Discovery, characterization, and optimization of an unnatural base pair for expansion of the genetic alphabet

Article abstract of DOI:10.1021/ja078223d

DNA is inherently limited by its four natural nucleotides. Efforts to expand the genetic alphabet, by addition of an unnatural base pair, promise to expand the biotechnological applications available for DNA as well as to be an essential first step toward

Full text of DOI:10.1021/ja078223d

Published on Web 01/25/2008
Discovery, Characterization, and Optimization of an Unnatural
Base Pair for Expansion of the Genetic Alphabet
Aaron M. Leconte, Gil Tae Hwang, Shigeo Matsuda, Petr Capek,
Yoshiyuki Hari, and Floyd E. Romesberg*
Department of Chemistry, The Scripps Research Institute, 10550 North Torrey Pines Road,
La Jolla, California, 92037
Received October 26, 2007; E-mail: floyd@scripps.edu
Abstract: DNA is inherently limited by its four natural nucleotides. Efforts to expand the genetic alphabet,
by addition of an unnatural base pair, promise to expand the biotechnological applications available for
DNA as well as to be an essential first step toward expansion of the genetic code. We have conducted two
independent screens of hydrophobic unnatural nucleotides to identify novel candidate base pairs that are
well recognized by a natural DNA polymerase. From a pool of 3600 candidate base pairs, both screens
identified the same base pair, dSICS:dMMO2, which we report here. Using a series of related analogues,
we performed a detailed structure-activity relationship analysis, which allowed us to identify the essential
functional groups on each nucleobase. From the results of these studies, we designed an optimized base
pair, d5SICS:dMMO2, which is efficiently and selectively synthesized by Kf within the context of natural
DNA.
We,9,10,15,16 and others,8,12,17-19 have shown that hydrophobic
1. Introduction
forces are also sufficient for the enzymatic synthesis of an
unnatural base pair by incorporation of an unnatural nucleoside
triphosphate against a template unnatural nucleotide; however,
synthesis beyond the unnatural base pair, i.e., extension, tends
to be relatively inefficient and generally limits the utility of these
base pairs. Recent efforts to modify either the nucleobases20-24
or the DNA polymerase25 have significantly improved the rate
of extension of unnatural base pairs and have demonstrated that
efficient extension by the exonuclease deficient Klenow frag-
ment of E. coli DNA Pol I (Kf) likely requires a minimally
distorted primer terminus with a suitably positioned minor
groove H-bond acceptor in the primer nucleobase. Unfortunately,
these strategies have yet to yield a viable base pair candidate
as the modifications that facilitate extension have also been
DNA is an essential biomolecule which is responsible for
encoding the complex information necessary for life. However,
it is limited to a set of nucleobases that encode a finite number
of three base codons; the expansion of the genetic alphabet to
include additional, coding nucleobases would significantly
increase the information potential of nucleic acids in Vitro1,2
and, ultimately, in ViVo. While significant progress has been
made toward both developing and applying unnatural base pairs
that form through unique hydrogen-bonding (H-bonding)
patterns,3-7 pairing based on hydrophobic interactions has also
emerged as a promising strategy for expansion of the genetic
alphabet.8-12 Hydrophobic forces are capable of stabilizing the
unnatural base pairs, as well as disfavoring mispairing with the
natural nucleobases due to forced desolvation of the natural
H-bonding functional groups. Indeed, several nucleotides bearing
predominantly hydrophobic nucleobase analogues have been
shown to pair stably and selectively in duplex DNA.13,14
(13) Berger, M.; Wu, Y.; Ogawa, A. K.; McMinn, D. L.; Schultz, P. G.;
Romesberg, F. E. Nucleic Acids Res. 2000, 28, 2911-2914.
(14) Matsuda, S.; Romesberg, F. E. J. Am. Chem. Soc. 2004, 126, 14419-
14427.
(15) McMinn, D. L.; Ogawa, A. K.; Wu, Y.; Liu, J.; Schultz, P. G.; Romesberg,
F. E. J. Am. Chem. Soc. 1999, 121, 11585-11586.
(16) Ogawa, A. K.; Wu, Y.; Berger, M.; Schultz, P. G.; Romesberg, F. E. J.
Am. Chem. Soc. 2000, 122, 8803-8804.
(1) Joyce, G. F. Ann. ReV. Biochem. 2004, 73, 791-836.
(2) Cropp, T. A.; Chin, J. W. Curr. Opin. Chem. Biol. 2006, 10, 601-6.
(3) Switzer, C.; Moroney, S. E.; Benner, S. A. J. Am. Chem. Soc. 1989, 111,
8322-8323.
(17) Matray, T. J.; Kool, E. T. J. Am. Chem. Soc. 1998, 120, 6191-6192.
(18) Matray, T. J.; Kool, E. T. Nature 1999, 399, 704-708.
(19) Chiaramonte, M.; Moore, C. L.; Kincaid, K.; Kuchta, R. D. Biochemistry
2003, 42, 10472-10481.
(4) Geyer, C. R.; Battersby, T. R.; Benner, S. A. Structure (Camb.) 2003, 11,
1485-1498.
(5) Prudent, J. R. Expert. ReV. Mol. Diagn. 2006, 6, 245-52.
(6) Yang, Z.; Sismour, A. M.; Sheng, P.; Puskar, N. L.; Benner, S. A. Nucleic
Acids Res. 2007, 35, 4238-49.
(20) Leconte, A. M.; Matsuda, S.; Hwang, G. T.; Romesberg, F. E. Angew.
Chem., Int. Ed. 2006, 45, (26), 4326-4329.
(7) Sismour, A. M.; Benner, S. A. Nucleic Acids Res. 2005, 33, 5640-6.
(8) Hirao, I.; Kimoto, M.; Mitsui, T.; Fujiwara, T.; Kawai, R.; Sato, A.; Harada,
Y.; Yokoyama, S. Nat. Methods 2006, 3, 729-35.
(21) Hwang, G. T.; Leconte, A. M.; Romesberg, F. E. ChemBioChem 2007, 8,
1606-11.
(22) Kim, Y.; Leconte, A. M.; Hari, Y.; Romesberg, F. E. Angew. Chem., Int.
Ed. 2006, 45, 7809-12.
(9) Ogawa, A. K.; Wu, Y.; McMinn, D. L.; Liu, J.; Schultz, P. G.; Romesberg,
F. E. J. Am. Chem. Soc. 2000, 122, 3274-3287.
(23) Matsuda, S.; Leconte, A. M.; Romesberg, F. E. J. Am. Chem. Soc. 2007,
129, 5551-7.
