(Methylsulfanyl)alkanoate ester biosynthesis in Actinidia chinensis kiwifruit and changes during cold storage

Article abstract of DOI:10.1016/j.phytochem.2010.01.016

Four 3-(methylsulfanyl)propionate esters, ethyl 3-(methylsulfanyl)prop-2-enoate, two 2-(methylsulfanyl)acetate esters and their possible precursors 2-(methylsulfanyl)ethanol, 3-(methylsulfanyl)propanol and 3-(methylsulfanyl)propanal were quantified from the headspace of Actinidia chinensis 'Hort 16A' kiwifruit pulp by GC-MS-TOF analysis. The majority of these compounds were specific for eating-ripe fruit and their levels increased in parallel with the climacteric rise in ethylene, accumulating towards the very soft end of the eating firmness. No ethylene production could be observed after long-term storage (4-6 months) at 1.5 °C and the levels of all methylsulfanyl-volatiles, except methional, declined by 98-100% during that period. This depletion of (methylsulfanyl)alkanoate-esters after prolonged cold storage points towards little flavour impact of these compounds on commercial 'Hort 16A' kiwifruits. However, ethyl 3-(methylsulfanyl)propionate is suggested to be odour active in ripe 'Hort 16A' fruit that has not been stored. Gene expression measured by q-RT PCR of six ripening-specific alcohol acyltransferase (AAT) expressed sequence tags and (methylsulfanyl)alkanoate-ester production of cell-free extracts were also significantly decreased after prolonged cold storage. However, (methylsulfanyl)alkanoate-ester synthesis of cell-free extracts and AAT gene transcript levels could be recovered by ethylene treatment after five months at 1.5 °C indicating that the biosynthesis of (methylsulfanyl)alkanoate-esters in 'Hort 16A' kiwifruit is likely to depend on ethylene-regulated AAT-gene expression. That the composition but not the concentration of (methylsulfanyl)alkanoate-esters in fresh fruit could be restored after ethylene treatment suggests that substrate availability might also have an impact on the final levels of these volatiles.

Full text of DOI:10.1016/j.phytochem.2010.01.016

Phytochemistry 71 (2010) 742–750
Contents lists available at ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
(Methylsulfanyl)alkanoate ester biosynthesis in Actinidia chinensis kiwifruit
and changes during cold storage
b
a
c
Catrin S. Günther a, , Adam J. Matich , Ken B. Marsh , Laura Nicolau
*
a The New Zealand Institute for Plant and Food Research Ltd., Private Bag 92169 Auckland, New Zealand
b The New Zealand Institute for Plant and Food Research Ltd., Private Bag 11600 Palmerston North, New Zealand
c Department of Chemistry, The University of Auckland, Private Bag 92019 Auckland, New Zealand
a r t i c l e i n f o
a b s t r a c t
Article history:
Four 3-(methylsulfanyl)propionate esters, ethyl 3-(methylsulfanyl)prop-2-enoate, two 2-(methylsulfa-
nyl)acetate esters and their possible precursors 2-(methylsulfanyl)ethanol, 3-(methylsulfanyl)propanol
and 3-(methylsulfanyl)propanal were quantified from the headspace of Actinidia chinensis ‘Hort 16A’
kiwifruit pulp by GC–MS–TOF analysis. The majority of these compounds were specific for eating-ripe
fruit and their levels increased in parallel with the climacteric rise in ethylene, accumulating towards
the very soft end of the eating firmness. No ethylene production could be observed after long-term stor-
age (4–6 months) at 1.5 °C and the levels of all methylsulfanyl-volatiles, except methional, declined by
98–100% during that period. This depletion of (methylsulfanyl)alkanoate-esters after prolonged cold stor-
age points towards little flavour impact of these compounds on commercial ‘Hort 16A’ kiwifruits. How-
ever, ethyl 3-(methylsulfanyl)propionate is suggested to be odour active in ripe ‘Hort 16A’ fruit that has
not been stored. Gene expression measured by q-RT PCR of six ripening-specific alcohol acyltransferase
(AAT) expressed sequence tags and (methylsulfanyl)alkanoate-ester production of cell-free extracts were
also significantly decreased after prolonged cold storage. However, (methylsulfanyl)alkanoate-ester syn-
thesis of cell-free extracts and AAT gene transcript levels could be recovered by ethylene treatment after
five months at 1.5 °C indicating that the biosynthesis of (methylsulfanyl)alkanoate-esters in ‘Hort 16A’
kiwifruit is likely to depend on ethylene-regulated AAT-gene expression. That the composition but not
the concentration of (methylsulfanyl)alkanoate-esters in fresh fruit could be restored after ethylene
treatment suggests that substrate availability might also have an impact on the final levels of these
volatiles.
Received 1 December 2009
Received in revised form 27 January 2010
Available online 25 February 2010
Keywords:
Actinidia chinensis, Ethylene
(Methylsulfanyl)alkanoate-ester
Tropical flavour
Methional
Dynamic headspace sampling
GC–MS–TOF
Cold storage
Alcohol acyltransferase
Quantitative real-time PCR
Cell-free extracts
Odour activity value
Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction
acetate has previously been quantified in A. deliciosa ‘Hayward’
kiwifruit puree by Jordan et al. (2002) and an aroma impact was
Since 1998, the novel kiwifruit cultivar Actinidia chinensis ‘Hort
16A’ has been commercially available under the trade name ZE-
SPRIÒ GOLD. This cultivar is distinguished from the green variety
not only by its yellow flesh colour but also by a sweeter taste with
a tropical, fruity aroma reminiscent of melon, mango and banana
(Jaeger et al., 2003). (Methylsulfanyl)alkanoate (MeS) esters, in
particular methyl and ethyl 3-MeS-propionate as well as ethyl 2-
MeS-acetate, display fruity, sweet and tropical odour characteris-
tics (Burdock, 2004) and were reported to occur in several tropical
fruits like pineapple (Takeoka et al., 1989), passion fruit (Werkhoff
et al., 1998), Asian pear (Takeoka et al., 1992) and durian fruit
(Weenen et al., 1996). Wyllie and Leach (1992) assigned these
compounds together with MeS-alkyl acetates a significant impact
on the characteristic aroma of certain melon cultivars due to their
odour activity values (OAV). Moreover, methyl and ethyl 2-MeS-
described for the cooked nut or roasted oil odour of the first ester
using GC–O.
