Welcome to LookChem.com Sign In|Join Free
  • or
Home > Pharmaceutical > 1405 > 

1405-69-2

Basic Information
CAS No.: 1405-69-2
Name: Avidins
Molecular Structure:
Molecular Structure of 1405-69-2 (Avidins)
Formula: n.a.
Molecular Weight: 0
Synonyms: Avidin;Glycoproteins, specific or class, avidins; LumAvidin; Neutralite Avidin
EINECS: 215-783-6
Density: N/A
Melting Point: N/A
Boiling Point: N/A
Flash Point: N/A
Solubility: N/A
Appearance: lyophilized powder
Hazard Symbols:
Risk Codes: 20/21/22-36/37/38
Safety: Experimental reproductive effects. When heated to decomposition it emits acrid smoke and irritating vapors.
Transport Information: N/A
PSA: 0.00000
LogP: 0.00000
Synthetic route
avidin

avidin

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaborane(12)(1-)

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaborane(12)(1-)

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaboran(12)(1-)-conjugated avidin

7-{3-[(3-isothiocyanatophenyl)amino]-3-oxopropyl}-7,8-dicarba-nido-undecaboran(12)(1-)-conjugated avidin

Conditions
ConditionsYield
With sodium hydrogencarbonate In water at 20℃; for 20h; pH=8.5; Addition;
avidin

avidin

polyethyleneimine

polyethyleneimine

polyehtyleneimine-avidin

polyehtyleneimine-avidin

Conditions
ConditionsYield
conjugation;
avidin

avidin

PEG, 20 kDa

PEG, 20 kDa

PEG-avidin

PEG-avidin

1079889-34-1

C33H35N2O7(1+)*Cl(1-)

avidin

avidin

avidin modified with 1-{9-[2,6-bis(carboxymethoxy)phenyl]-6-(piperidin-1-yl)-3H-xanthen-3-ylidene}piperidinium chloride

avidin modified with 1-{9-[2,6-bis(carboxymethoxy)phenyl]-6-(piperidin-1-yl)-3H-xanthen-3-ylidene}piperidinium chloride

Conditions
ConditionsYield
Stage #1: C33H35N2O7(1+)*Cl(1-) With 1-hydroxy-pyrrolidine-2,5-dione; diisopropyl-carbodiimide In N,N-dimethyl-formamide Darkness;
Stage #2: avidin With bicarbonate buffer pH=8.3;
146397-20-8

cyanine 3

avidin

avidin

(Cy 3)-labelled avidin

(Cy 3)-labelled avidin

Conditions
ConditionsYield
at 20℃; for 2h; pH=7.4; aq. buffer; Darkness;

6-(6-biotinamidohexanamido)hexanoylferrocene

avidin

avidin

6-(6-biotinamidohexanamido)hexanoylferrocene avidin complex

6-(6-biotinamidohexanamido)hexanoylferrocene avidin complex

Conditions
ConditionsYield
In methanol at 19℃; for 12h;
5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide

5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide

avidin

avidin

{5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide}*{avidin}

{5'-desthiobiotin-d(CTGAATTCTCCCGAAAGTAAGCTTAGATAGGCGAGAATTCAG)-3'-NHCOC6H4-4-azide}*{avidin}

Conditions
ConditionsYield
for 0.00833333h; Irradiation;
  • Display:default sort

    New supplier

  • TIANFU-CHEM AVIDIN 1405-69-2

  • Casno:

    1405-69-2

    TIANFU-CHEM AVIDIN 1405-69-2

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 0.0-0.0/Kilogram

    AVIDIN Basic information Product Name: AVIDIN Synonyms: avidins;AVIDIN, HEN EGG WHITE;AVIDINE;AVIDIN, EGG WHITE;AVIDIN CHICKEN EGG WHITE;AVIDIN;AVIDIN-ACETYL;IMMUNO

    Our company engages in Electronic chemicals such as OLED,Photoresist chemical,Electrolyte additive and Intermediate Pharmaceutical production; development of noble metal catalysts,

  •  Henan Tianfu Chemical Co., Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:86-371-55170693/55170694

    Address:Zhengzhou International Trade New Territory,Jinshui District,Zhengzhou ,China

       Inquiry Now

  • Factory direct supply CAS 1405-69-2 with best quality

  • Casno:

    1405-69-2

    Factory direct supply CAS 1405-69-2 with best quality

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 139.0-210.0/Kilogram

    WITH US,YOUR MONEY IN SAFE,YOUR BUSINESS IN SAFE 1)Quick Response Within 12 hours; 2)Quality Guarantee: All products are strictly tested by our QC, confirmed by QA and approved by third party lab in China, USA, Canada, Germany, UK, Italy, France et

    Zhuo Zhou Wen Xi Import and Export Co., Ltd. is a company mainly engaged in the export of pharmaceutical raw materials. Its parent company is (Wen Xi Pharma), including three subs

  •  Zhuozhou Wenxi import and Export Co., Ltd

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86-13111626072

    Address:Room 1710, Baoxin International Phase I, 19 Guanyun East Road, Zhuozhou, Hebei

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Chemwill Asia co.,Ltd is one of the leading manufacturer in CHINA.Our main production base is located in Xuzhou industry park. We produce a wide range of organics including Active pharmaceutical ingredients(APIs), Veterinary, Indole derivatives, Aro

    Our main production base is located in Xuzhou industry park. We produce a wide range of organics including Fine chemicals, Active pharmaceutical ingredients(APIs), Veterinary, In

  •  Chemwill Asia Co., Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Manufacturers

    Tel:021-51086038

    Address:High-Tech Industrial park,Chemical Economical Development Zone,Xuzhou, Jiangsu-Province, P.R.China

       Inquiry Now

  • Avidins

  • Casno:

    1405-69-2

    Avidins

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Henan Wentao Chemical Product Co.,Ltd is Located in Zhengzhou High-tech Development Zone with import and export license, We passed ISO 9001:2008 as well, Henan Wentao has developed more than 1000 compounds, which are widely used in the fields of prod

    The company is Located in Zhengzhou High-tech Development Zone with import and export license, We passed ISO 9001:2008 as well, Henan Wentao has developed more than 1000 compounds,

  •  Henan Wentao Chemical Product Co., Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:+86-370-2722992

    Address:32 Room, 5th Floor, Building 11, No. 6 Yinxing Road, High-tech Industrial Development Zone, Zhengzhou City, Henan Province

       Inquiry Now

  • Avidins

  • Casno:

    1405-69-2

    Avidins

    Min.Order: 1 Gram

    FOB Price:  USD $ 0.0-0.0/Gram

    1.In No Less 10 years exporting experience. you can 100% received goods 2.Lower Price with higher quality 3,Free sample 4,We are sincerely responsible for the "product quality" and "After Service" Upbio is Specializ

    Shanghai Upbio Tech Co.,Ltd (Former Onchem (China)Co.,Ltd) is a comprehensive manufacturer and an international distribution of chemicals throughout the world, The predecessor of

  •  Shanghai Upbio Tech Co.,Ltd

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:+86-21-52196435

    Address:No.2 Floor,No.979 Yunhan Rd,Nicheng,Pudong New Area,Shanghai,China

       Inquiry Now

  • High Purity Avidin Cas No: 1405-69-2

  • Casno:

    1405-69-2

    MSDS/COA Download

    High Purity Avidin Cas No: 1405-69-2

    Min.Order: 10 Gram

    FOB Price:  USD $ 1.0-3.0/Gram

    Our Service: 1. Best quality in your requirement 2. Competitive price in china market 3. Mature technical support 4. Professional logistic support 5 . Full experience of large numberscontainers loading in chinese sea port 6 .Fast

    Wuhan Monad Medicine Tech Co.,LTD is a research and development, production, sales in one high-tech company, own about 100 kinds of products, can provide about more than 30000 kind

  •  Wuhan Monad Medicine Tech Co.,LTD

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+8618771942761

    Address:13th Floor, Tower B, Century Plaza, Zhongnan Road, Wuchang District, Wuhan, China.