(10) Henry, A. A.; Olsen, A. G.; Matsuda, S.; Yu, C.; Geierstanger, B. H.;
Romseberg, F. E. J. Am. Chem. Soc. 2004, 126, 6923-6931.
(11) Henry, A. A.; Romesberg, F. E. Curr. Opin. Chem. Biol. 2003, 7, 727-
733.
(24) Adelfinskaya, O.; Nashine, V. C.; Bergstrom, D. E.; Davisson, V. J. J.
Am. Chem. Soc. 2005, 127, 16000-16001.
(25) Leconte, A. M.; Chen, L.; Romesberg, F. E. J. Am. Chem. Soc. 2005, 127,
12470-1.
(12) Hirao, I. Curr. Opin. Chem. Biol. 2006, 10, 622-7.
9
2336
J. AM. CHEM. SOC. 2008, 130, 2336-2343
10.1021/ja078223d CCC: $40.75 © 2008 American Chemical Society

Discovery and Optimization of an Unnatural Base Pair
A R T I C L E S
Figure 2. Representative nucleobase scaffolds and substitutions for
unnatural nucleotides screened for functional heterobase pairs. X )
heteroatom substitution; R ) functional group. See Supporting Information
for structures of the individual nucleotides.
Figure 1. Unnatural nucleobases used in this study. (A) MMO2 and
analogues: aref 23, bref 36, cref 20. (B) SICS and analogues: dref 28, eref
9, synthesized for this study.
f
found to limit synthesis and increase mispairing.20-22 Thus,
rational approaches to base pair discovery have been limited
by the conflicting demands of efficient synthesis and extension.
In contrast to approaches based on rational design, screening-
based approaches are not limited by our incomplete understand-
ing of DNA stability and replication, and they can potentially
identify both the determinants of efficient replication and
unanticipated unnatural base pairs.26,27
We now report the results of two independent screens of 3600
different unnatural base pairs, which both identified the same
promising base pair formed between the dSICS28 and dMMO223
nucleotide analogues (dSICS:dMMO2, Figure 1). Detailed
steady-state kinetic studies with Kf confirmed that dSICS:
dMMO2 is efficiently synthesized and extended; however, the
utility of the base pair is limited by the facile formation of the
dSICS:dSICS self-pair. To design improved analogues, as well
as to better understand the determinants of efficient polymerase-
mediated replication, we analyzed the DNA polymerase rec-
ognition of a family of related nucleobase derivatives. This, and
previous data collected with other analogues, allowed us to
determine the minimal requirements for polymerase recognition
and to optimize the dSICS:dMMO2 base pair, culminating in
the d5SICS:dMMO2 base pair (Figure 1). Comparison of the
reported kinetic data with previously reported data for other
unnatural base pair candidates suggests that d5SICS:dMMO2
is likely the most promising candidate for expansion of the
genetic alphabet identified to date.
the 24th position of a complementary 45-mer template oligo-
nucleotide. Hybridization of any given primer strand with any
template strand results in an unnatural primer terminus (dX:
dY, where dX is the primer nucleobase and dY is the template
nucleobase). The nucleotide in the template immediately 5′ to
the unnatural nucleotide is in all cases dG; thus, polymerase
mediated dCTP incorporation results in extension of the
unnatural terminus. 60 primers were divided into 10 groups of
related unnatural nucleotides, and the primers were mixed in
equal portions. Each group of primers was radiolabeled together
and annealed to individual template oligonucleotide strands,
creating a group of radiolabeled primers annealed to a single
common template. Each “primer group:template” combination
was challenged with dCTP and Kf, and the reaction products
were quantified using gel electrophoresis. “Primer group:
template” combinations that yielded the most 25-mer product
were selected for further analysis of the individual component
pairs. 274 single primer:template pairs were challenged with
Kf and three different concentrations of dCTP. Reaction products
were quantified using gel electrophoresis, and the Michaelis-
Menten equation was fit to the data. From this rough estimate
of the kcat/KM of extension of 274 individual pairs, the 40 most
efficiently extended primer:template combinations were selected
for full steady-state kinetic analysis using standard methods.35
The steady-state rate constants of extension of these 40 pairs
were examined in both the selected strand context (dX:dY) as
well as the opposite strand context (dY:dX), resulting in six
pairs that were efficiently extended in both contexts. We next
measured the enzymatic synthesis of these pairs by Kf-mediated
insertion of dXTP opposite dY and dYTP opposite dX. Of these
six base pairs, the pair formed between dSICS and dMMO2
was the only identified pair that was efficiently incorporated in
addition to being efficiently extended in both sequence contexts.
To increase our confidence that we had identified the most
promising unnatural base pair, we ran a second screen. In this
case, each of 3600 possible unnatural base pairs was screened
simultaneously for efficient and high fidelity synthesis and
extension using a fluorescence-based assay. Each 45-mer
template with an unnatural nucleotide at position 24 was
dissolved in polymerase reaction buffer and annealed to an 18-
mer primer whose 3′ nucleotide annealed to position 23 of the
template, and the primer:template pairs were aliquoted into
individual wells of a 384-well plate. To each well was added
either all four natural dNTPs and one of the 60 unnatural dNTPs
2. Results
2.1. Screening for Unnatural Base Pairs. We have previ-
ously reported the synthesis of a wide variety of unnatural
nucleotide analogues bearing predominantly hydrophobic nu-
cleobase analogues.8,9,11,14,15,20,22,28-34 From these, 60 were
collected (Figure 2) and their phosphoramidites were incorpo-
rated into the 3′ end of a 24-mer primer oligonucleotide and at
(26) Kincaid, K.; Kuchta, R. D. Nucleic Acids Res. 2006, 34, e109.
(27) Leconte, A. M.; Matsuda, S.; Romesberg, F. E. J. Am. Chem. Soc. 2006,
128, 6780-1.
(28) Yu, C.; Henry, A. A.; Romesberg, F. E.; Schultz, P. G. Angew. Chem., Int.
Ed. 2002, 41, 3841-3844.
(29) Wu, Y.; Ogawa, A. K.; Berger, M.; McMinn, D. L.; Schultz, P. G.;
Romesberg, F. E. J. Am. Chem. Soc. 2000, 122, 7621-7632.
(30) Tae, E. L.; Wu, Y. Q.; Xia, G.; Schultz, P. G.; Romesberg, F. E. J. Am.
