Welcome to LookChem.com Sign In|Join Free
  • or
Avidin, a homotetrameric glycoprotein, is predominantly found in the egg white of birds, reptiles, and amphibians. Each subunit of avidin weighs 16 kDa, is singly glycosylated, and exhibits a high affinity and specificity for binding to a molecule of biotin. Recombinant avidin derived from corn shares similar properties with egg white avidin, such as isoelectric point (pI) and antigenic properties, but has a lower molecular weight due to a less complex glycosylation composition. Avidin's ability to bind biotin with extreme strength makes it a valuable tool in various applications.

1405-69-2

Post Buying Request

1405-69-2 Suppliers

Recommended suppliers

  • Product
  • FOB Price
  • Min.Order
  • Supply Ability
  • Supplier
  • Contact Supplier

1405-69-2 Usage

Uses

Used in Biosensors:
Avidin is used as a component in assays with functionalized xenon as a biosensor to detect biotin-avidin binding. In such applications, egg white avidin is utilized at a concentration of 80 nmol.
Used in Immunochemical Methods:
Avidin's strong complex formation with D-biotin (Kd ~ 10^-15) makes it an extremely useful label in immunochemical methods for detection and quantitation purposes.
Used in Research and Diagnostics:
Due to its high specificity and affinity for biotin, avidin is employed in research and diagnostic applications where the detection or manipulation of biotin-tagged molecules is required.
Used in Drug Delivery Systems:
Avidin's strong binding properties with biotin can be exploited in the development of targeted drug delivery systems, where biotin-avidin interactions can be used to direct therapeutic agents to specific cells or tissues.
Used in the Food Industry:
Avidin's ability to bind biotin tightly can be utilized in the food industry to prevent biotin deficiency caused by the consumption of raw egg white, which contains avidin. Cooking the egg white denatures avidin, allowing biotin to become available for absorption.

Enzyme inhibitor

This bacteriostatic egg-white glycoprotein (MW = 54.7 kDa; CAS 1405- 69-2; Abs10mg/mL = 15.5 at 282nm) contains four identical subunits, each containing a ultrahigh-affinity binding site (Kd ≈ 10?15 M) for biotin, a coenzyme essential in many carboxylation reactions. The avidin-biotin interaction is among the strongest known noncovalent interactions, making it the constant subject of biophysical inquiry. By binding ~15 μg biotin per mg, avidin (which makes up makes up ~0.05% of total egg protein, or around 1.8 mg/egg) deprives invading microorganisms of this vital coenzyme. Many microorganisms partly by-pass this effect by possessing enzymes that covalently link biotin to e-NH2 groups of active-site lysyl residues within biotin-dependent carboxylases. Upon cooking, biotin-free avidin is fully denatured, thus imparting no effect on those consuming cooked eggs. Applications in Cytology: The avidin-biotin interaction provides a simple and sensitive immunoenzymatic method to localize antigens (Ag) in formalin-fixed tissues, typically involving a biotin-labeled secondary antibody (Ab), followed by the addition of avidin-biotin peroxidase complex, and affording superior results over the use of unlabeled antibodies. The availability of biotin-binding sites in the Ab Ag complex is created by the incubation of a relative excess of avidin with biotin-labeled peroxidase. The oligomeric structure of avidin serves to bridge biotin-labeled peroxidase molecules to biotin-labeled peroxidase molecules. When compared on a mol-for-mol basis, the extreme affinity of avidin-biotin interactions rivals or exceeds that of nearly all known Ab-Ag interactions (See also Streptavidin). Biochemical Applications with Recombinant Fusion Proteins: In Escherichia coli, the biotin carboxy carrier protein (BCCP) is biotinylated by BirA, a biotin ligase that covalently attaches a biotin to the amino group of a lysine residue present within the recognition sequence within BCCP. A minimal biotinylation sequence has been found from screens of combinatorial peptide libraries; this 13-residue peptide (Sequence: GLNDIFEAQKIEW), along with a 13- residue long variant (Sequence: GLNDIFEAQKIEWHE), termed the AviTag?, have been identified as effective in vivo and in vitro substrates for the BirA enzyme. When targets proteins are fused to the AviTag and co-expressed in vivo along with BirA, they can be biotinylated in bacteria, yeast, insect, or mammalian cells. Furthermore, when recombinant proteins are fused to the AviTag and incubated in vitro with purified BirA, they can be biotinylated efficiently on the central lysine residue in the AviTag.

Purification Methods

Avidin is purified by chromatography of an ammonium acetate solution on CM-cellulose [Green Biochem J 101 774 1966]. It is also purified by affinity chromatography on 2-iminobiotin-6-aminohexyl-Sepharose 4B [Orr J Biol Chem 256 761 1981]. Itis a biotin-binding protein.

Check Digit Verification of cas no

The CAS Registry Mumber 1405-69-2 includes 7 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 4 digits, 1,4,0 and 5 respectively; the second part has 2 digits, 6 and 9 respectively.
Calculate Digit Verification of CAS Registry Number 1405-69:
(6*1)+(5*4)+(4*0)+(3*5)+(2*6)+(1*9)=62
62 % 10 = 2
So 1405-69-2 is a valid CAS Registry Number.