General fruit ester production by alcohol acyltransferases
(AATs) has been studied in apple (Souleyre et al., 2005; Matich
and Rowan, 2007), banana (Wyllie and Fellman, 2000), strawberry
(Olias et al., 2002) and melon (El-Sharkawy et al., 2005). It was
shown that recombinant Cucumis melo AATs were capable of
using MeS-alcohols as substrates for ester synthesis with acetyl-
CoA (Lucchetta et al., 2007) but (MeS)alkyl-CoAs have never been
tested as substrates for ester synthesis. In apple and melon, the
gene expression of ripening-specific AATs appeared to be regu-
lated by ethylene (Yahyaoui et al., 2002; Schaffer et al., 2007)
and the production of volatile esters has also been correlated with
ethylene synthesis in these climacteric fruit (Aubert and Bourger,
2004; Johnston et al., 2009). Kiwifruit in general is known to pro-
duce climacteric ethylene during ripening but only very low lev-
els can be detected during cold storage of A. chinensis ‘Hort 16A’
(Patterson et al., 2003) which is the common postharvest practice
* Corresponding author. Tel.: +64 9 9257265; fax: +64 9 9257001.
E-mail address: Catrin.Guenther@plantandfood.co.nz (C.S. Günther).
0031-9422/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2010.01.016

C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
743
to maintain flesh firmness. Kiwifruit firmness is widely used as
2. Results and discussion
the defining character for ripeness and the non destructive acous-
tic firmness sensor (AFS) was suggested as a suitable alternative
to destructive devices for monitoring textural changes of ‘Hort
16A’ kiwifruit during storage (Schotsmans et al., 2008). The AFS
measures fruit stiffness in 106 Hz2 g2/3 and to date there is no
equation available to express kiwifruit stiffness in N. However,
‘Hort 16A’ fruit are considered as eating-ripe between 10 and
4 Â 106 Hz2 g2/3 using the instrument parameters applied in this
study.
The intention of this work was firstly to study the levels of
MeS-volatiles during ripening of A. chinensis ‘Hort 16A’ and after
cold storage in regards to fruit ethylene production. Secondly,
we were aiming to test whether (MeS)alkanoate esters can be
synthesised by ripening-specific AATs and if gene expression of
these enzymes is influenced by chilling and ethylene. Thirdly, it
was of interest to use the quantitative MeS-volatile data to obtain
a first indication of their potential impact on the tropical flavour
of eating-ripe fruit.
2.1. Methylsulfanyl (MeS)-volatiles accumulate during softening of
eating-ripe ‘Hort 16A’ kiwifruit
Methyl, ethyl, propyl, and butyl esters of 3-MeS-propionic acid,
methyl and ethyl 2-MeS-acetate, ethyl 3-MeS-prop-2-enoate, 2-
MeS-ethanol, 3-(methylsulfanyl)propanol (methionol) and 3-
(methylsulfanyl)propanal (methional) (Fig. 1) were quantified in
A. chinensis ‘Hort 16A’ using GC–MS–TOF after dynamic headspace
sampling. None of these compounds could be detected in unripe
fruit after harvest at 38 Â 106 Hz2 g2/3 and only methyl and ethyl
2-MeS-acetate and methional (Fig. 2B and D) were present, at
low concentrations (<0.5 l
g kgÀ1), before ‘Hort 16A’ kiwifruit had
softened to eating firmness. As shown in Fig. 2A–D most MeS-vol-
atiles just appeared to be detectable in eating-ripe fruit after the
climacteric rise in ethylene production. In fact, all MeS-compounds
increased with fruit softness, except methyl 2-MeS-acetate,
which displayed highest levels (0.42 0.01 l ) in firm
g kgÀ1
Fig. 1. Structures of MeS-volatiles quantified in Actinidia chinensis ‘Hort 16A’ kiwifruit and the corresponding deuterium-labelled internal standard.

744
C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
Fig. 2. Ethylene production and direct quantification of MeS volatiles in non-stored ‘Hort 16A’ with respect to fruit firmness during ripening. Error bars: Standard deviations
of means; MeS-volatiles: four replicates; ethylene: six biological replicates; me/et/pr/bu: methyl/ethyl/propyl/butyl; MeS: methylsulfanyl; ac: acetate; prop: propionate;
propEN: prop-2-enoate; 2MeSOH: 2-MeS-ethanol; FW: fresh weight.
(8 Â 106 Hz2 g2/3) eating-ripe fruit, and dropped to under the
detection limit during further ripening (Fig. 2B). Peak levels of
MeS-volatiles were quantified in soft fruit (4 Â 106 Hz2 g2/3) with
before storage. These results are in good agreement with those of
Young and Paterson (1985), who observed that fruit volatiles –
especially total esters – increased in Actinidia deliciosa ‘Hayward’
kiwifruit with fruit softness, but decreased with storage time at
0 °C prior to ripening. Methional, however, was less affected by
chilling (3–5-fold decrease in concentration), and remained pres-
ent during the whole storage trial even after methionol concentra-
tions were below detection limit. In lactic acid bacteria methional
can act as an intermediate for 3-MeS-propionic acid formation
from methionine (Pripis-Nicolau et al., 2004; Landaud et al.,
2008; Vallet et al., 2008) and a similar role could be possible in
plants. In this situation, methional would act as a biosynthetic
precursor for AAT substrates, namely 3-MeSpropionyl- and
2-MeS-acetyl-CoA, from 3-MeS-propionic acid.