Chem. Soc. 2001, 123, 7439-7440.
(31) Henry, A. A.; Yu, C.; Romesberg, F. E. J. Am. Chem. Soc. 2003, 125,
9638-9646.
(32) Matsuda, S.; Henry, A. A.; Schultz, P. G.; Romesberg, F. E. J. Am. Chem.
Soc. 2003, 125, 6134-6139.
(33) Hwang, G. T.; Romesberg, F. E. Nucleic Acids Res. 2006, 34, 2037-45.
(34) Matsuda, S.; Fillo, J. D.; Henry, A. A.; Rai, P.; Wilkens, S. J.; Dwyer, T.
J.; Geierstanger, B. H.; Wemmer, D. E.; Schultz, P. G.; Spraggon, G.;
Romesberg, F. E. J. Am. Chem. Soc. 2007, 129, 10466-73.
(35) Creighton, S.; Bloom, L. B.; Goodman, M. F. Methods Enzymol. 1995,
262, 232-256.
9
J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008 2337

A R T I C L E S
Leconte et al.
Table 1. Steady-State Rate Constants of Kf-Mediated,
dY-Templated, dXTP Incorporation for Synthesis of dSICS:dMMO2
and Mispairsa
Table 2. Steady-State Rate Constants of Kf-Mediated Unnatural
Terminus Extension by Insertion of dCTP for dSICS:dMMO2 and
Mispairsa
5
′ − dTAATACGACTCACTATAGGGAGA
5
′ − dTAATACGACTCACTATAGGGAGA(X)
3
′ − dATTATGCTGAGTGATATCCCTCT(Y)GCTAGGTTACGGCAGGATCGC
3
′ − dATTATGCTGAGTGATATCCCTCT(Y)GCTAGGTTACGGCAGGATCGC
kcat
(min-
KM
M)
kcat/KM
(M-1 min-
kcat
(min-
KM
M)
kcat/KM
1
1
1
1
dXTP
Y
)
(
µ
)
X
Y
)
(
µ
(M-1 min-
)
SICS
MMO2
A
C, G, T
MMO2
SICS
A
C
MMO2
MMO2b
MMO2b
MMO2b
SICS
11.2 ( 0.2
5.1 ( 0.7
3.3 ( 0.3
ndd
0.8 ( 0.1
44 ( 4
32 ( 4
ndd
18 ( 3
3.2 ( 3.1
45 ( 2
ndd
1.4 × 107
1.2 × 105
1.0 × 105
<1.0 × 103
3.4 × 105
1.6 × 106
3.7 × 104
1.3 × 102
1.5 × 105
1.4 × 104
SICS
A
MMO2
MMO2
SICS
A
C
G
T
MMO2
MMO2b
MMO2b
SICS
1.0 ( 0.1
8.65 ( 0.89
0.87 ( 0.28
3.8 ( 0.5
1.5 ( 0.3
2.6 ( 1.0
0.7 ( 0.3
0.7 ( 0.3
12.0 ( 0.7
0.9 ( 0.2
187 ( 17
165 ( 47
2.2 ( 0.3
242 ( 78
85 ( 17
255 ( 84
191 ( 84
124 ( 26
1.1 × 106
4.6 × 104
5.3 × 103
1.7 × 106
6.3 × 103
3.1 × 104
2.6 × 103
3.7 × 103
9.6 × 104
6.2 ( 0.5
SICSc
SICS
SICSc
5 ( 1
SICSc
1.6 ( 0.6
ndd
SICS
SICS
SICS
SICSc
G
T
SICSc
13 ( 3
2.7 ( 1.2
85 ( 9
194 ( 66
SICSc
a See Experimental Section for experimental details. b Reference 23.
c Reference 28.
a See Experimental Section for experimental details. b Reference 23.
c Reference 28. d Rates too slow to independently determine kcat and KM.
misincorporation of the incorrect unnatural nucleoside triphos-
phate. While dMMO2TP is inserted opposite dMMO2 in the
template over 100-fold less efficiently than dSICSTP (1.2 ×
(60 reactions) or only the four natural dNTPs (misincorporation
control). Reactions were incubated with Kf and quenched with
EDTA and SYBR Green I. SYBR Green I preferentially
fluoresces in the presence of double stranded DNA, and the
ratio of “reaction” fluorescence to “misincorporation” fluores-
cence was used as a measure of efficient and selective full length
synthesis, simultaneously evaluating both incorporation and
extension. The average ratio of fluorescence was 0.87, and 94
reactions were found in excess of 1.25. However, only one
unnatural pair, dSICS:dMMO2, showed elevated values (1.9
and 1.5) in both possible sequence contexts. Thus, the same
unnatural base pair was identified by both screens, allowing us
to conclude with a high level of confidence that it is the most
promising of the 3600 pairs screened. Thus, we chose the
dSICS:dMMO2 base pair for further analysis.
2.2. Characterization of dSICS:dMMO2. To better under-
stand the dSICS:dMMO2 pair, we next performed a detailed
steady-state kinetic analysis. First, we characterized base pair
synthesis by determining the rates at which each unnatural
nucleoside triphosphate is inserted opposite its cognate base in
the template (Table 1). For reference, in the analogous sequence
context, dATP is inserted opposite dT with a second-order rate
constant (kcat/KM, also referred to as efficiency) of approximately
3 × 108 M-1 min-1. dSICSTP is inserted against template
dMMO2 with a second-order rate constant of 1.4 × 107 M-1
min-1, only approximately 20-fold less efficient than the
synthesis of a natural pair. In the opposite context, dMMO2TP
is incorporated against template dSICS with a second-order rate
constant of 3.4 × 105 M-1 min-1. Comparing these rates with
those previously reported for dSICS and dMMO2 templated
mispair synthesis,23,28 the correct unnatural base pair is synthe-
sized with a minimum fidelity (e.g., the ratio of the second-
order rate constants of correct synthesis to that for the most
efficiently synthesized mispair) of 117-fold (insertion of dSIC-
STP opposite dMMO2) and 2-fold (insertion of dMMO2TP
opposite dSICS). The relatively low, 2-fold selectivity of the
dSICS:dMMO2 base pair results from the efficient insertion
of dGTP opposite dMMO2. Although the dG:dMMO2 mispair
is synthesized relatively efficiently, unlike the correct unnatural
pair it is extended very inefficiently at a rate that is barely
detectable (see below), and thus it is likely excised when the
polymerase possesses exonuclease activity. In addition to fidelity
against the natural nucleotides, the pair must be selective against
105 M-1 min-1),23 dSICSTP is inserted opposite dSICS at a
28
rate of 1.6 × 106 M-1 min-1
approximately 5-fold more
efficiently than correct dMMO2TP incorporation against dSICS.
