Journal of Agricultural and Food Chemistry
Article
surface display, bacterial spore surface display systems have
been widely used for their resistance to heat, radiation, and
in phosphate buffer at 4 °C without the addition of phenyl-
1
6
methylsulfonyl fluoride (PMSF). The E. coli DH5α strain, used for
the plasmid amplification for nucleotide cloning and sequencing, was
grown in LB medium at 37 °C.
21
chemicals in a harsh environment. Moreover, Bacillus subtilis
is classified as generally recognized as safe (GRAS) by the U.S.
Food and Drug Administration, and its genetic information,
spore structure, and mature genetic manipulation techniques
are established, thus making it an excellent strain for a food-
Activity Assays of the Anchored L-AI. Activity of spore surface-
displayed L-AI was determined at 70 °C, pH 6.5, in 1 mL of 36 g/L of
D-galactose and the washed spore suspension. After a 30 min reaction,
the system was transferred to ice to terminate the reaction.
The generated D-tagatose was first examined using the cysteine-
carbazol-sulfuric acid method, and the absorbance was measured at
22−24
grade surface display system.
In the present study, a surface display system was
constructed based on B. subtilis 168 for the production of D-
tagatose using CotX as an anchoring protein. After active L-AI
was successfully observed on the spore surface of B. subtilis 168
and a higher efficiency to catalyze D-galactose to produce D-
tagatose was exhibited, the potential of using a food-grade
expression system to produce D-tagatose was confirmed. To the
best of our knowledge, this is the first report for D-tagatose
production using anchored L-AI on the spore surface of B.
subtilis 168.
2
9
560 nm. Then, both D-tagatose and D-galactose were analyzed by
high-performance liquid chromatograph (HPLC), using a Rezex
RCM-Monosaccharide Ca2 column at 80 °C with distilled water as
the mobile phase at an elution rate of 0.5 mL/min. The components
+
30
were analyzed with a refractive index detector RI-101. The HPLC
2+
and Rezex RCM-Monosaccharide Ca column were purchased from
Agilent (Wilmington, DE) and Phenomenex (Guangzhou, China).
The standard linear graph prepared with different D-tagatose
concentrations was used to calibrate the generated D-tagatose
concentration from the reaction. One unit of enzyme activity is
defined as the amount of displayed L-AI required to catalyze the
3
0
MATERIALS AND METHODS
production of 1 μmol D-tagatose per min. The number of spores was
■
calculated by direct counting with a Burker chamber under an optical
Chemicals. D-Tagatose (≥99% purity) and D-galactose (≥98%
purity) were purchased from Aladdin Industry Co., Ltd. (Shanghai,
China). Ex-Taq DNA polymerase, restriction enzymes, T4 DNA
ligase, ampicillin, and erythromycin were supplied by Takara
Biotechnology Co., Ltd. (Dalian, China). Trypsin and proteinase K
were purchased from Sigma. All other chemicals were analytical grade.
Plasmid and Strain Construction. To display L-AI on the surface
of B. subtilis 168 spores, we constructed a genetic fusion: cotX-araA.
The DNA fragment with the cotX (GenBank Accession No.
NP_389058) promoter and structure gene from the genome of B.
subtilis 168 was amplified by primers P1 and P2 (Table 1), digested
1
6
microscope.
Examination for the Properties of the Anchored L-AI. To
examine the properties of the anchored L-AI, 30 mL of reaction
mixture in a 250 mL Erlenmeyer flask was used with variations as
follows. The optimization of temperature and pH were conducted with
3
6 g/L of D-galactose and the washed spore suspension from 10 mL of
8
spore fermentation broth (containing about 8.4 × 10 spores) for 30
min. The optimal temperature of the anchored L-AI was analyzed over
the range of 55−90 °C. The effect of the pH on enzyme activity was
determined using the standard assay conditions at 70 °C with sodium
acetate (pH 4.0−6.0), phosphate (pH 6.0−8.0), and Tris-HCl (pH
8
.0−9.0). In addition, the thermal stabilities of spore surface-displayed
Table 1. Oligonucleotides Used In This Study
L-AI were determined by incubating the reaction mixtures at 70, 75,
and 80 °C for 90 min at pH 6.5, and the residual activities were
determined using the standard activity assays every 15 min.
