140613-56-5

Upstream product

• 124482-92-4 2-cyanoethyl-N,N-(diisopropylamino)chlorophosphine 
• 81144-43-6 5'-O-(p,p'-dimethoxytrityl)-2'-deoxyguanosine 
• 129452-89-7 N-(9-{(2R,4S,5R)-5-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-tetrahydro-furan-2-yl}-6-oxo-6,9-dihydro-1H-purin-2-yl)-2-(tert-butyl-diphenyl-silanyloxymethyl)-benzamide 
• 139036-62-7 2-(tert-Butyl-diphenyl-silanyloxymethyl)-N-[9-((2R,4S,5R)-4-hydroxy-5-hydroxymethyl-tetrahydro-furan-2-yl)-6-oxo-6,9-dihydro-1H-purin-2-yl]-benzamide 
• 129184-64-1 3',5'-bis-O-trimethylsilyl-2'-deoxyguanosine 
• 961-07-9 2'-Deoxyguanosine 
• 40615-36-9 4,4'-dimethoxytrityl chloride 
• 141846-56-2 5'-O-dimethoxytrityl-N2-isobutyryl-2'-deoxyguanosine-3'-O-(2-cyanoethyl)-N,N-diisopropylphosphoramidite 
• 129452-92-2 Diisopropyl-phosphoramidous acid (2R,3S,5R)-2-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-5-{2-[2-(tert-butyl-diphenyl-silanyloxymethyl)-benzoylamino]-6-oxo-1,6-dihydro-purin-9-yl}-tetrahydro-furan-3-yl ester 2-cyano-ethyl ester 

Relevant academic research and scientific papers

Cytidine- and guanosine-based nucleotide-lipids

Hybrid nucleotide-lipids composed of a lipid covalently attached to purine and pyrimidine nucleobases exhibit supramolecular properties. The novel cytidine and guanosine derivatives are promising bioinspired materials, which can act as supramolecular gela

BIOINK GEL FORMULATIONS COMPRISING NUCLEOLIPID-BASED COMPOUND

The present invention relates to nucleolipid-based compounds for use in regenerative medicine. More specifically, the invention relates to the use of to nucleolipid-based compounds in bioink gel formulations and a bioprinting method comprising the use of

Oligonucleotide with protected base

The present invention provides a protected nucleotide for elongation, which can be purified efficiently and in a high yield by a liquid-liquid extraction operation, and can achieve an oligonucleotide production method by a phosphoramidite method. It has been found that the above-mentioned problem can be solved by a particular oligonucleotide comprising a protected base and/or particular oligonucleotide protected by a branched chain-containing aromatic group at 3′-position.

OLIGONUCLEOTIDE WITH PROTECTED BASE

The present invention provides a protected nucleotide for elongation, which can be purified efficiently and in a high yield by a liquid-liquid extraction operation, and can achieve an oligonucleotide production method by a phosphoramidite method. It has been found that the above-mentioned problem can be solved by a particular oligonucleotide comprising a protected base and/or particular oligonucleotide protected by a branched chain-containing aromatic group at 3′-position.

Convenient synthesis of N-unprotected deoxynucleoside 3′- phosphoramidite building blocks by selective deacylation of N-acylated species and their facile conversion to other N-functionalized derivatives

(Chemical Equation Presented) A new route to N-unprotected deoxynucleoside 3′-phosphoramidite building blocks by use of highly selective N-deacylation of commercially available N-acylated deoxynucleoside 3′-phosphoramidites is described. These compounds could be readily converted to other types of N-protected species by facile N-acylations with acylating reagents.

Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

A new protected acyl protecting group for exocyclic amino functions of nucleobases

2-(Tert-butyldiphenylsilyloxymethyl)benzoyl chloride (SiOMB-Cl) reacts with the per-O-trimethylsilylated d-nucleosides C,G and A to give, after removal of the Si(Me)3 groups and 5′-O-protection with 4,4′-dimethoxytrityl chloride (DMT-Cl), the corresponding N-SiOMB-5′-O-DMT derivates, the SiOMB groups of which can easily be removed by fluoride ion. The SiOMB protected nucleosides proved to be suitable building units for the preparation of DNA fragments in solution and on a solid support.