Thus, dSICS:dMMO2 base pair synthesis is limited by the facile
synthesis of the dSICS self-pair.
We next examined the extension efficiency of the dSICS:
dMMO2 unnatural base pair by characterizing the steady-state
rate at which Kf extends a primer terminating with dSICS paired
opposite dMMO2 by incorporation of dCTP opposite dG (Table
2). In this context, the pair is extended with a second-order rate
constant of 1.7 × 106 M-1 min-1, which is approximately equal
to the rate of extension of the fastest unnatural termini reported
to date21 and only approximately 100-fold less efficient than a
natural base pair in the same context. We then examined the
rate at which dMMO2 is extended when paired opposite dSICS.
The unnatural pair is again extended efficiently, with a kcat/KM
of 1.1 × 106 M-1 min-1. Thus, the dSICS:dMMO2 is efficiently
extended in both sequence contexts.
To examine the selectivity of unnatural base pair extension,
we measured the rate at which the most problematic mispairs
(i.e., those synthesized with detectable rates) are extended by
insertion of dCTP opposite dG in the template (Table 2). With
dMMO2 in the template, this includes only the mispair with
dA (the other mispairs are all synthesized with rates below the
detectable limit of 103 M-1 min-1). With dSICS in the template,
this includes mispairs with each natural nucleotide (synthesized
at rates between 1.3 × 102 and 1.5 × 105 M-1 min-1). The
dA:dMMO2 mispair is extended with a second-order rate
constant of 4.6 × 104 M-1 min-1, which is 24-fold less efficient
than the rate at which dSICS:dMMO2 is extended. The most
efficiently extended mispair with dSICS was that formed with
dT, which was extended with a second-order rate constant of
9.6 × 104 M-1 min-1. All other mispairs formed with dSICS
are extended with a rate less than or equal to 3.1 × 104 M-1
min-1. Importantly, the mispair formed between dSICS and dG,
which is the most efficiently synthesized, is extended ap-
proximately 500-fold less efficiently than the correct pair.
Additionally, the extension of incorrect unnatural base pairs
(dSICS:dSICS or dMMO2:dMMO2) is inefficient, occurring
at rates less than 104 M-1 min-1. Thus, the dSICS:dMMO2
9
2338 J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008

Discovery and Optimization of an Unnatural Base Pair
A R T I C L E S
Figure 4. Second-order rate constants of Kf mediated extension of unnatural
base pairs. The x-axis corresponds to the extension of the dX:dY context
while the y-axis corresponds to the extension of the dY:dX context. Pairs
are listed on the plot as X:Y. See Supporting Information (Table S2) for
rate constants and sequence context.
Figure 3. Second-order rate constants of Kf mediated synthesis of unnatural
base pairs. The x-axis corresponds to incorporation of dXTP against dY
while the y-axis corresponds to incorporation of dYTP against dX. Pairs
are listed on the plot as X:Y. d4MPTP is incorporated against dICS at a
rate below the limit of detection (<1.0 × 103 M-1 min-1). See Supporting
Information (Table S1) for rate constants and sequence context.
(Figure 3, Table S1). In the template, dMMO2, d2OMe, and
dDM5 direct dSICSTP incorporation at similar rates (1.1 ×
107 M-1 min-1 to 1.7 × 107 M-1 min-1); these rates are
approximately 10-fold greater than the rate of dICSTP incor-
poration (8.7 × 105 M-1 min-1 to 1.6 × 106 M-1 min-1). d4MP
templates unnatural base pair incorporation poorly, with rates
that are 50- to 150-fold lower than those for the other three
phenyl analogues. The rates of incorporation of dSPYRTP are
significantly less than those for either dICSTP or dSICSTP,
confirming previous results indicating that the incorporation of
hydrophobic base pairs tends to correlate strongly with the total
aromatic surface area of the incoming triphosphate.
base pair is extended with a minimum fidelity of 18 for
dMMO2:dSICS and 24 for dSICS:dMMO2.
2.3. Structure-Activity Relationship Analysis. To under-
stand the determinants of unnatural base pair synthesis and
extension, as well as to further optimize the replication of the
unnatural base pair, we measured the steady-state rate constants
of both incorporation and extension of all possible pairs formed
between several derivatives of dSICS and dMMO2 (Figure 1).
The derivatives examined were designed to probe the role of
nucleobase shape, electrostatics, minor groove H-bonding, and
extended aromatic surface area.
We first examined the incorporation of different nucleoside
triphosphate derivatives (dMMO2TP, d2OMeTP,23 dDM5TP,36
and d4MPTP20) opposite dSICS (Figure 3, Table S1). In
addition, to probe the role of the minor groove H-bond acceptor
and aromatic surface area of the template nucleobase, we also
examined the rates with which the same triphosphates are
inserted opposite dICS9 or dSPYR. Interestingly, dMMO2TP,
d2OMeTP, and dDM5TP are all incorporated against dSICS
with similar rates, ranging from 1.3 × 105 to 4.3 × 105 M-1
min-1; however, d4MPTP is incorporated 10- to 30-fold less
efficiently than the other analogues. The data suggest that a
more hydrophobic minor groove substituent in the dNTP
facilitates unnatural base pair synthesis. The same general trend
is observed when dICS is in the template since dMMO2TP,
d2OMeTP, and dDM5TP are all incorporated more efficiently
than d4MPTP. However, relative to dSICS, the rates are
uniformly decreased by 12-60-fold with dICS in the template,
demonstrating that the thiopyridone is more efficient at tem-
plating unnatural triphosphate insertion than the more natural-
like pyridone. In addition, the ability to template unnatural base
pair synthesis is moderately dependent on the bicyclic aromatic
scaffold, as dSPYR templates the incorporation of all four
MMO2 analogues less efficiently than dSICS, but still more
efficiently than dICS.
