461.
W. Chen, N. Gao, J. L. Wang, Y. P. Tian, Z. T. Chen, J. An, Arch.
Virol. 2008, 153, 1777–1781.
[13]
[14]
U. F. Greber, Cell. Mol. Life Sci. 2002, 59, 608–626.
R. Thayan, T. L. Huat, L. L. C. See, N. S. Khairullah, R. Yusof, S.
Devi, Southeast Asian J. Trop. Med. Public Health 2009, 40, 56–65.
E. G. Acosta, V. Castilla, E. B. Damonte, Cell. Microbiol. 2009, 11,
1533–1549.
Molecular modelling studies. Docking simulation study was performed
using Molecular Operating Environment (MOE) C.C.G.I., (2015), 1010
Sherbooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7. The
computational software operated under Windows 8 Pro (64 bit) installed
on a DELL Precision T7610 (v3) Work Station. The X-ray crystallographic
structure of tubulin in a complex with colchicine was obtained from a
protein database via the Internet (http://www.RCSB.org/, PDB code
[15]
[16]
[17]
H. Y. Chee, S. AbuBakar, Biochem. Biophys. Res. Commun. 2004,
320, 11–17.
M. Cortese, S. Goellner, E. G. Acosta, C. J. Neufeldt, O. Oleksiuk,
M. Lampe, U. Haselmann, C. Funaya, N. Schieber, P. Ronchi, et al.,
Cell Rep. 2017, 18, 2113–2123.
4OB2)[58]
. The corresponding structure of combretastatin was also
obtained from the PDB bank, code 1LYJ[25]. The energy of all conformers
was minimized in an automatic mode until the RMSD gradient of
0.01 kcal/mol was achieved, and the mean square distance of 0.1 Å was
calculated with the force field MMFF94X.
[18]
[19]
[20]
B. E. E. Martina, P. Koraka, A. D. M. E. Osterhaus, Clin. Microbiol.
Rev. 2009, 22, 564–581.
S. Blackley, Z. Kou, H. Chen, M. Quinn, R. C. Rose, J. J.
Schlesinger, M. Coppage, X. Jin, J. Virol. 2007, 81, 13325–13334.
V. Boldescu, V. Crudu, N. Sucman, S. Pogrebnoi, M. Zviaghin, E.
Stîngaci, V. Pogrebnoi, F. Macaev, Chem. J. Mold. 2013, 8, 21–31.
M. Hosokawa, Molecules 2008, 13, 412–31.
Acknowledgements
[21]
[22]
L. a Needham, A. H. Davidson, L. J. Bawden, A. Belfield, E. a Bone,
14
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
D. H. Brotherton, S. Bryant, M. H. Charlton, V. L. Clark, S. J. Davies,
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
M.-M. Niu, J. Qin, C. Tian, X. Yan, F.-G. Dong, Z. Cheng, G. Fida, M.
Yang, H. Chen, Y. Gu, Acta Pharmacol. Sin. 2014, 35, 967–979.
U. Yadava, V. K. Yadav, R. K. Yadav, RSC Adv. 2017, 7, 15917–
15925.
et al., J. Pharmacol. Exp. Ther. 2011, 339, 132–42.
M. H. Charlton, D. F. C. Moffat, S. J. Davies, A. Hastings
Drummond, M. Struthers Drummond, Imaging Agents, 2014, US
2014/0010762 A1.
[23]
Y. Wang, H. Zhang, B. Gigant, Y. Yu, Y. Wu, X. Chen, Q. Lai, Z.
Yang, Q. Chen, J. Yang, FEBS J. 2016, 283, 102–111.
B. V. Kumbhar, A. Borogaon, D. Panda, A. Kunwar, PLoS One 2016,
11, e0156048.
[24]
[25]
[26]
[27]
R. B. G. Ravelli, B. Gigant, P. A. Curmi, I. Jourdain, S. Lachkar, A.
Sobel, M. Knossow, Nature 2004, 428, 198–202.
R. Gaspari, A. E. Prota, K. Bargsten, A. Cavalli, M. O. Steinmetz,
Chem 2017, 2, 102–113.
R. I. Ahmed, E. E. A. Osman, F. M. Awadallah, S. M. El-Moghazy, J.
Enzyme Inhib. Med. Chem. 2017, 32, 176–188.
J. A. Woods, J. A. Hadfield, G. R. Pettit, B. W. Fox, A. T. McGown,
Br. J. Cancer 1995, 71, 705–11.
D. D. Li, Y. J. Qin, X. Zhang, Y. Yin, H. L. Zhu, L. G. Zhao, Chem.
Biol. Drug Des. 2015, 86, 731–745.
K. Jaroch, M. Karolak, P. Górski, A. Jaroch, A. Krajewski, A. Ilnicka,
A. Sloderbach, T. Stefański, S. Sobiak, Pharmacol. Reports 2016,
68, 1266–1275.
D. F. Tang-Wai, P. Gros, A. Brossi, L. D. Arnold, Biochemistry 1993,
32, 6470–6476.