1405-69-2SDS

SAFETY DATA SHEETS

According to Globally Harmonized System of Classification and Labelling of Chemicals (GHS) - Sixth revised edition

Version: 1.0

Creation Date: Aug 12, 2017

Revision Date: Aug 12, 2017

1.Identification

1.1 GHS Product identifier

Product name Avidin from egg white

1.2 Other means of identification

Product number -
Other names -

1.3 Recommended use of the chemical and restrictions on use

Identified uses For industry use only.
Uses advised against no data available

1.4 Supplier's details

1.5 Emergency phone number

Emergency phone number -
Service hours Monday to Friday, 9am-5pm (Standard time zone: UTC/GMT +8 hours).

More Details:1405-69-2 SDS

1405-69-2Synthetic route

avidin

avidin

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaborane(12)(1-)

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaborane(12)(1-)

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaboran(12)(1-)-conjugated avidin

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaboran(12)(1-)-conjugated avidin

Conditions
ConditionsYield
With sodium hydrogencarbonate In water at 20℃; for 20h; pH=8.5; Addition;
avidin

avidin

polyethyleneimine

polyethyleneimine

polyehtyleneimine-avidin

polyehtyleneimine-avidin

Conditions
ConditionsYield
conjugation;
avidin

avidin

PEG, 20 kDa

PEG, 20 kDa

PEG-avidin

PEG-avidin

C33H35N2O7(1+)*Cl(1-)
1079889-34-1

C33H35N2O7(1+)*Cl(1-)

avidin

avidin

avidin modified with 1-{9-[2,6-bis(carboxymethoxy)phenyl]-6-(piperidin-1-yl)-3H-xanthen-3-ylidene}piperidinium chloride

avidin modified with 1-{9-[2,6-bis(carboxymethoxy)phenyl]-6-(piperidin-1-yl)-3H-xanthen-3-ylidene}piperidinium chloride

Conditions
ConditionsYield
Stage #1: C33H35N2O7(1+)*Cl(1-) With 1-hydroxy-pyrrolidine-2,5-dione; diisopropyl-carbodiimide In N,N-dimethyl-formamide Darkness;
Stage #2: avidin With bicarbonate buffer pH=8.3;
cyanine 3
146397-20-8

cyanine 3

avidin

avidin

(Cy 3)-labelled avidin

(Cy 3)-labelled avidin

Conditions
ConditionsYield
at 20℃; for 2h; pH=7.4; aq. buffer; Darkness;
6-(6-biotinamidohexanamido)hexanoylferrocene

6-(6-biotinamidohexanamido)hexanoylferrocene

avidin

avidin

6-(6-biotinamidohexanamido)hexanoylferrocene avidin complex

6-(6-biotinamidohexanamido)hexanoylferrocene avidin complex

Conditions
ConditionsYield
In methanol at 19℃; for 12h;
5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide

5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide

avidin

avidin

{5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide}*{avidin}

{5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide}*{avidin}

Conditions
ConditionsYield
for 0.00833333h; Irradiation;

1405-69-2Upstream product

1405-69-2Downstream Products

1405-69-2Related news

ArticleProtein Motion and Configurations in a Form-Fitting Nanopore: AVIDIN (cas 1405-69-2) in ClyA09/30/2019

We probe the molecular dynamics and states of an avidin protein as it is captured and trapped in a voltage-biased cytolysin A nanopore using time-resolved single-molecule electrical conductance signals. The data for very large numbers of single-molecule events are analyzed and presented by a new...detailed

Interactions between AVIDIN (cas 1405-69-2) and graphene for development of a biosensing platform09/29/2019

Fundamental understanding of interactions at the interface of biological molecules, such as proteins, and nanomaterials is crucial for developing various biocompatible hybrid materials and biosensing platforms. Biosensors comprising of graphene-based conductive nanomaterials offer the advantage ...detailed

Gold nanoparticle aggregation: Colorimetric detection of the interactions between AVIDIN (cas 1405-69-2) and biotin10/01/2019

This paper reported a novel colorimetric assay strategy for avidin and biotin interactions based on terminal protection of the biotinylated single-stranded DNA and the surface plasmon resonance adsorption of gold nanoparticles (AuNPs). In this assay, it was firstly found that biotin-ssDNA specif...detailed

New bioanalytical platform based on the use of AVIDIN (cas 1405-69-2) for the successful exfoliation of multi-walled carbon nanotubes and the robust anchoring of biomolecules. Application for hydrogen peroxide biosensing09/27/2019

We are reporting an innovative building-block for the development of biosensors based on the non-covalent functionalization of multi-walled carbon nanotubes (MWCNTs) with avidin (MWCNTs-avidin). In this work, at variance with previous reports, avidin has the double role of simultaneously being t...detailed

Affinity purification of the AVIDIN (cas 1405-69-2) protein family, based on crystal structures of AVIDIN (cas 1405-69-2)-HABA complexes09/25/2019

Since the importance of the high affinity between avidin and biotin, Kd = 3 × 10−16 M, gained universal recognition, numerous chemical, biological and medical avidin-biotin based applications have been developed. However, in some cases the high affinity may be a disadvantage, as this interactio...detailed

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1 Customer Service

What can I do for you?
Get Best Price

Get Best Price for 1405-69-2