Nucleobase derivatization also has significant effects on the
rate of unnatural pair extension (Figure 4, Table S2). In addition
to the aforementioned analogues, we also examined MM336 to
observe the effect of removing one of the minor groove H-bond
acceptors, and SNICS,28 to observe the effect of heteroatom
substitution on the dSICS scaffold. When in the primer, the
four dSICS analogues act similarly when paired with common
templates. Each is extended most efficiently when paired with
dMMO2, d2OMe, or dDM5 in the template. These rates are
highest with dSICS and dICS, which are extended with rates
greater than or equal to 1 × 106 M-1 min-1. Pairs formed with
dSNICS or dSPYR in the primer and dMMO2, d2OMe, or
dDM5 in the template are extended less efficiently than their
dSICS or dICS counterparts, but still more efficiently than those
with either dMM3 or d4MP in the template. Pairs formed with
dSICS, dICS, dSNICS, or dSPYR in the primer and d4MP in
the template are extended with only moderate efficiency (kcat/
KM ranging from 2 × 104 to 3 × 105 M-1 min-1), and pairs
formed with dMM3 are generally extended the least efficiently
(kcat/KM ranging from 2 × 104 to 7 × 104 M-1 min-1).
The results are significantly different in the opposite context,
with the dMMO2 analogues in the primer and the dSICS
analogues in the template (Figure 4, Table S2). Consistent with
previous studies,20-24 primers bearing a hydrogen bond acceptor
in the minor groove (i.e., d2OMe, dMMO2, and d4MP) were
extended more efficiently than those bearing either hydrogen
or a methyl group in the minor groove (dMM3 or dDM5),
regardless of the templating nucleobase. The only exception was
We next examined the incorporation of dSICSTP and its
analogues against dMMO2 and its analogues in the template
(36) Matsuda, S.; Henry, A. A.; Romesberg, F. E. J. Am. Chem. Soc. 2006,
128, 6369-75.
9
J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008 2339

A R T I C L E S
Leconte et al.
Table 3. Steady-State Rate Constants of Self-Pair Synthesis by
Incorporation of dXTP against dX for SICS and Analoguesa
Table 4. Steady-State Rate Constants of Kf-Mediated,
dY-Templated, dXTP Incorporation for Synthesis of
d5SICS:dMMO2 and Mispairsa
5
′ − dTAATACGACTCACTATAGGGAGA
3
′ − dATTATGCTGAGTGATATCCCTCT(X)GCTAGGTTACGGCAGGATCGC
5
′ − dTAATACGACTCACTATAGGGAGA
′ − dATTATGCTGAGTGATATCCCTCT(Y)GCTAGGTTACGGCAGGATCGC
3
kcat
(min-
KM
M)
kcat/KM
1
1
(M-1 min-
)
kcat
(min-
KM
M)
kcat/KM
X
)
(
µ
1
1
dXTP
Y
)
(
µ
(M-1 min-
)
SICSb
4SICS
5SICS
5 ( 1
2.6 ( 0.8
1.7 ( 0.5
3.2 ( 3.1
8.6 ( 1.7
63 ( 4
1.6 × 106
3.0 × 105
2.7 × 104
5SICS
MMO2
5SICS
A
C
G
T
MMO2
5SICS
5SICS
5SICS
5SICS
5SICS
5SICS
8.5 ( 0.1
12 ( 1
1.7 ( 0.5
1.2 ( 0.3
nd b
4.6 ( 0.6
1.7 ( 0.2
0.18 ( 0.01
33 ( 6
63 ( 4
54 ( 6
nd b
36 ( 4
130 ( 19
4.7 × 107
3.6 × 105
2.7 × 104
2.2 × 104
<1.0 × 103
1.3 × 105
1.3 × 104
a See Experimental Section for experimental details. b Reference 23.
with dSPYR in the template, where primer extension was largely
independent of the primer nucleotide. When paired with dSICS
as the template, primers terminating with d2OMe, dMMO2,
or d4MP are extended with rates greater than 1 × 106 M-1
min-1. When paired with dICS or dSNICS, these same pairs
are extended less efficiently (1.3 × 104 to 1.5 × 105 M-1 min-1),
but still generally more efficiently than the pairs without the
primer H-bond acceptor, which were extended with rates
between 3.8 × 103 and 1.4 × 104 M-1 min-1. Surprisingly, the
identity of the hydrogen bond acceptor was relatively unim-
portant, especially when paired with dSICS; in these cases,
primers bearing methoxy groups (d2OMe or dMMO2) were
extended essentially as efficiently as those bearing more natural,
stronger H-bond accepting carbonyl groups (d4MP).
a See Experimental Section for experimental details. b Rates are too slow
to determine kcat and KM independently.
Table 5. Steady-State Rate Constants of Kf-Mediated Unnatural
Terminus Extension by Insertion of dCTP for d5SICS:dMMO2 and
Mispairsa
5
′ − dTAATACGACTCACTATAGGGAGA(X)
3
′ − dATTATGCTGAGTGATATCCCTCT(Y)GCTAGGTTACGGCAGGATCGC
kcat
(min-
KM
M)
kcat/KM
(M-1 min-
)
1
1
X
Y
)
(
µ
MMO2
5SICS
5SICS
A
C
G
T
5SICS
MMO2
5SICS
5SICS
5SICS
5SICS
5SICS
6.4 ( 1.1
3.8 ( 0.3
nd b
0.79 ( 0.01
0.18 ( 0.01
0.62 ( 0.02
2.0 ( 0.1
3.4 ( 0.3
5.7 ( 1.2
nd b
76 ( 11
44 ( 9
127 ( 8
4.9 ( 0.3
1.9 × 106
6.7 × 105
<1.0 × 103
1.0 × 104
4.2 × 103
4.9 × 103
4.0 × 105
The rate of extension is also highly dependent on the template
nucleobase. Pairs formed with dSICS in the template are
consistently more efficiently extended than those formed with
dICS, dSNICS, or dSPYR. The effects are the greatest when
the primer nucleobase bears a methoxy group (either d2OMe
or dMMO2), as the dMMO2:dSICS and d2OMe:dSICS pairs
are extended greater than 100-fold more efficiently than
dMMO2:dICS or d2OMe:dICS. The dMMO2:dSICS and
d2OMe:dSICS pairs are also among the most efficiently
extended pairs overall, with rates greater than 1 × 106 M-1
min-1. Relative to dSICS, dSNICS is also a poorer template
for all of the pairs examined; thus, the heteroatom located away
from the interbase interface alters the extension properties of
these pairs. In contrast, primer termini possessing dSPYR as
the template nucleobase were extended at approximately the
a See Experimental Section for experimental details. b Rates are too slow
to determine kcat and KM independently.
we examined the pairing of d5SICS with both dMMO2 and
d2OMe.