ethyl 3-MeS-propionate being the main ester (168 6.7 l )
g kgÀ1
and methionol 429 25.8 l
g kgÀ1) being the major MeS-com-
pound in ‘Hort 16A’ fruit pulp. Friel et al. (2007) reported that
the levels of most fruit esters, especially ethyl esters, increased
during ripening with high levels in soft ‘Hort 16A’ fruit and this
was also found to be the case for (MeS)alkanoate-esters in this
study, indicating that these compounds are specific for eating ripe
A. chinensis kiwifruit.
2.2. The effect of cold storage on MeS-volatile production
After one month at 1.5 °C, the composition and concentration of
all MeS-volatiles in eating-ripe ‘Hort 16A’ fruit decreased dramat-
ically (Table 1) and only methyl esters of 2-MeS-acetic acid and 3-
MeS-propionic acid could be detected in firm, eating-ripe fruit
(8 Â 106 Hz2 g2/3) with levels corresponding to 10% and 20% of
those present in non-stored fruit respectively. After two months
of cold storage, methional was the only MeS-volatile detectable
at this firmness and its levels remained constant until six months
2.3. Ethylene production of ‘Hort 16A’ kiwifruit is altered by cold
storage
Interestingly, the pattern of ethylene production was also al-
tered after cold storage (Fig. 3). For instance there was a 25-fold
decrease of ethylene levels measured in firm, eating-ripe fruit
(8 Â 106 Hz2 g2/3) from the first to the second month of cold stor-
age and no ethylene could be detected in eating ripe ‘Hort 16A’
after four months at 1.5 °C. In non-stored fruit, a climacteric peak
of ethylene production was observed within the eating firmness
range that appeared in parallel to MeS-volatile production
(Fig. 2A), suggesting a link between this hormone and fruit ester
production. Low levels (0.023 0.008 ppm gÀ1 hÀ1) of ethylene
were detectable using GC-FID just before the fruit had reached eat-
ing firmness (12 Â 106 Hz2 g2/3) and ethylene levels increased dur-
ing softening to peak concentrations (0.33 0.07 ppm gÀ1 hÀ1) at
5 Â 106 Hz2 g2/3, with a further decline towards the very soft
at 1.5 °C when a twofold increase (12.8 2.2
l
g kgÀ1) was ob-
g kgÀ1
served compared with levels in non-stored fruits (6.6
1
l
)
at 8 Â 106 Hz2 g2/3. In addition, volatile levels of ethyl 3-MeS-pro-
pionate (0.19 0.01 l ) and ethyl 2-MeS-acetate (0.11
g kgÀ1
0.002 l
g kgÀ1) that corresponded to about 56% and 61% of those
before storage could be quantified after six months.
The composition of MeS-volatiles in very soft kiwifruit
(4 Â 106 Hz2 g2/3) after one month at 1.5 °C did not change (Table 1)
but their levels were significantly reduced for up to 95% (ethyl 3-
MeS-propionate; 8.3 l
g kgÀ1), followed by a further gradual de-
cline with storage time at 1.5 °C. After four months of cold storage,
only trace amounts of ethyl 2-MeS-acetate and ethyl 3-MeS-propi-
onate esters remained detectable, at levels less than 3% of those
end of the eating firmness range (4 Â 106 Hz2 g2/3
, 0.14
0.02 ppm gÀ1 hÀ1). The depletion of ethylene production by ‘Hort
16A’ after cold storage is unlikely to depend on the actual length

Table 1
MeS-volatile concentrations (
l
g kgÀ1) in ‘Hort 16A’ kiwifruit at firmness 8 and 4 Â 106 Hz2 g2/3 before and after cold storage at 1.5 °C. SD%: Standard deviation of four technical replicates given in%; 0m8. . .6m8: 0. . .6 months at 1.5 °C,
ripened to 8 Â 106 Hz2 g2/3; 0m4. . .6m4: 0. . .6 months at 1.5 °C, ripened to 4 Â 106 Hz2 g2/3; 4c8: 4 months of softening to 8 Â 106 Hz2 g2/3 at 1.5 °C; 6c4: 6 months of softening to 4 Â 106 Hz2 g2/3 at 1.5 °C; 5et4: ethylene treatment after
5 months at 1.5 °C, ripened to 4 Â 106 Hz2 g2/3; nd: not detectable. [1] Aubert and Bourger, 2004); [2] Steinhaus et al., 2009; [3] Takeoka et al., 1989; [4] Ferreira et al., 2005; [5] Takeoka et al., 1991.
