1405-69-2

Basic information

• Product Name: AVIDIN
• Synonyms: avidins;AVIDIN, HEN EGG WHITE;AVIDINE;AVIDIN, EGG WHITE;AVIDIN CHICKEN EGG WHITE;AVIDIN;AVIDIN-ACETYL;IMMUNOPURE AVIDIN
• CAS NO: 1405-69-2
• Molecular Formula: n.a.
• Molecular Weight: 0
• EINECS: 215-783-6
• Product Categories: Avidin Reagents;Biotin/Avidin;Supplementary Products;Avidin Biotin MatricesSupplementary Products;Avidin ReagentsPost-Translational Modification;Affinity Chromatography;Affinity ResinsProtein Chromatography;Core Bioreagents;Phosphorylation Analysis;Research Essentials;Resins and Plates;Auxiliary Proteins;Other;Proteins and Derivatives;proteins
• Mol File: 1405-69-2.mol
• Article Data: 0

Chemical Properties

• Appearance: White/lyophilized powder
• Storage Temp.: 2-8°C
• CAS DataBase Reference: AVIDIN(CAS DataBase Reference)
• NIST Chemistry Reference: AVIDIN(1405-69-2)
• EPA Substance Registry System: AVIDIN(1405-69-2)

Safety Data

• Hazard Codes: Xi,Xn
• Statements: 20/21/22-36/37/38
• Safety Statements: 22-24/25-36-26
• WGK Germany: 3
• RTECS: CL1590000
• F: 10-21
• Hazardous Substances Data: 1405-69-2(Hazardous Substances Data)

Usage

Uses

Different sources of media describe the Uses of 1405-69-2 differently. You can refer to the following data:
1. Avidin egg white was used in an assay using functionalized xenon as a biosensor to detect biotin-avidin binding. Egg white was used at 80 nmol.
2. Avidin forms an extremely strong complex with d-biotin (Kd ~ 10-15). This activity has made both avidin and biotin extremely useful labels in immunochemical methods of detection and quantitation.

Definition

A protein occurring in egg white, where it constitutes approximately 0.2% of the total protein. It has the property of combining firmly with biotin and rendering it unavailable to organisms, since proteolytic enzymes do not destroy the avidin–biotin complex. Avidin loses its ability to combine with biotin when subjected to heat; hence cooked egg white does not lead to biotin deficiency.

General Description

Avidin is a homotetrameric glycoprotein found in the egg white of birds, reptiles and amphibians. Each subunit is 16 kDa, singly glycosylated and binds to a molecule of biotin with greater affinity and specificity. Recombinant avidin from corn is similar to avidin from egg white in terms of properties like isoelectric point (pI) and antigenic properties except for the molecular weight. Avidin from corn has low molecular weight than chicken egg-derived avidin. This might be due to less complex glycosylation composition in plants. Commercial production of avidin from corn has certain advantages in terms of availability of greater biomass and avoiding the co-purification of animal virus.

Enzyme inhibitor

This bacteriostatic egg-white glycoprotein (MW = 54.7 kDa; CAS 1405- 69-2; Abs10mg/mL = 15.5 at 282nm) contains four identical subunits, each containing a ultrahigh-affinity binding site (Kd ≈ 10?15 M) for biotin, a coenzyme essential in many carboxylation reactions. The avidin-biotin interaction is among the strongest known noncovalent interactions, making it the constant subject of biophysical inquiry. By binding ~15 μg biotin per mg, avidin (which makes up makes up ~0.05% of total egg protein, or around 1.8 mg/egg) deprives invading microorganisms of this vital coenzyme. Many microorganisms partly by-pass this effect by possessing enzymes that covalently link biotin to e-NH2 groups of active-site lysyl residues within biotin-dependent carboxylases. Upon cooking, biotin-free avidin is fully denatured, thus imparting no effect on those consuming cooked eggs. Applications in Cytology: The avidin-biotin interaction provides a simple and sensitive immunoenzymatic method to localize antigens (Ag) in formalin-fixed tissues, typically involving a biotin-labeled secondary antibody (Ab), followed by the addition of avidin-biotin peroxidase complex, and affording superior results over the use of unlabeled antibodies. The availability of biotin-binding sites in the Ab Ag complex is created by the incubation of a relative excess of avidin with biotin-labeled peroxidase. The oligomeric structure of avidin serves to bridge biotin-labeled peroxidase molecules to biotin-labeled peroxidase molecules. When compared on a mol-for-mol basis, the extreme affinity of avidin-biotin interactions rivals or exceeds that of nearly all known Ab-Ag interactions (See also Streptavidin). Biochemical Applications with Recombinant Fusion Proteins: In Escherichia coli, the biotin carboxy carrier protein (BCCP) is biotinylated by BirA, a biotin ligase that covalently attaches a biotin to the amino group of a lysine residue present within the recognition sequence within BCCP. A minimal biotinylation sequence has been found from screens of combinatorial peptide libraries; this 13-residue peptide (Sequence: GLNDIFEAQKIEW), along with a 13- residue long variant (Sequence: GLNDIFEAQKIEWHE), termed the AviTag?, have been identified as effective in vivo and in vitro substrates for the BirA enzyme. When targets proteins are fused to the AviTag and co-expressed in vivo along with BirA, they can be biotinylated in bacteria, yeast, insect, or mammalian cells. Furthermore, when recombinant proteins are fused to the AviTag and incubated in vitro with purified BirA, they can be biotinylated efficiently on the central lysine residue in the AviTag.