For d5SICS, dMMO2 serves as a slightly better pairing
partner than d2OMe (compare Tables 4 and 5 to Tables S3
and S4), and although the difference is small, we focused on
pairing with dMMO2. Importantly, addition of the methyl group
at the 5-position of the dSICS scaffold has virtually no effect
on mispair formation with natural nucleotides but does increase
the rate of pairing with dMMO2 approximately 3-fold to a rate
within 10-fold of natural synthesis. We then examined extension
of the d5SICS:dMMO2 heteropair (Table 5). The rates of
extension are virtually unchanged in either context by methyl
substitution of the isocarbostiryl scaffold. Thus, it appears that
methyl substitution at the 5-position results in a selective
decrease of self-pair synthesis. In either strand context, the
d5SICS:dMMO2 unnatural base pair is synthesized and ex-
tended with rates that are reasonable and with a minimal overall
fidelity of 130- and 6300-fold considering incorporation and
extension (Table 6). This data compare favorably to those for
any unnatural base pair reported to date.
same rate (ranging from 6.4 × 104 to 1.6 × 105 M-1 min-1
)
regardless of primer nucleobase.
2.4. Optimization of dSICS:dMMO2: The d5SICS:
dMMO2 Unnatural Base Pair. While the derivatizations
described above help to elucidate the determinants of unnatural
base pair replication, none resulted in significantly improved
synthesis or extension. Also, as described above, the most
significant limitation of the dSICS:dMMO2 heteropair is the
lack of selectivity against the dSICS self-pair, which is formed
5-fold more efficiently than the heteropair. Interestingly, previ-
ous studies with the isocarbostiryl framework suggested that
self-pair formation may be minimized by methyl substitution
at the 4- or 5-position.29 Thus, we synthesized and analyzed
the d4SICS or d5SICS analogues (Figure 1B). When we
measured the rates of self-pair synthesis for d4SICS and
d5SICS, we found that the rates are decreased 5-fold and 60-
fold, respectively, relative to dSICS (Table 3). Considering the
substantial decrease in the self-pair synthesis of d5SICS, we
examined whether this modification would modify the efficiency
or fidelity of heteropair synthesis. Since dMMO2 and d2OMe
acted similarly at all steps in our structure-activity relationship,
3. Discussion
Typically, the design and development of unnatural base pairs
have relied on the prevalent theories of molecular recognition,
especially within the context of the DNA polymerase.3,37 Here,
we have used two screens for efficient Kf-mediated synthesis,
one which probes extension and another which probes synthesis
and continued primer extension, to identify novel candidate base
(37) Ohtsuki, T.; Kimoto, M.; Ishikawa, M.; Mitsui, T.; Hirao, I.; Yokoyama,
S. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 4922-4925.
9
2340 J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008

Discovery and Optimization of an Unnatural Base Pair
A R T I C L E S
Table 6. Fidelities of d5SICS:dMMO2 Synthesis and Extension
We have made initial progress toward understanding the
origins of the remarkable properties of the dSICS:dMMO2 and
d5SICS:dMMO2 base pairs by analyzing the relationship
between nucleobase shape, electronics, or H-bonding potential
and Kf-mediated synthesis and extension (summarized in Table
7). During incorporation of the unnatural nucleoside, hydro-
phobic substituents at the position ortho to the glycosidic
linkage, which are most likely oriented into the minor groove,
are required for efficient synthesis. When the analogue in either
the template or triphosphate bears a hydrophilic group at this
position, on either scaffold, the rates of unnatural dNTP
incorporation decrease significantly. In a manner similar to
natural mispairing, uncompensated desolvation of hydrophilic
functional groups likely renders dNTP incorporation energeti-
cally unfavorable. Thus, in agreement with the previously
reported characterization of other hydrophobic analogues, ef-
ficient unnatural base pair synthesis is strongly facilitated by
hydrophobic groups disposed in the developing minor groove.9,16,36
Interestingly, effects in the major groove tend to be more
variable; methyl substitution at the 4-position of dMMO2 has
only small effects while methyl substitution at the 5-position
of the dSICS scaffolds profoundly decreases the rate of self-
pair formation. The effects on self-pair synthesis may result from
cross-strand eclipsing interactions manifest only in the inter-
calated mode of pairing that is unique to the self-pair.34
The most efficiently extended termini all had a minor groove
H-bond acceptor in the primer and a relatively hydrophobic
minor groove substituent in the template nucleobase. Biochemi-
cal studies of natural DNA have clearly shown that H-bond
acceptors in the minor groove of the primer nucleobase facilitate
extension;40-43 interactions between these functional groups and
Kf, particularly H-bonds formed between the minor groove
H-bond acceptor of the primer nucleobase, Arg668 of Kf, and
the ribosyl oxygen of the incoming dNTP, are necessary for
the polymerase to properly orient the primer terminus and the
incoming triphosphate for catalysis.42 We have repeatedly
observed the same phenomenon in unnatural scaffolds.18-22
Here, this idea is further supported by the significantly decreased
efficiency of extension of primers terminating in either dMM3
or dDM5. Despite the importance of this H-bond, the strength
of the interaction appears to be less important; within the dSICS
scaffold, the oxygen and sulfur substituted analogues are
extended essentially equivalently; within the dMMO2 scaffold,
the methoxy and carbonyl variants are extended similarly as
well.
incorporation
fidelityb
extension
fidelityc
total
fidelityd
X*
Y
5SICS
A
C
G
5SICS
5SICS
5SICS
5SICS
5SICS
MMO2
MMO2a
MMO2a
13
16
>360
2.8
1900
190
452
388
4.8
126
13
2.5 × 104
3.0 × 103
>1.6 × 105
6.3 × 103
1.3 × 102
4.9 × 104
6.3 × 103
f
T
28
MMO2
A
C, G, T
392
470
>47000
e
a Reference 23. b Relative rate of correct nucleoside triphosphate
incorporation to incorrect dX*TP incorporation against template dY.
c relative rate of correct pair extension to incorrect dX*:dY extension. d Total
fidelity is the product of incorporation and extension fidelity. e Extension
was not measured since incorporation product was not observed. f Total
fidelity was not measured since extension was not measured.
pairs. From 3600 potential unnatural base pairs, the pair formed
between dSICS and dMMO2 is clearly the strongest candidate
base pair. Detailed kinetic analysis revealed that the pair is
limited by facile synthesis of the dSICS:dSICS self-pair, which
is likely driven by favorable packing interactions between the
large aromatic rings.34 Interestingly, the self-pairing problem
appears to be a common problem for hydrophobic base pairs.8,16
Notably, the dDs:dPa base pair developed by Hirao and co-
workers is, like dSICS:dMMO2, limited by self-pair formation
of the larger nucleobase. To solve this problem, Hirao and co-
workers modified the gamma phosphate of the large nucleobase
to nonspecifically decrease the rate of dDsTP incorporation and,
thus, self-pair formation.8 While this is a clever solution, it is
likely to limit at least some of the potential applications in which
the base pair might be used. To solve the same problem, we
used synthetic derivatization of the pair, designed using a
thorough structure-activity relationship as well as previous
studies, to produce the candidate base pair d5SICS:dMMO2.