Methyl 2-(methyl Ethyl 2-(methyl
sulfanyl) acetate sulfanyl) acetate
Methional
Methyl 3-(methyl
sulfanyl)
2-(Methyl
Ethyl 3-(methyl
Propyl 3-(methyl
sulfanyl)
Methionol
Ethyl 3-(methyl
sulfanyl) prop-2-
enoate
Butyl 3-(methyl
sulfanyl)
sulfanyl) ethanol sulfanyl)
propionate
propionate
propionate
propionate
C(l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD% C(
l
g kgÀ1
)
SD%
0m8
1m8
2m8
3m8
4m8
4c8
5m8
6m8
0m4
1m4
2m4
3m4
4m4
5m4
6m4
6c4
0.35
0.03
nd
nd
nd
nd
nd
nd
nd
0.08
0.04
0.02
0.01
nd
nd
nd
0.02
10
10
–
–
–
–
–
–
–
8
32
4
8
–
–
–
9
0.18
nd
nd
nd
0.07
nd
0.08
0.11
3.25
0.27
0.14
0.37
0.08
0.08
0.08
0.06
0.28
5
–
–
–
2
–
3
2
3
3
6
4
1
1
2
1
2
6.6
5.4
15
9
28
14
7
27
18
17
16
14
13
15
9
15
11
14
19
0.23
0.04
nd
nd
nd
nd
nd
nd
4.57
1.17
0.25
0.12
0.04
nd
nd
nd
0.14
180
[3]
12
5
–
–
–
–
–
–
8
nd
–
–
–
–
–
–
–
–
10
9
10
10
–
–
–
–
–
0.34
nd
nd
nd
0.13
nd
0.09
0.19
168
8.4
2.1
3.4
8
–
–
–
22
–
15
5
4
3
9
10
9
10
12
–
nd
–
–
–
–
–
–
–
–
24
9
–
–
–
–
–
–
–
nd
–
–
–
–
–
–
–
–
6
4
22
5
–
–
–
–
13
nd
–
–
–
–
–
–
–
–
4
9
–
4
–
–
–
–
7
nd
–
–
–
–
–
–
–
–
8
3
2
–
–
–
–
–
–
nd
nd
nd
nd
nd
nd
nd
42.8
12.4
8.5
3.6
nd
nd
nd
nd
nd
nd
nd
nd
0.06
0.04
nd
nd
nd
nd
nd
nd
nd
nd
nd
nd
nd
nd
nd
nd
429
61.3
25.7
15.2
nd
nd
nd
nd
22.1
2500
[4]
nd
nd
nd
nd
nd
nd
nd
1.5
0.12
nd
0.09
nd
nd
nd
nd
0.10
246
[5]
nd
nd
nd
nd
nd
nd
nd
0.21
0.15
0.12
nd
7.6
2.7
4.2
3.3
6.1
12.8
62.3
18
4
15.2
9.8
9.7
15
13
7
–
–
0.27
0.13
0.12
nd
nd
nd
nd
nd
6.8
nd
nd
nd
nd
18.9
19.9
22.9
0.43
[2]
–
8
5et4
Odour
threshold
3.56
8
nd
25
l
g kgÀ1
l
g kgÀ1
l
g kgÀ1
7
l
g kgÀ1
l
g kgÀ1
l
g kgÀ1
[1]
[3]

746
C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
nine biosynthetic pathway, since the later metabolites were
shown to increase resistance to cold stress in certain crops (Szego
and Horvath, 2007; Cuevas et al., 2008; Groppa and Benavides,
2008).
2.4. Gene expression of putative AATs is regulated by ethylene in A.
chinensis ‘Hort 16A’
Gene transcription of MpAT1, an AAT that has been previously
reported to be of importance for ‘Royal Gala’ apple fruit flavour
(Souleyre et al., 2005), was shown to be regulated by ethylene
(Schaffer et al., 2007). Yahyaoui et al. (2002) reported that gene
expression of CmAAT1 from melon increased during ripening and
furthermore, that transcript levels were reduced in fruit treated
with 1-MCP, as well as in antisense amino-cyclopropane-oxidase
fruit, which points towards a regulatory role of ethylene for AAT
gene transcription in climacteric fruit. Six Actinidia Expressed Se-
quence Tags (ESTs) with putative flavour-related AAT function dis-
play high sequence homology to those genes mentioned above and
to each other (Crowhurst et al., 2008). The gene transcription of
AT15, AT18, AT2, AT17 AT1 and AT16 in A. chinensis ‘Hort 16A’
kiwifruit was measured using quantitative Real-Time PCR. In un-
ripe fruit (38 Â 106 Hz2 g2/3), gene expression of these ESTs could
not be observed apart from low levels of AT16 (Fig. 4A). Additional
transcripts (AT2, AT17, AT1) were detectable before fruit had soft-
ened to eating firmness (15 Â 106 Hz2 g2/3) and transcripts of AT15
and AT18 occurred only in eating-ripe fruit (8–4 Â 106 Hz2 g2/3).
This suggests an impact of AT2, AT17, AT1, AT15 and AT18 on fla-
vour-related fruit ester production, which could involve MeS-es-
ters. After short-term cold storage for one month, gene
expression of AT2, AT17 AT1 and AT16 was significantly reduced
in fruit at 8 Â 106 Hz2 g2/3 (Fig. 4B), but transcripts of these ESTs
in soft, eating-ripe fruits (4 Â 106 Hz2 g2/3) displayed similar levels
to those before storage, except for AT2 transcripts, which appeared
to be twofold reduced. Thus, after five months at 1.5 °C, only tran-
scripts of AdAt2 and AcAT16 with levels < 1% and 50%, respectively
could be detected in eating-ripe ‘Hort 16A’ fruit (8 and
4 Â 106 Hz2 g2/3) in comparison with non-stored fruit. However,
ethylene treatment of long-term stored fruit prior to ripening
was able to increase gene transcription of all ESTs to the levels be-
fore storage or after one month at 1.5 °C, suggesting that transcrip-
tion of those Actinidia (ESTs) is regulated by ethylene.
Fig. 3. Ethylene production of cold-stored fruit.
not ripened;
ripened to
8 Â 106 Hz2 g2/3
;
ripened to 4 Â 106 Hz2 g2/3
;
ethylene-treated and
ripened to 4 Â 106 Hz2 g2/3. Error bars: Standard deviations of the means of six
biological replicates.
of ripening time at 20 °C (data not shown); for example, after two
months of chilling, fruit at 8 and 4 Â 106 Hz2 g2/3 were both rip-
ened for 13 days but soft, eating-ripe fruit produced 200-fold more
ethylene than firm, eating-ripe fruit. After an additional two
months at 1.5 °C, fruit were ripened for 11 days to 4 Â 106 Hz2 g2/
3 but ethylene was not detectable at all. During the six-month stor-
age trial, ethylene production was never observed for fruit that had
been taken directly from cold storage without ripening, suggesting
that the biosynthesis of this ripening hormone in ‘Hort 16A’ is
inhibited by chilling at 1.5 °C. Ritenour et al. (1999) discovered that
ethylene preconditioning of A. deliciosa at 0 °C within the first two
weeks of cold storage induced fruit softening but at a 2-fold slower
rate than observed for fruit which were ethylene treated at 20 °C
prior to cold storage. Moreover, the softening pattern of green
kiwifruit that were kept for at least three weeks at 0 °C prior to
preconditioning was not altered in comparison with non-treated
fruit. On the other hand, Antunes and Sfakiotakis (2002) stated that
short-term chilling (0–10 °C) for 12 days of ‘Hayward’ kiwifruit
actually enhanced the onset of ethylene production in parallel with
its precursor and biosynthetic enzymes after re-warming. How-
ever, since the effects of mid and long-term storage were not inves-
tigated by these authors, the impact of prolonged chilling on
ethylene biosynthesis in kiwifruit remains to be elucidated.