Purification Methods

Avidin is purified by chromatography of an ammonium acetate solution on CM-cellulose [Green Biochem J 101 774 1966]. It is also purified by affinity chromatography on 2-iminobiotin-6-aminohexyl-Sepharose 4B [Orr J Biol Chem 256 761 1981]. Itis a biotin-binding protein.

Synthetic route

avidin + 7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaborane(12)(1-) → 7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaboran(12)(1-)-conjugated avidin

Conditions	Yield
With sodium hydrogencarbonate In water at 20℃; for 20h; pH=8.5; Addition;

avidin + polyethyleneimine → polyehtyleneimine-avidin

Conditions	Yield
conjugation;

avidin + PEG, 20 kDa → PEG-avidin

C33H35N2O7(1+)*Cl(1-) (1079889-34-1) + avidin → avidin modified with 1-{9-[2,6-bis(carboxymethoxy)phenyl]-6-(piperidin-1-yl)-3H-xanthen-3-ylidene}piperidinium chloride

Conditions	Yield
Stage #1: C33H35N2O7(1+)*Cl(1-) With 1-hydroxy-pyrrolidine-2,5-dione; diisopropyl-carbodiimide In N,N-dimethyl-formamide Darkness; Stage #2: avidin With bicarbonate buffer pH=8.3;

cyanine 3 (146397-20-8) + avidin → (Cy 3)-labelled avidin

Conditions	Yield
at 20℃; for 2h; pH=7.4; aq. buffer; Darkness;

6-(6-biotinamidohexanamido)hexanoylferrocene + avidin → 6-(6-biotinamidohexanamido)hexanoylferrocene avidin complex

Conditions	Yield
In methanol at 19℃; for 12h;

5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide + avidin → {5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide}*{avidin}

Conditions	Yield
for 0.00833333h; Irradiation;

Related news

ArticleProtein Motion and Configurations in a Form-Fitting Nanopore: AVIDIN (cas 1405-69-2) in ClyA09/30/2019

We probe the molecular dynamics and states of an avidin protein as it is captured and trapped in a voltage-biased cytolysin A nanopore using time-resolved single-molecule electrical conductance signals. The data for very large numbers of single-molecule events are analyzed and presented by a new...detailed

Interactions between AVIDIN (cas 1405-69-2) and graphene for development of a biosensing platform09/29/2019

Fundamental understanding of interactions at the interface of biological molecules, such as proteins, and nanomaterials is crucial for developing various biocompatible hybrid materials and biosensing platforms. Biosensors comprising of graphene-based conductive nanomaterials offer the advantage ...detailed

Gold nanoparticle aggregation: Colorimetric detection of the interactions between AVIDIN (cas 1405-69-2) and biotin10/01/2019

This paper reported a novel colorimetric assay strategy for avidin and biotin interactions based on terminal protection of the biotinylated single-stranded DNA and the surface plasmon resonance adsorption of gold nanoparticles (AuNPs). In this assay, it was firstly found that biotin-ssDNA specif...detailed

New bioanalytical platform based on the use of AVIDIN (cas 1405-69-2) for the successful exfoliation of multi-walled carbon nanotubes and the robust anchoring of biomolecules. Application for hydrogen peroxide biosensing09/27/2019

We are reporting an innovative building-block for the development of biosensors based on the non-covalent functionalization of multi-walled carbon nanotubes (MWCNTs) with avidin (MWCNTs-avidin). In this work, at variance with previous reports, avidin has the double role of simultaneously being t...detailed

Affinity purification of the AVIDIN (cas 1405-69-2) protein family, based on crystal structures of AVIDIN (cas 1405-69-2)-HABA complexes09/25/2019

Since the importance of the high affinity between avidin and biotin, Kd = 3 × 10−16 M, gained universal recognition, numerous chemical, biological and medical avidin-biotin based applications have been developed. However, in some cases the high affinity may be a disadvantage, as this interactio...detailed