       Inquiry Now

  • Avidins

  • Casno:

    1405-69-2

    Avidins

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 0.0-0.0/Kilogram

    Hello, dear friend! I'm Hansen and Allen from China. Welcome to my lookchem mall! The following is a brief introduction of our company's products and services. If you are interested in our products, please contact us by emai

    Shandong Hanjiang Chemical Co., Ltd. is located in Qilu Petrochemical Industrial Park, Zibo City, Shandong Province, involving pesticide, medicine, chemical industry, coating, dy

  •  Shandong Hanjiang Chemical Co., Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:18369939125

    Address:95A, Xingyuan East Road, Zhangdian District

       Inquiry Now

  • AVIDIN CAS NO.1405-69-2 CAS NO.1405-69-2

  • Casno:

    1405-69-2

    AVIDIN CAS NO.1405-69-2 CAS NO.1405-69-2

    Min.Order: 1 Gram

    FOB Price:  USD $ 0.0-0.0/Gram

    1.place of origin china with super quality by reasonable price. 2. it's customers' right to choose the package (ems, dhl, fedex, ups); 3. it's customers' right to choose the packing way for his produccts from many recent

    Hebei Guanlang Biotechnology Co., Ltd. belongs to Guanlang Group,which was founded in 2007 , located in Shijiazhuang city which is the capital of Hebei Province and hub sector amon

  •  Hebei Guanlang Biotechnology Co., Ltd.

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+8619930503256

    Address:No.66, Yuhua West Road

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 100.0-100.0/Kilogram

    HangYu Chemical is a leading manufacturer and supplier of chemicals in China. We develop produce and distribute high quality pharmaceuticals, intermediates, special chemicals and OLED intermediates and other fine chemicals. HangYu Chemical consis

    Zibo HangYu Chemical is a leading manufacturer and supplier of chemicals in China. We develop produce and distribute high quality pharmaceuticals, intermediates, special chemicals

  •  Zibo Hangyu Import&Export Co., Ltd

    China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:86-15988566987

    Address:Room1701, Tianxing Building,Licheng district, jinan, Shandong, China

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    MSDS/COA Download

    Avidin

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 0.0-0.0/Kilogram

    High quality, competitive price, fast delivery and first-class service we possesses have won the trust and praise of customers. Standard: BP/USP/EP The purity is equal or greater than 99%. As a supplier, we can provide high-quality products. Clearan

    Our company was established in May,2022, Changchun Weiersi Import and Export trade Co., Ltd, a professional manufacturer and exporter that is concerned with the design, development

  •  CHANGCHUN WEIERSI IMPORT AND EXPORT TRADE CO.,LTD

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86-431-80606858

    Address:547#West Min Zhu Street,Chaoyang District,Changchun City,Jilin Province,China

       Inquiry Now

  • Avidin(chikeneggwhite)

  • Casno:

    1405-69-2

    Avidin(chikeneggwhite)

    Min.Order: 1 Milligram

    FOB Price:  USD $ 0.0-0.0/Milligram

    GMP standard, high purity, competitive price, in stock 1. Quick Response: within 6 hours after receiving your email. 2. Quality Guarantee: All products are strictly tested by our QC, confirmed by QA, and approved by a third-party lab in China, USA,

  •  Xiamen Jenny Chemical Technology Co., Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86

    Address:xiameng

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 0.0-0.0/Kilogram

    1, High quality with competitive price: 2, Fast and safe delivery 3.Excellent pre-sales and after-sales service 4. Well-trained and professional technologist and sales with rich experience in the field Appearance:see detailed specifications Sto

    Hangzhou Clap Technology Co., Ltd is a leading manufacturer and supplier of API, Pharma intermediates, organic and inorganic compounds, rare earth, pesticide, raw drugs, fine chemi

  •  HANGZHOU CLAP TECHNOLOGY CO,.LTD

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:86-571-56972507

    Address:Room 4198,Floor 4,No.4,ShanXian Road XiaCheng District,HangZhou city,ZheJiang province,China

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Appearance:95%+ Package:R&D,Pilot run Transportation:per client require Port:Express ,Air, Sea

    Hunan chemfish Pharmaceutical co.,Ltd.located in Lugu High-tech industral park ,Hunan province . with its own R&D center and more than 10000㎡manufacture plant . Chemfish owns

  •  Hunan chemfish Pharmaceutical co.,Ltd

     China (Mainland)  |  Contact Details

    Business Type:Manufacturers

    Tel:0731-85567275

    Address:No.10048, xiangjiang centry bulding ,kaifu district ,changsha city ,Hunan

       Inquiry Now

  • AVIDIN 1405-69-2  CAS NO.1405-69-2

  • Casno:

    1405-69-2

    AVIDIN 1405-69-2 CAS NO.1405-69-2

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Price, service, company and transport advantage: 1.Best service, high quality and reasonable price. 2. It's customers' right to choose the package (EMS, DHL, FEDEX, UPS). ? 3. It's customers' right to choose the packing way for his products fro

    Changchun Haofei Import and Export Trade Co. , Ltd is located in Changchun, Changchun, Jilin Province. We are a modern high-tech private enterprise specializing in the R & D, Produ

  •  Jilin haofei import and export trade Co.,Ltd

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+8615643102578

    Address:Guanghui Park, Huanghe Road, Kuancheng District

       Inquiry Now

  • Avidin(chiken egg white)

  • Casno:

    1405-69-2

    Avidin(chiken egg white)

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    ISO/factory/goodqualityAppearance:off white Storage:Dry,cool place Package:drum Application:active pharmaceutical ingredients Transportation:by air/sea/express Port:shenzhen/shanghai

    Wuhan Vanz Pharm Inc. is a manufacturer&trading company.

  •  Hubei Vanz Pharm Co.,Ltd

     China (Mainland)  |  Contact Details

    Business Type:Manufacturers

    Tel:86-27-84492310

    Address:FANHU INDUSTRY PARK

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Lower price, sample is available,SDS test documents are available,large stock in warehouseAppearance:White powder Storage:Sealed and preserved Package:200/Kilograms Application:Fine chemical intermediates, used as the main raw material for the synthe

    GIHI CHEMICALS CO.,LIMITED, its former company is a small manufacturer who is specialized in the production of ester products which are used in the daily chemicals ,cosmetic produc

  •  GIHI CHEMICALS CO.,LIMITED

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:+86-571-86217390

    Address:No.567 Dengcai Street,Sandun,Westlake District,Hangzhou310030,Zhejiang,China.

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    TAIHO Unique Advantages:1.We're factory2.Free samples available3.Commodity inspection can be done4.ISO9001,Kosher certifications5.10 years experiences Storage:Store in cool &dry place Package:aluminium foil bag/fiber can/plastic drum Application:comp

    As a member of TAIHO Group,Hubei Taiho Chemical Co.,Ltd,is a professional new-type chemicals enterprise combined into research and development,production and sales.We adhere to the

  •  Hubei Taiho Chemical Co.,LTD

     China (Mainland)  |  Contact Details

    Business Type:Manufacturers

    Tel:+86-18120399543

    Address:No. 49 taifeng Road,Qianjiang City,Hubei,China

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Shanghai, Run-Biotech Co., Ltd is a leading domestic pharmaceutical, biopharmaceutical, and health care products R & D outsourcing services company. As an innovation-driven and customer-focused company, Run Biotech provides a broad and integrated por

    Dine products include organic reagents, inorganic reagents and biochemical reagents, including pharmaceutical intermediates, bulk drugs, catalysts, high purity solvents, specialty

  •  Shanghai Run-Biotech Co., Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86-21-57171705 / 57171706

    Address:No.787, Kangqiao Road, Pudong New District, Shanghai, China

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    FINETECH INDUSTRY LIMITED is a LONDON based CRO company providing drug discovery & development services to worldwide clients. FINETECH INDUSTRY LIMITED supplies the AVIDIN, CAS:1405-69-2 with the most competitive price and the best quality. We can of

    Finetech Industry Limited is a company in England,which specializing in developing, manufacturing and marketing fine organic compounds and intermediates for the fine chemical and p

  •  Finetech Industry Limited

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:86-27-87465837

    Address:wuhan

       Inquiry Now

  • Avidins

  • Casno:

    1405-69-2

    Avidins

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Ansciep Chemical is a professional enterprise manufacturing and distributing fine chemicals and speciality chemicals. We have been dedicated to heterocycle compounds and phenyl rings for tens of years. This is our mature product for export. Our quali

    Antimex Chemical Limied, was founded in 2001, we are specializing in manufacturing & researching of Active pharmaceutical Ingredients,Veterinary pharm APIs,cosmetic ingredients,and

  •  Antimex Chemical Limied

    China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:0086-21-50563169

    Address:Room1027,No.Jinyu Road,Pudong

       Inquiry Now

  • Avidin 1405-69-2

  • Casno:

    1405-69-2

    Avidin 1405-69-2

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    high purity lowest priceAppearance:solid or liquid Storage:in sealed air resistant place Package:Foil bag; Drum; Plastic bottle Application:Pharma;Industry;Agricultural Transportation:by sea or air Port:any port in China

    Russell Chemicals Technology Co.,Ltd is a new-tech research and development enterprise dedicated to providing high-value-added auxiliaries,such as photoinitiators monomers and olig

  •  Hunan Russell Chemicals Technology Co.,Ltd

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:0086-731-85415356

    Address:Buiding4,Lugu Enterprise Plaza, Yuelu Distric

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    We are committed to providing our customers with the best products and services at the most competitive prices.Appearance:yellowis to white powder Storage:Room temperature with sealed well Package:according to the clients requirement Application:Use

    BOC Sciences is a brand of BOCSCI Inc. We leverage our wide spectrum of business in the fields of development, manufacturing, marketing, and distribution to help you make best-info

  •  BOC Sciences

    United States  |  Contact Details

    Business Type:Trading Company

    Tel:1-631-485-4226

    Address:Ramsey Road

       Inquiry Now

  • CSR1608-521

  • Casno:

    1405-69-2

    CSR1608-521

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Capacity, Prompt shipment Application:surface active agent

    Skyrun Industrial Co.Limited (CSR Ind), established in 2003, a state-controlled company(By Skyrun Corp. & High Hope) in China, specializing in developing, producing and handing ra

  •  Skyrun Industrial Co.,Ltd

    China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:0086-576-84610586

    Address:Chemical Development Zone

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    AVIDINAppearance:white crystalline powder Storage:Store in dry, dark and ventilated place Package:25KG drum Application:pharmaceutical intermediate Transportation:by air, by sea, by express

    Welcome to Hangzhou Fandachem Co.,Ltd (www.FandaChem.com) Hangzhou Fandachem Co.,Ltd (Fandachem),an experienced and professional China-based Fine Chemical supplier. We supply the

  •  Hangzhou Fandachem Co.,Ltd

    China (Mainland)  |  Contact Details

    Business Type:Other

    Tel:+86-571-28800458

    Address:Room 5010, No.9 YanAn Road,Hangzhou,Zhejiang,China

       Inquiry Now

  • avidin

  • Casno:

    1405-69-2

    avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Best quality with low priceAppearance:lyophilized powder Storage:ln stock Package:25kg/Barrel Application:Chemicals Transportation:Express/Sea/Air Port:Shanghai

    Sartort Biopharma is a leading company engaging in the production of Intermediates, fine chemicals, Ionic liquids and 3D printing materials. It has such controlled subsidiaries as

  •  Hangzhou Sartort Biopharma Co., Ltd

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:86-571-28069376

    Address:914-915, Bldg. 16, No. 57, Tech Park Road, Baiyang Street, Economic And Technological Development Zone

       Inquiry Now

  • Avidin from egg white

  • Casno:

    1405-69-2

    Avidin from egg white

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    *stable and better quality products*efficient and meticulous servicesAppearance:Powder Storage:Store in dry, cool and ventilated place Package:10G/bottle 1kg/tin 5kg/tin 25kg/carton Application:Biology reagent Transportation:By sea By air By courier

    ASURE BIOCHEM Co., Ltd was established in March 2016. It is located in Hangzhou, a very beautiful city. It is a comprehensive chemical service provider with business scope coverin

  •  Asure Biochem CO.,LTD.

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:15068760982

    Address:hangzhou

       Inquiry Now

  • 1405-69-2

  • Casno:

    1405-69-2

    1405-69-2

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Good Quality Package:1kg/bag Application:Medical or chemical Transportation:Air/Train/Sea Port:Shenzhen

    Hebei Bester Biological Technology Co., Ltd. is a modern advanced enterprise specializing in production and exportation of APIs, Pharmaceutical intermediates, peptides, plant extra

  •  Hebei Bester Biological Technology Co. LTD

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+8618633020931

    Address:No.114,Zhonghua South Street,Qiaoxi District

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Prime Molecular Co., Ltd. is a high-tech enterprise providing comprehensive customer service for pharmaceutical companies at home and abroad in accordance with international standards. Two R&D centers and two production sites in China, all well-equip