It would be interesting to investigate whether the lack of ethyl-
ene production in cold stored ‘Hort 16A’ fruit is due to increased
competition for S-adenosyl-methionine (Crowhurst et al.), a com-
mon precursor of the ethylene, polyamine and S-methyl-methio-
2.5. Ripening-specific AATs produce MeS-esters in ‘Hort 16A’ kiwifruit
In ‘Hort 16A’ kiwifruit most MeS volatiles could be restored but
to a much lower level by ethylene treatment after five months of
Fig. 4. Relative transcript levels of six Actinidia AAT ESTs relative to Ubiquitin9 in non-stored and stored ‘Hort 16A’ kiwifruit. Error bars: Standard errors of the means of three
biological with two technical replicates each. 0m38. . .4: no storage, 38. . .4 Â 106 Hz2 g2/3; 1m4. . .5m4: 1 month and 5 months, ripened to 4 Â 106 Hz2 g2/3; 1m8. . .5m8:
1 month and 5 months, ripened to 8 Â 106 Hz2 g2/3; 5et4: 5 months at 1.5 °C, ethylene-treated and ripened to 4 Â 106 Hz2 g2/3
.

C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
747
cold storage (Table 1). For example, in soft eating-ripe fruit
(4 Â 106 Hz2 g2/3), volatile levels of ethyl 2-MeS-acetate could be
restored to 8%, methyl 3-MeS-propionate to 3% and ethyl 3-MeS-
propionate to 2% compared with those before storage, or 100%,
10% and 40% after one month at 1.5 °C, respectively. Therefore, it
was of interest to investigate whether this was caused by reduced
enzyme activity or depletion of substrates. We hypothesised that
2-MeS-acetate and 3-MeS-propionate esters are formed by AATs
using straight chain alcohols and the corresponding MeS alkyl-
CoA that was added to cell-free protein extracts. Ethyl, propyl, bu-
tyl 2-MeS-acetates and 3-MeS-propionates were produced by
crude extracts from non-stored eating-ripe fruit and after one
month at 1.5 °C (Fig. 5), indicating that MeS-esters in ‘Hort 16A’
are produced by AATs. In addition, there was no MeS-ester produc-
tion in cell-free extracts from unripe fruit (38 Â 106 Hz2 g2/3) and
after five months of cold storage (4 Â 106 Hz2 g2/3), pointing to-
wards AAT depletion. However, protein extracts from soft eating-
ripe fruit (4 Â 106 Hz2 g2/3) that had been ethylene-treated after
five months at 1.5 °C were able to produce MeS-esters at similar
levels to cell-free extracts of ‘Hort 16A’ fruit after one month of
cold storage. This finding correlates with changes in gene expres-
sion but not with volatile levels of fresh fruit, suggesting reduced
MeS alkyl-CoA or alcohol levels in ethylene-treated kiwifruit after
five months of chilling.
of methional are associated with off-flavours and mainly caused by
chemical oxidation of methionol (Escudero et al., 2000). In this
study, headspace volatiles were trapped with air for 20 h and oxi-
dation products as artefacts can therefore not be excluded.
Ethyl 3-MeS-propionate on the other hand only exceeds its
odour thresholds in soft, eating-ripe (4 Â 106 Hz2 g2/3) ‘Hort 16A’
kiwifruit with an estimated odour activity value (OAV) of 24 in
non-stored fruit and an OAV of 1 after one month at 1.5 °C. But
the concentration of this tropical, sweet odorant stayed well below
odour threshold after further storage at 1.5 °C. However, OAVs that
are generally estimated from odour thresholds in a simplified ma-
trix should only be seen as indicative means for the aroma impact
of an individual compound. For a better understanding of the im-
pact different volatiles can have on the overall aroma, matrix influ-
ence (Marsh et al., 2006) and the interaction between volatile
compounds (Escudero et al., 2007) need to be considered. Further-
more, Escudero et al. (2004) demonstrated a key role of low OAV
compounds on wine aroma and more recent research showed that
volatiles of the same chemical family, which occurred below odour
threshold, produced a quite specific odour impression probably
due to additive effects (Pineau et al., 2009). These findings make
the use of OAVs as critical parameter even more controversial.
Whether MeS-volatiles contribute to the tropical flavour of A. chin-
ensis ‘Hort 16A’ kiwifruit would therefore have to be investigated
using a systematic GC-O approach and aroma reconstitution stud-
ies. However, since commercial ‘Hort 16A’ kiwifruit is often stored
for up to nine months, a contribution of (MeS)alkanoate-esters on
the aroma of long-term stored fruits seems very unlikely, since the
levels of these compounds markedly decreased below the detec-
tion limit with storage time. Therefore, it would be of interest to
investigate the impact of cold storage on the general flavour per-
ception of ‘Hort 16A’. Also because total ester production is likely
to be influenced by decreased AAT gene expression and enzyme
activity.