[28]
[29]
[30]
[31]
[32]
M. Medarde, A. B. S. Maya, C. Pérez-Melero, J. Enzyme Inhib. Med.
Chem. 2004, 19, 521–40.
S. Bencharit, C. C. Edwards, C. L. Morton, E. L. Howard-Williams, P.
Kuhn, P. M. Potter, M. R. Redinbo, J. Mol. Biol. 2006, 363, 201–214.
T. Fukami, M. Kariya, T. Kurokawa, A. Iida, M. Nakajima, Eur. J.
Pharm. Sci. 2015, 78, 47–53.
R. Mikstacka, T. Stefański, J. Różański, Cell. Mol. Biol. Lett. 2013,
18, 368–97.
G. C. Tron, T. Pirali, G. Sorba, F. Pagliai, S. Busacca, A. A.
Genazzani, J. Med. Chem. 2006, 49, 3033–44.
C. Da, S. L. Mooberry, J. T. Gupton, G. E. Kellogg, J. Med. Chem.
2013, 56, 7382–7395.
S. Casey Laizure, V. Herring, Z. Hu, K. Witbrodt, R. B. Parker,
Pharmacother. J. Hum. Pharmacol. Drug Ther. 2013, 33, 210–222.
C. Liang, M. A. M. Behnam, T. R. Sundermann, C. D. Klein,
Tetrahedron Lett. 2017, 58, 2325–2329.
A. Vandecandelaere, S. R. Martin, P. M. Bayley, M. J. Schilstra,
Biochemistry 1994, 33, 2792–2801.
A. E. Prota, F. Danel, F. Bachmann, K. Bargsten, R. M. Buey, J.
Pohlmann, S. Reinelt, H. Lane, M. O. Steinmetz, J. Mol. Biol. 2014,
426, 1848–60.
[33]
[34]
B. Baguley, L. Zhuang, P. Kestell, Oncol. Res. 1997, 9, 55–60.
J. Fournier-Dit-Chabert, V. Vinader, A. R. Santos, M. Redondo-
Horcajo, A. Dreneau, R. Basak, L. Cosentino, G. Marston, H. Abdel-
Rahman, P. M. Loadman, et al., Bioorganic Med. Chem. Lett. 2012,
22, 7693–7696.
[35]
[36]
[37]
M. Roesner, H.-G. Capraro, A. E. Jacobson, L. Atwell, A. Brossi, M.
A. Iorio, T. H. Williams, R. H. Sik, C. F. Chignell, J. Med. Chem.
1981, 24, 257–261.
A. Huczyński, J. Rutkowski, K. Popiel, E. Maj, J. Wietrzyk, J.
Stefańska, U. Majcher, F. Bartl, Eur. J. Med. Chem. 2014, 90, 296–
301.
Y. B. Malysheva, S. Combes, D. Allegro, V. Peyrot, P. Knochel, A. E.
Gavryushin, A. Y. Fedorov, Bioorg. Med. Chem. 2012, 20, 4271–
4278.
[38]
[39]
[40]
[41]
[42]
N. Yasobu, M. Kitajima, N. Kogure, Y. Shishido, T. Matsuzaki, M.
Nagaoka, H. Takayama, ACS Med. Chem. Lett. 2011, 2, 348–352.
E. O. Esbolaev, N. A. Aitkhozhina, L. A. Aleksandrova, Chem. Nat.
Compd. 1989, 25, 80–83.
Y. L. Garazd, M. M. Garazd, V. G. Kartsev, Chem. Nat. Compd.
2015, 51, 1138–1141.
A. Massarotti, A. Coluccia, R. Silvestri, G. Sorba, A. Brancale,
ChemMedChem 2012, 7, 33–42.
A. Farce, C. Loge, S. Gallet, N. Lebegue, P. Carato, P. Chavatte, P.
Berthelot, D. Lesieur, J. Enzyme Inhib. Med. Chem. 2004, 19, 541–
547.
[43]
O. M. Aly, E. A. Beshr, R. M. Maklad, M. Mustafa, A. M. Gamal-
Eldeen, Arch. Pharm. (Weinheim). 2014, 347, 658–667.
M. Mphahlele, N. Parbhoo, Pharmaceuticals 2018, 11, 59.
M. Zayed, S. Ahmed, S. Ihmaid, H. Ahmed, H. Rateb, S. Ibrahim, Int.
J. Mol. Sci. 2018, 19, 1731.
[44]
[45]
[46]
S. N. Baytas, N. Inceler, A. Yılmaz, A. Olgac, S. Menevse, E.
Banoglu, E. Hamel, R. Bortolozzi, G. Viola, Bioorg. Med. Chem.
2014, 22, 3096–3104.
15
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800641
ChemMedChem
FULL PAPER
Entry for the Table of Contents
Restraining Dengue and Zika Viruses: Inhibitors of tubulin polymerization can disrupt the reproduction cycle of dengue and Zika
viruses, but have limited application due to their high toxicity. We present a series of combretastatin and colchicine prodrugs that are
cleaved by hCE1 which is abundant in infected cells. The prodrugs show decreased toxicity and reduce the dengue and Zika virus
replication at subcytotoxic concentrations.
16
This article is protected by copyright. All rights reserved.