Importantly, here, the decreased self-pair synthesis is highly
selective; the synthetic modification has little to no effect on
any other step of replication.
Steady-state kinetics demonstrated that all steps of enzymatic
DNA synthesis of the unnatural base pair are within 1000-fold
of the efficiency of a natural base pair, and considering the
fidelity of base pair synthesis and extension, the overall
selectivity against the most efficiently formed mispair is 130-
and 6300-fold, with d5SICS and dMMO2 in the template,
respectively (Table 6). Previously we reported the characteriza-
tion of the d3FB self-pair,10,34 which was until now our best
candidate for the expansion of the genetic alphabet. The d3FB
self-pair is synthesized 20-fold slower than d5SICSTP is
inserted opposite dMMO2, but 8-fold faster than dMMO2TP
is inserted opposite d5SICS. However, in either sequence
context, the d5SICS:dMMO2 pair is extended significantly
faster than the d3FB self-pair. In addition, the overall fidelity
of the d5SICS:dMMO2 pair is significantly greater than that
for the d3FB self-pair, which is 20. Thus, relative to the d3FB
self-pair, the d5SICS:dMMO2 pair is more efficiently synthe-
sized and extended with overall greater fidelity. Although direct
comparison with base pairs developed by other groups is difficult
due to differing sequence contexts, the fidelity and efficiency
of the d5SICS:dMMO2 pair appear to compare favorably with
those for previously reported dDs:dPa,8 dκ:dX,38 and disoC:
disoG3,39 unnatural base pairs.
In addition to a minor groove hydrogen bond acceptor on
the primer nucleobase, efficient extension appears to require a
hydrophobic substituent oriented into the minor groove of the
template nucleobase, although the origins of this effect are less
clear. Examination of the various crystal structures of Pol I
polymerases shows evolutionarily conserved H-bonding contacts
between the polymerase and minor groove H-bond acceptors
of the template nucleobase.44-47 However, in stark contrast to
(38) Piccirilli, J. A.; Krauch, T.; Moroney, S. E.; Benner, S. A. Nature 1990,
343, 33-37.
(39) Switzer, C. Y.; Moroney, S. E.; Benner, S. A. Biochemistry 1993, 32,
10489-10496.
(40) Morales, J. C.; Kool, E. T. J. Am. Chem. Soc. 1999, 121, 2323-2324.
(41) Morales, J. C.; Kool, E. T. J. Am. Chem. Soc. 2000, 122, (6), 1001-1007.
(42) Meyer, A. S.; Blandino, M.; Spratt, T. E. J. Biol. Chem. 2004, 279, 33043-
6.
(43) Spratt, T. E. Biochemistry 2001, 40, 2647-52.
(44) Li, Y.; Korolev, S.; Waksman, G. EMBO J. 1998, 17, 7514-7525.
9
J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008 2341

A R T I C L E S
Leconte et al.
Table 7. Relative Rates of Incorporation and Extension for dSICS and dMMO2 Analoguesa
a Relative rates are defined as the ratio of the second-order rate constants of the X:Y pair to the SICS:MMO2 pair. See Supporting Information for
experimental details. b Incorporation of dXTP against dY or dYTP against dX. c Extension of X:Y or Y:X. Bases are listed primer:template. d Not determined.
the interactions between the polymerase and the primer nucleo-
base, biochemical disruption of this contact, by atomic substitu-
tion of the H-bonding group in the nucleobase, results in only
small or insignificant changes in the rate of enzymatic synthesis
of natural DNA.41,43 Thus, this template H-bond appears to play
a smaller role in the synthesis of natural DNA. Interestingly,
with hydrophobic unnatural base pairs, it appears that increased
hydrophobicity in the template position of the developing minor
groove actually facilitates extension.23 We observed a large
reduction in extension associated with substitution of the sulfur
atom of dSICS with an oxygen, or the substitution of the
C-glycosidic methoxy analogue of dMMO2 with an N-glyco-
sidic amide. Although the carbonyl functional group is more
similar to a natural nucleobase and should H-bond with the poly-
merase at the conserved residues, it significantly decreases the
rate of extension in either scaffold. Additionally, within the
dMMO2 scaffold, substituting the methoxy group with a hydro-
gen (dMM3) results in a significant decrease in extension while
substituting it with a methyl group (dDM5) has little effect.
H-bond acceptor in the primer nucleobase and a hydrophobic
substituent in the template nucleobase. These conflicting
requirements for polymerase mediated recognition appear to
explain one of the most conspicuous and, according to our
structure activity relationship studies, essential aspects of the
dSICS:dMMO2 and d5SICS:dMMO2 unnatural base pairss
the unusual substituents at the position ortho to the glycosidic
linkage. dMMO2 possesses an ortho methoxy substituent which
provides both a hydrophobic methyl group and a potential
H-bond acceptor; dSICS and d5SICS possess an ortho sulfur
atom which, relative to an oxygen atom, is more hydrophobic
but retains the ability to act as an H-bond acceptor. Thus, the
dSICS:dMMO2 and d5SICS:dMMO2 pairs appear to simul-
taneously satisfy the apparently contradictory demands of
efficient synthesis and extension. It is unlikely that such a subtle
balance of properties would have been designed rationally.