2.6. The potential impact of methylsulfanyl (MeS)-volatiles on ‘Hort
16A’ flavour
In this study MeS-volatiles occurred in trace amounts in ‘Hort
16A’ kiwifruit pulp. Literature values of odour thresholds for most
MeS-volatiles in water or synthetic wine (methionol) are listed in
Table 1 and it becomes obvious that methional is the only MeS-
compound that exceeds its odour threshold in firm and soft eat-
ing-ripe fruit after cold storage for at least six months. This mashed
potato or soup-like odorant was reported to be aroma-active in
non-processed pink guava (Steinhaus et al., 2008), lychee (Mahat-
tanatawee et al., 2007) and one blackberry cultivar (Klesk and Qian,
2003). However, since methional levels are also above odour
threshold in unripe fruit (33 Â 106 Hz2 g2/3), its impact on the char-
acteristic flavour of ripe fruit can be questioned. In wine, high OAVs
3. Concluding remarks
It can be concluded that most MeS-volatiles specifically occur in
eating-ripe A. chinensis ‘Hort 16A’ kiwifruit and increase during
softening. Cold storage in general leads to a marked decrease of
(MeS)alkanoate-esters and AAT transcript levels, which can be par-
tially restored by ethylene treatment. This finding was confirmed
by (MeS)alkanoate-ester production of cell-free extracts with
added (MeS)alkyl-CoAs and alcohols. Therefore, we suggest that
(MeS)alkanoate-ester production in ‘Hort 16A’ kiwifruit is likely
to depend primarily on gene expression of ripening-specific AATs,
which was regulated by ethylene and inhibited by prolonged cold
storage. On the basis of estimated OAVs ethyl 3-MeS-propionate
appears to be the only odour active MeS-ester primarily in soft,
non-stored fruits. But if (MeS)alkanoate-esters contribute to char-
acteristic aroma notes of non or short-term stored ‘Hort 16A’ – for
instance due to cumulative or synergistic effects- will have to be
investigated. Finally, the changes in MeS-volatile levels with ripen-
ing stage and storage time also demonstrate the impact of posthar-
vest treatment on fruit volatiles and potential flavour abundance.
4. Experimental
4.1. Materials and methods
Actinidia chinensis ‘Hort 16A’ kiwifruit from three different
growers were harvested in 2008 at commercial maturity (Satara
Kiwifruit Supply Ltd., Bay of Plenty, New Zealand), colour-condi-
tioned for five days at 5 °C and randomized. A random sample of
the fruit was ripened at 20 °C and sampled according to their
Fig. 5. MeS-ester production of cell-free protein extract from ‘Hort 16A’ kiwifruit.
Error bars: Standard deviations of the average of two biological replicates. 0m38: no
storage, 38 Â 106 Hz2 g2/3; 0m4: no storage, 4 Â 106 Hz2 g2/3; 1m4. . . 5m4: 1 and
5 months at 1.5 °C, 4 Â 106 Hz2 g2/3, 5et4: 5 months at 1.5 °C, ethylene-treated and
ripened to 4 Â 106 Hz2 g2/3
.

748
C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
firmness using AWETAÒ acoustic firmness sensor (microphone
gain:80, thick power:16). The other fruit were cold stored at
1.5 °C for six months and monthly samples were taken without rip-
ening as well as after ripening to an average firmness of 8 and
4 Â 106 Hz2 g2/3, respectively. An additional sample was treated
with 100 ppm ethylene for 24 h after five months of cold storage
and ripened to 4 Â 106 Hz2 g2/3. At each time-point, kiwifruit pulp
from 25 to 30 fruit was snap frozen with liquid nitrogen, pulver-
ized with a stone crusher (Rocklabs, New Zealand) and stored at
À80 °C prior to sampling.
(100), 41 (51), 56 (37), 57 (30), 162 (28, M+), 106 (21), 42 (15),
60 (12), 35 (12), 62 (11), 45 (10), 46 (10), 39 (9), 47 (7), 43 (7).
The internal standard, ethyl 3-([D3]-methylsulfanyl)propionate
(Fig. 1), was synthesised by reaction of CD3I with ethyl 3-merca-
ptopropionate according to Sen and Grosch (1991), and was puri-
fied (97.5%) by distillation at 65 °C under reduced pressure. EI–
MS, m/z (rel. int.): 77 (100), 64 (71), 151 (58, M+), 78 (48), 106
(20), 43 (19), 55 (16), 49 (13), 46 (12), 80 (11), 59 (11), 50 (10),
45 (10).
For the synthesis of [D5]ethyl 2-(methylsulfanyl)acetate (Fig. 1),
1.58 mmol of 2-(methylsulfanyl)acetic anhydride (5.74 mmol 2-
(methylsulfanyl)acetic acid and 3.15 mmol dicyclohexylcarbodiim-
ide reacted as described above) were stirred with 1.75 mmol d6-
ethanol and p-toluene sulfonic acid (5 mg) for 3 h under N2. Pen-
tane (10 ml) was added to the reaction mixture, which was then
quenched with 2 Â 10 ml saturated NaHCO3 (aq.). The aqueous
layer was extracted twice with 5 ml pentane before combining
and drying (MgSO4) the organic fractions. After the solvent was re-
moved, the product was purified (>99%) by distillation at 50 °C un-
der reduced pressure. EI–MS, m/z (rel. int.): 61 (100), 139 (82, M+),
93 (56), 63 (9), 45 (6), 74 (5), 140 (5), 46 (4), 141 (4), 73 (4).
4.2. Ethylene production
Six fruit per sample were individually placed in an airtight plas-
tic container with rubber seal aperture. In addition, one empty con-
tainer was prepared as a control. After one hour, 1 ml was taken
from the headspace with a syringe and directly injected into a Phil-
lips PU 4500 GC with 1.5 m  6 mm  4 mm 80/100 mesh acti-
vated alumina F1 column (Pye unicam) and FID-detector (210 °C)
that was calibrated with 1 ppm ethylene standard. The injector
and column temperature were set at 130 °C.