    Prime Molecular Co., Ltd. is an advanced chemical intermediates manufacture with ?two R&D centers and two production sites in China, all well-equipped with dedicated and profession

  •  PRIME MOLECULAR CO.,LIMITED

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:0852-95636137

    Address:Hong Kong

       Inquiry Now

  • Avidin(chiken egg white) manufacturer

  • Casno:

    1405-69-2

    Avidin(chiken egg white) manufacturer

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Known for its best quality and competitve price, this chemicals we offered is widely appreciated by our customers.Appearance:White powder Storage:keep sealed and keep from direct light Package:According client's requirements Application:pharmaceutica

    Shanghai Yuanye Bio-Technology Co., Ltd. is a comprehensive enterprise of life science, specializing in the research, development and sales of biochemical reagents, analytical stan

  •  Shanghai Yuanye Bio-Technology Co., Ltd.

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86-21-67811725

    Address:Building 6, No. 465, Changta Road,Songjiang District,Shanghai,China

       Inquiry Now

  • Avidin 1405-69-2

  • Casno:

    1405-69-2

    Avidin 1405-69-2

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    high purity lowest priceAppearance:solid or liquid Storage:in sealed air resistant place Package:Foil bag; Drum; Plastic bottle Application:Pharma;Industry;Agricultural Transportation:by sea or air Port:any port in China

    Shenzhen Foris Technology Co.LTD is located in Shenzhen ,Guangdong, is the leading supplier for electronic chemicals,APIs, pharmaceutical intermediates, fine chemicals which can be

  •  Shenzhen Foris Technology Co. LTD

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:+86 15889746615

    Address:BuildingA7, KingloryTongxin International Industry Park, Wanglei Avenue, Hi-tec District

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    high-purity Application:intermediate

    Company specializing in the production and development: acid dyes, basic dyes, direct dyes, solvent dyes, metal complex dyes, organic pigments, mordant dyes, disperse dyes, pen and

  •  Huayang chemical Co., LTD

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86-18653358619

    Address:zibo

       Inquiry Now

  • Avidin

  • Casno:

    1405-69-2

    Avidin

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Best Seller, High Quality, Competitive Price, Fast Delivery, Quick ResponseAppearance:powder, or liquid Storage:Stored in room temperature, ventilated place Package:Bottle, barrel, cargo, container, etc. Application:Pharmaceuticals, intermediates, AP

  •  LEAP CHEM Co., Ltd.

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:0571-87317139

    Address:hangzhou

       Inquiry Now

  • Avidin from egg white

  • Casno:

    1405-69-2

    Avidin from egg white

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    We have our own laboratory factory, familiar with the production process, preferential price and stock Package:25g Application:Medicine or biology

    北京谨明生物科技有限公司 联系电话: 15801484223;18511084608 联系传真: - Email: yvhfjjp@163.com 网址: www.chemicalbook.com/ShowSupplierProductsList19924/0.htm BOOK1

  •  Beijing Jin Ming Biotechnology Co., Ltd.

    China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:15801484223;18511084608

    Address:Beijing

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 0.0-0.0/Kilogram

    Henan Sunlake Enterprise Corporation is located in Henan Province , the central plain of China , which enjoys favorable geogeaphical position and convenient transportion. The compa

  • HENAN SUNLAKE ENTERPRISE CORPORATION

     China (Mainland)  |  Contact Details

    Business Type:Trading Company

    Tel:+86-371- 86259723

    Address:Mingmen International Center, NO.222 Dongming Road,Zhengzhou,Henan,China

       Inquiry Now

  • AVIDIN

  • Casno:

    1405-69-2

    AVIDIN

    Min.Order: 1 Metric Ton

    FOB Price:  USD $ 0.0-0.0/Metric Ton

    Anyang General Chemical Co., Ltd. is a modern and comprehensive enterprise, subordinated to AGICO GROUP, engaged in the research, development and manufacture of chemicals. As a professional chemical company, we devote to the development, production

    Anyang General Chemical Co., Ltd. is a modern and comprehensive enterprise, subordinated to AGICO GROUP, engaged in the research, development and manufacture of chemicals. As a pro

  • Anyang General Chemical Co.,Ltd.