Our characterization of the d5SICS:dMMO2 heteropair
demonstrates that its synthesis and extension are both relatively
efficient and selective. The pair compares favorably with all
previously characterized unnatural base pair candidates for
which relevant kinetic data are available. Additionally, our
structure-activity relationship, along with the growing literature
regarding hydrophobic base pairs, begins to suggest discreet
design principles which will aid in the development of future
unnatural base pairs. Indeed, we continue to search for
modifications that optimize the d5SICS:dMMO2 heteropair as
well as new scaffolds with promising properties with the
expectation that this work will not only elucidate fundamental
principles underlying the storage and retrieval of genetic
The structure-activity relationship data described above
suggest that functionality within the developing minor groove
is generally most important for polymerase recognition and
replication of hydrophobic base pairs. However, at first glance,
these requirements appear to be mutually exclusive: efficient
synthesis requires a hydrophobic substituent in both the primer
and template analogue while subsequent extension requires an
(45) Li, Y.; Waksman, G. Protein Sci. 2001, 10, 1225-1233.
(46) Beese, L. S.; Derbyshire, V.; Steitz, T. A. Science 1993, 260, 352-355.
(47) Keifer, J. R.; Mao, C.; Hansen, C. J.; Basehore, S. L.; Hogrefe, H. H.;
Braman, J. C.; Beese, L. Structure 1997, 5, 95-108.
9
2342 J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008

Discovery and Optimization of an Unnatural Base Pair
A R T I C L E S
sures and the ImageQuant program. The Michaelis-Menten equation
was fit to the data using the program Kaleidagraph (Synergy software).
The data used were from single experiments.
information but also ultimately culminate in a fully functional
unnatural base pair.
Experimental Methods
Full Length Synthesis Screen. Primer (5′-d(CGACTCACTAT-
AGGGAGA)) and templates (5′-d(CGCTAGGACGGCATTGGATCGX-
TCTCCCTATAGTGAGTCGTATTA)) were annealed in reaction
buffer by heating to 95 °C followed by slow cooling to room
temperature. A mixture of the four natural dNTPs was added, and 5
µL of the solution were aliquoted into a 384-well plate. To each well
was added either a 2.5 µL aliquot of an unnatural dNTP (60 reactions,
final concentration of 100µM) or water (misincorporation control)
followed by addition of 2.5 µL of Kf (exo-) in reaction buffer. Reaction
conditions were as follows: 80 nM primer, 40 nM template, 0.4 nM
Kf, 10 µM natural dNTPs, 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2,
1 mM DTT, and 50 µg/mL acetylated BSA. A negative control, in the
absence of dNTPs, and a positive control, where dX ) dA, were run
simultaneously to all experiments. The reaction was incubated at
25 °C for 1 h and quenched by addition of 10 µL of quenching solution
(25 mM Tris-HCl (pH 7.5), 5 mM EDTA, 2× SYBR Green I
(Invitrogen)) and then incubated for 4 min in the dark, and the
fluorescence intensities were quantified using a fluorescence plate reader
(Spectra MAX Gemini, Molecular Devices) with excitation at 485 nm
and emission at 538 nm. The ratio of fluorescence in the reaction
containing both dNTPs and dXTP to the fluorescence of the reaction
only containing dNTPs was used as a measure of both efficiency and
selectivity of full length synthesis.
Extension Screen - Primer Group:Template Screening. Primers,
varying at position X of the sequence 5′-dTAA TAC GAC TCA CTA
TAG GGA GAX-3′, were grouped into 10 groups based loosely on
their functional groups and general shape. Primer pools consisting of
(n) nucleobases were constructed by equally representing all primers
(final concentration of each individual primer ) 1 µM/n) into a pool
with a total DNA concentration of 1 µM. Primer pools were 5′
radiolabeled with [γ33P]-ATP (GE Healthcare) and T4 polynucleotide
kinase (New England Biolabs). Primer pools were annealed with 2-fold
excess template of the complementary sequence, 3′-dATT ATG CTG
AGT GAT ATC CCT CTY GCT AGG TTA CGG CAG GAT CGC-
5′, in the reaction buffer by heating to 90 °C and slow cooling to room
temperature. Assay conditions include the following: 40 nM total
primer-template duplex, 0.3 nM enzyme, 50 mM Tris buffer (pH 7.5),
10 mM MgCl2, 1 mM DTT, 50 µg/mL BSA, 400 µM dCTP. Prior to
reaction, dCTP was mixed with enzyme, and the reactions were initiated
by adding the dCTP-enzyme mixture to an equal volume (5 µL) of a
2× DNA stock solution, incubated at 25 °C for 5 min, and quenched
with 20 µL of loading buffer (95% formamide, 20 mM EDTA). The
reaction mixture (3 µL) was then analyzed by 15% polyacrylamide
gel electrophoresis. Radioactivity was quantified using a Phosphorim-
ager (Molecular Dynamics) with overnight exposures and the Im-
ageQuant program. Percent conversion was defined as the ratio of singly
extended product to the sum of the singly extended product and the
unextended product. The top 7% of the pairs were carried on to
individual primer:template analysis.
Extension Screen - Individual Primer:Template. Individual
primer, in the same sequence context as above, was 5′ radiolabeled
with [γ33P]-ATP and T4 polynucleotide kinase. Primer-template
duplexes were annealed in the reaction buffer by heating to 90 °C and
slow cooling to room temperature. Assay conditions were as follows:
40 nM template-primer duplex, 0.3 nM enzyme, 50 mM Tris buffer
(pH 7.5), 10 mM MgCl2, 1 mM DTT, and 50 µg/mL BSA. The
reactions were initiated by adding the DNA-enzyme mixture to an
equal volume (5 µL) of a 2× dNTP stock solution resulting in a final
concentration of 0, 10, 100, or 1000 µM dCTP, incubated at 25 °C for
5 min, and quenched with 20 µL of loading buffer (95% formamide,
20 mM EDTA). The reaction mixture (8 µL) was then analyzed by
15% polyacrylamide gel electrophoresis. Radioactivity was quantified
using a Phosphorimager (Molecular Dynamics) with overnight expo-
General Steady-State Kinetic Assay Protocol. Experiments were
performed as in Extension Screen - IndiVidual Primer:Template with
the following exceptions. To ensure steady-state conditions,35 enzyme
concentrations ranged from 0.06 to 1.2 nM Kf and incubation times
ranged from 2 to 12 min. Additionally, each experiment used nine
triphosphate concentrations to more accurately calculate KM. Data
presented are the result of triplicate experiments.
Acknowledgment. Funding was provided by the National
Institutes of Health (GM60005 to F.E.R.) and the Uehara
Memorial Foundation (Y.H.).
Supporting Information Available: Details of synthetisis and
characterization of nucleotides; additional kinetic data. This
material is available free of charge via the Internet at
http://pubs.acs.org.
JA078223D
9
J. AM. CHEM. SOC. VOL. 130, NO. 7, 2008 2343