4.3.2. Dynamic headspace sampling
4.3. Headspace volatile analysis
Four replicates, each containing 10 g of pulverized ‘Hort 16A’
fruit pulp, 1 ll of each deuterated internal standard (10 mM),
4.3.1. Standard compounds
and 0.1 mM of Paraoxon (Sigma–Aldrich) were prepared in
250 ml Erlenmeyer flasks (Quick Fit™). The addition of the carbox-
yesterase inhibitor Paraoxon significantly increased peak areas of
MeS-esters as well as [D5]-ethyl 2-(methylsulfanyl)acetate and
was therefore crucial for quantification. After sealing the equip-
ment hermetically, dry air (BOC) was purged through the system
with a flow rate of 30 ml minÀ1 and headspace volatiles were
trapped with 100 mg TenaxÒ-TA resin for 20 h at room tempera-
ture. Prior to sampling, the TenaxÒ-filled direct thermal desorption
(DTD) vials (ATAS GL International) were conditioned for two
Stock solutions (10 mM) of all standards were prepared in iso-
propanol and stored at À20 °C prior to use. The following reference
compounds were purchased from Sigma–Aldrich New Zealand Ltd:
2-(methylsulfanyl)ethanol, 3-(methylsulfanyl)propanol, 3-
(methylsulfanyl)propanal methyl and ethyl 2-(methylsulfanyl)ace-
tate, methyl and ethyl 3-(methylsulfanyl)propionate.
Propyl and butyl 3-(methylsulfanyl)propionate were synthes-
ised by reaction of propanol or butanol with 1 equivalent of 3-
(methylsulfanyl)propionic anhydride, which was synthesised by
stirring 2.3 mmol of dicyclohexylcarbodiimide with 4.2 mmol 3-
(methylsulfanyl)propionic acid in 10 ml of dry Et2O under N2 for
24 h, and was used without further purification. Propanol or buta-
nol (1 mmol), 3-(methylsulfanyl)propionic anhydride, and p-tolu-
ene sulfonic acid (10 mg) were stirred for five days in 5 ml of dry
Et2O. Et2O (40 ml) was added, and the reaction quenched with
2 Â 10 ml saturated NaHCO3 (aq.). The organic phase was dried
(MgSO4), the solvent removed and the product purified by flash
chromatography on silica gel. Propyl 3-(methylsulfanyl)propionate
(99% pure); EI–MS, m/z (rel. int.): 74 (100), 61 (88), 41 (60), 75 (48),
43 (47), 162 (40, M+), 47 (32), 103 (27), 55 (20), 73 (18), 120 (15),
77 (14), 119 (10), 102 (7), 89 (7), 147 (1). Butyl 3-(methylsulfa-
nyl)propionate (99% pure); EI–MS, m/z (rel. int.): 74 (100), 61
(88), 41 (60), 75 (48), 43 (47), 176 (40, M+), 47 (32), 103 (27), 55
(20), 73 (18), 120 (15), 77 (14), 119 (10), 102 (7), 89 (7), 120 (1).
Propyl and butyl 2-(methylsulfanyl)acetate were synthesised
by reaction of propanol or butanol with 1 equivalent of 2-(meth-
ylsulfanyl)acetic anhydride, which was synthesised by stirring
6.3 mmol of dicyclohexylcarbodiimide with 3.33 mmol 2-(meth-
ylsulfanyl)acetic acid in 10 ml of dry Et2O under N2 for 24 h, and
was used without further purification. Propanol or butanol
(1.6 mmol), 2-(methylsulfanyl)acetic anhydride (1.67 mmol), and
p-toluene sulfonic acid (10 mg) were stirred for five days in
10 ml of dry Et2O. 20 ml of Et2O was added, and the reaction
quenched with 2 Â 5 ml saturated NaHCO3 (aq.). The organic phase
was dried (MgSO4), the solvent removed, and the product purified
by flash chromatography on silica gel. Propyl 2-(methylsulfa-
nyl)acetate (>99% pure); EI–MS, m/z (rel. int.): 61 (100), 43 (36),
148 (30, M+), 41 (19), 42 (11), 45 (11), 60 (11), 35 (9), 47 (7), 63
(4), 62 (4), 149 (4), 102 (4), 77 (4), 106 (4), 46 (3), 89 (3). Butyl
2-(methylsulfanyl)acetate (99% pure); EI–MS, m/z (rel. int.): 61
hours at 235 °C with a nitrogen flow of 20 ml minÀ1
.
4.3.3. GC–MS–TOF analysis
For DTD injection, the Focus (ATAS GL) autosampler was oper-
ated via the PAL cycle composer software 1.5.4. The headspace vol-
atiles were cryo-focused at À120 °C and thermally desorbed at
175 °C after heating the cryogenic trap with a ramp rate of
50 °C minÀ1 using an Optic 3 thermal desorption system (ATAS
GL). The initial injector temperature of 35 °C was increased to
220 °C with a rate of 16 °C sÀ1. Three minutes after the first split
mode (15 ml minÀ1), a second split of 25 ml minÀ1 was introduced
and the volatiles were transferred onto a 30 m  0.25 mm Â
0.25 lm film thickness DB-Wax (J&W Scientific, Folsom, CA, USA)
capillary column in a HP6890 GC (Agilent Technologies). A linear
GC-programme of 3 °C minÀ1 from 30 °C for 1 min to 220 °C for
2.3 min was applied with a column flow of 1 ml minÀ1. Peaks were
identified by time-of-flight mass spectrometry (TOF-MS, Leco Peg-
asus III, St. Joseph, MI, USA). Helium was used as carrier gas, the
transfer line temperature was set to 220 °C and a detector voltage
of 1700 V was applied. The ion source temperature was kept at
200 °C and ionisation energy of 70 eV was used for electron impact
ionisation. Ion spectra from 26 to 250 amu were collected with a
data acquisition rate of 20 Hz sÀ1
.
4.3.4. Qualitative and quantitative analysis
Retention times and mass spectra of reference compounds were
used to identify methylsulfanyl-volatiles, except for ethyl 3-(meth-
ylsulfanyl)prop-2-enoate whose spectrum was matched to
National Institute of Standards and Technology (NIST) library.
The peak area of the corresponding molecular ion peaks were
integrated manually using the LECO chromaTOF software and the

C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
749
critical limit for integration was set at a signal–noise-ratio of 20.