     China (Mainland)  |  Contact Details

    Business Type:Other

    Tel:+86-372-5086905

    Address:19/F,Unit 1, BLD C-3,Haitian City Plaza,Wenfeng Rd.,

       Inquiry Now

  • Avidin(chiken egg white) manufacturer

  • Casno:

    1405-69-2

    Avidin(chiken egg white) manufacturer

    Min.Order: 0

    FOB Price:  USD $ 0.0-0.0/

    Known for its best quality and competitve price, this chemicals we offered is widely appreciated by our customers. Our advantages:1, High quality with competitive price:1) Standard:BP/USP/EP/Enterprise standard2) All Purity≥99%3) We are manufacturer

    Shaanxi Mingqi Chemical Co., Ltd is committed to the development of import and export trade in the production, operation and plant extracts of pharmaceutical raw materials and inte

  • Shaanxi Mingqi Chemical Co., Ltd

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:+8618092428356

    Address:Weiyang District

       Inquiry Now

  • Avidin 1405-69-2

  • Casno:

    1405-69-2

    Avidin 1405-69-2

    Min.Order: 1 Kilogram

    FOB Price:  USD $ 0.0-0.0/Kilogram

    1.high purity 2.consistent quality 3.competitive price 4.Fast Shipping Appearance:Showed in specifications Storage:Store in cool & dry place Package:according to the clients requirement Application:Pharmaceutic

    Shaanxi wuzhiyuan biological technology Co., Ltd is committed to the development of import and export trade in the production, operation and plant extracts of pharmaceutical r

  • Shaanxi WuZhiYuan Biological Technology Co.,Ltd

     China (Mainland)  |  Contact Details

    Business Type:Other

    Tel:+86 18791979989

    Address:No24.west fengming road,fengming town,qishan county

       Inquiry Now

  • Avidin(chiken egg white) 1405-69-2 supplier

  • Casno:

    1405-69-2

    Avidin(chiken egg white) 1405-69-2 supplier

    Min.Order: 1 Milligram

    FOB Price:  USD $ 0.0-0.0/Milligram

    Nanjing Sunsure Chemical Technology Co., Ltd., established in 2009, has expanded a compositive entity from initially only as a small manufacturer. The company dedicated to the development, production and marketing of chemicals. Sunsure covers whole

    Nanjing Sunsure Chemical Technology Co., Ltd., established in 2009, has expanded a compositive entity from initially only as a small manufacturer. The company dedicated to the deve

  • Nanjing Sunsure Chemical Technology Co., Ltd

     China (Mainland)  |  Contact Details

    Business Type:Lab/Research institutions

    Tel:+86-025-58535435

    Address:Southeast University Science Park(SEUSP) Gaoxin, Nanjing, Jiangsu 210032, China

       Inquiry Now

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1

What can I do for you?
Get Best Price

Get Best Price for 1405-69-2

Chemistry

Product Name: Avidin 
EINECS of Avidin (CAS NO.1405-69-2): 215-783-6
Storage temp: 2-8°C
Form: Lyophilized powder
Product categories of Avidin (CAS NO.1405-69-2): Supplementary Products;Avidin Biotin Matrices;Affinity Chromatography;Core Bioreagents;Phosphorylation Analysis;Research Essentials;Auxiliary Proteins;Proteins and Derivatives;Resins and Plates  

Toxicity Data With Reference

1.    

orl-mus TDLo:50 mg/kg (female 1-18D post):REP

    TJADAB    Teratology, A Journal of Abnormal Development. 30 (1984),91.

Safety Profile

Experimental reproductive effects. When heated to decomposition it emits acrid smoke and irritating vapors.
Hazard Codes: Xi,Xn
Risk Statements:
20:  Harmful by inhalation
21:  Harmful in contact with skin
22:  Harmful if swallowed 
36:  Irritating to the eyes
37:  Irritating to the respiratory system
38:  Irritating to the skin
Safety Statements:
22:  Do not breathe dust
24:  Avoid contact with skin
25:  Avoid contact with eyes
26:  In case of contact with eyes, rinse immediately with plenty of water and seek medical advice
36:  Wear suitable protective clothing

Specification

 Avidin ,its cas register number is 1405-69-2. Avidin (CAS NO.1405-69-2) also can be called Glycoproteins, avidins and Avidins .