oligonucleotides (forward, 5′ to 3′)
name
GCTCTAGATTACTTTGTCTGCCGACGAGA (Xba I underlined)
P1
P2
Production of D-Tagatose Using the Anchored L-AI. The
optimization of substrate concentration was conducted with D-
galactose at 25, 50, 100, 150, and 200 g/L for 24 h using the washed
spore suspension from 10 mL of spore fermentation broth. The
optimal cell dosage was determined by using the washed spore
suspension prepared from 5, 10, 20, 30, 40, 50, 60, and 70 mL of spore
fermentation broth for 24 h. Sufficient shaking was performed each
time before samples were obtained from the spore fermentation broth.
CCGGTACCGAGGACAAGAGTGATAACTAGGATG (KpnI
underlined)
AGAGGTACCATGCGTAAGATGCAAGATTAC (KpnI underlined)
CCGGAATTCCTACTTGATGTTGATAAAGT (EcoR I underlined)
P3
P4
with Xba I and KpnI, and ligated into pJS700a cloning vector to
25
generate the plasmid pJS700a-cotX. The araA gene (GenBank
Accession No. HM150718) was amplified from the genome of L.
fermentum CGMCC2921 using primers P3 and P4 (Table 1), digested
with KpnI and EcoR I, and cloned into the same restriction
endonuclease sites of plasmid pJS700a-cotX to obtain the plasmid
pJS700a-cotX-araA.
1
0
Finally, 100 mL of reaction mixture (containing about 1.4 × 10
spores) in a 500 mL Erlenmeyer flask was used to determine the
reusability of the spore surface-displayed L-AI in the production of D-
tagatose. The reusability experiments were conducted by recycling the
anchored L-AI for several cycles. The concentrations of D-tagatose and
D-galactose were measured by HPLC. After each biotransformation
batch, the amount of spores was counted, and the activity of the
anchored L-AI was assayed. Subsequently, reaction mixtures were
centrifuged and the sediment was reused for another batch.
The competent cells of B. subtilis 168 were prepared as previously
2
6
described. The cells transformed by chemical transformation
methods were cultured in 3 mL of Luria−Bertani (LB) medium at
3
7 °C and spread onto LB plates containing 4 μg/mL of erythromycin
(
(
Em). Plates were incubated at 37 °C overnight, and Em-resistant
Em ) clones were selected and identified using the amylase activity
r
RESULTS
27
■
assay. To verify the amylase activity of colonies, we stained the
colonies cultivated on LB plates containing 0.1% starch with iodine
potassium iodide solution.
Gene Clone and Construction of Recombinant
Plasmid. To construct the recombinant plasmid, the cotX
gene of the outer coat protein CotX (18.6 kDa) and the araA
gene from L. fermentum CGMCC2921 were amplified
successfully. Then, the cotX and araA genes were ligated into
pJS700a to construct the recombinant plasmid pJS700a-cotX-
araA (Figure 1), which was verified by the digestion method.
DNA sequencing results also demonstrated that a correct
recombinant plasmid pJS700a-cotX-araA was obtained.
Culture Conditions of the Bacterial Strains and the
Purification of Spores. For the formation of spores, B. subtilis 168
was cultivated in Difco-sporulation media (DSM) as described
28
elsewhere. After cultivation in DSM at 37 °C for 24 h, the spores
and sporangial cells of B. subtilis 168 with recombinant plasmids were
harvested by centrifugation and resuspended in 0.1 M sodium
phosphate buffer (pH 6.5). The suspension was treated with 0.5%
lysozyme for 1 h and then centrifuged at 5000 rpm (4470g) for 15
min. After the sediments were washed with 1 M NaCl, 1 M KCl, and
phosphate buffer, the washed spores were obtained and resuspended
Transformation of the Plasmid pJS700a-cotX-araA
and Activity Assays of the Anchored L-AI. The
6
757
dx.doi.org/10.1021/jf501937j | J. Agric. Food Chem. 2014, 62, 6756−6762