For quantitative analysis, peak areas of 3-(methylsulfanyl)propi-
onic acid derivatives were corrected against ethyl 3-([D3]-meth-
4.5.2. Protein crude extraction
0.5 g of pulverized tissue was extracted with 1 ml of 0.25 M
potassium phosphate buffer (pH 7) containing Complete™ prote-
ase inhibitor (Roche Applied Science), 1% Triton and PVPP. The
supernatant was desalted with a NAP-5 column (Illustra™) and
eluted in assay buffer (0.25 M potassium phosphate buffer, pH 8,
10% glycerol, complete™ protease inhibitor tablet). Total protein
concentrations were quantified using the Quick start™ Bradford
protein assay (Bio-Rad) and BSA-standard curve. Two replicates
were extracted per time point.
ylsulfanyl)propionate
and
2-(methylsulfanyl)acetic
acid
derivatives against [D5]ethyl 2-(methylsulfanyl)acetate. Standard
curves with a correlation coefficient R2 > 0.995 were acquired by
standard dilution series of each compound in a ‘Hort 16A’ model
solution (5.5 g lÀ1 malic acid, 11.2 g lÀ1 citric acid, 20.6 g lÀ1 quinic
acid, 1.3 g lÀ1 myo-inositol, 15 g lÀ1 sucrose, 39.3 g lÀ1 glucose
49.6 g lÀ1 fructose, pH 4.5) and dynamic headspace sampling at
the parameters described. Ethyl 3-(methylsulfanyl)prop-2-enoate
concentrations were expressed in equivalents of ethyl 3-
(methylsulfanyl)propionate.
4.5.3. AAT assay
10 ml glass vials with pierced Teflon liners were used to mix
600
propanol and butanol, 1
and 300 M of each (methylsulfanyl)alkyl-CoA in a reaction vol-
ume of 2 ml. After one hour at 33 °C, a 65 m polydimethylsilox-
l
g of crude protein, assay buffer, 3 mM methanol, ethanol,
lM of each deuterated internal standard
4.4. Quantitative real-time PCR analysis
l
l
Three RNA extractions were made from each sample according
to Lopez-Gomez and Gomez-Lim (1992) and quantified with Nano-
Drop™ (Thermo scientific). 1 lg RNA of each replicate was treated
ane-divinylbenzene (PDMS-DVB) HS-SPME fibre (Supelco) was
injected into the headspace of the sample and volatiles were ad-
sorbed onto the fibre for 15 min. The same GC-MS-TOF equipment
was utilised as described above but HS-SPME fibres were injected
manually with an injector temperature of 220 °C in splitless mode.
A GC-oven programme of 90 °C for 1 min, 5 °C minÀ1 to 200 °C, and
hold for 1 min was applied. The spectra were compared with those
obtained with boiled and substrate-free protein extracts and only
additional peak areas were considered for integration.
with DNase I amplification grade (Invitrogen) prior to cDNA syn-
thesis. First-strand cDNA was synthesised using the SuperScript™
VILO cDNA synthesis-kit (Invitrogen) according to the manufac-
turer’s instructions and diluted 100-fold prior to use. The same
procedure without addition of reverse transcriptase was applied
for each replicate to test for gDNA contamination. Real-time gene
transcription analysis of Actinidia AAT ESTs (Crowhurst et al.,
2008) relative to the reference gene Ubiquitin9 were performed
on a LightCyclerÒ 480 platform using LightCyclerÒ 480 SYBR Green
(Methylsulfanyl)alkanoate-esters were identified according to
reference compounds and quantified in equivalents of the corre-
sponding deuterated internal standard.
master mix in a reaction volume of 5 ll. Two technical replicates of
each biological replicate per sample were used and cDNA was re-
placed by water to test for false amplification. A standard dilution
series with plasmid DNA was generated to evaluate the primer effi-
ciencies of each primer, which were > 1.85. The results were ana-
lysed using the LightCycler 480 software (Roche) and quantified
according to Pfaffl (2001). Programme: 1 min at 95 °C; 40 cycles
of 10 s at 95 °C, 10 s at 60 °C, and 12 s at 72 °C; followed by melting
curve analysis: 95 °C 5 s, 65 °C 60 s then ramping at 0.18 °C sÀ1 to
95 °C. The following primer pairs were used for real-time PCR (size
of PCR-product is given in brackets):
Acknowledgements
The authors wish to thank Ringo Feng, Anne White and Allan
Woolf for their advice and support in postharvest handling. Fur-
thermore, we gratefully acknowledge William Laing’s and Edwige
Souleyre’s constructive feedback on this manuscript. This study
was financed by the New Zealand Foundation for Research Science
and Technology (contract COX0403).
Ubi 9 (109 bp): 5’- CCATTTCCAAGGTGTTGCTT -3’ (forward);
5’- TACTTGTTCCGGTCCGTCTT-3’(reverse); AT15 (142 bp): 5’- ACAA
CAGCAACAGCATGACC -3’(forward), 5’- AGTGCGGCATCTCCATAAAC
-3’(reverse); AT2: 5’- CTCCCTCCATCACATTCCAG -3’ (forward); 5’- C
GGCATCTCCATAAACACG -3’ (reverse); AT18 (107 bp): 5’- ACCCCGT
CACAGTCATCAGAG-3’ (forward); 5’- GCAATCCACCACAAGTTTTCG-3’
(reverse); AT16 (133 bp): 5’- CCATCACATTCCAGCATCAC-3’ (for-
ward); 5’- GTGTGGTGGAAAATGGCTTC-3’ (reverse);
AT17 (160 bp): 5’- TGGCAGAGGGAGTTTCTAGC-3’ (forward);
5’- TGGCTTCGAATGGCTCTTAT-3’ (reverse); AT1 (198 bp): 5’- TCCC
TTCATCCCATTCCAG-3’ (forward); 5’- CGGCATCTCCATAAACACG-3’
(reverse).
References
Antunes, M.D.C., Sfakiotakis, E.M., 2002. Chilling induced ethylene biosynthesis in
‘Hayward’ kiwifruit following storage. Scientia Horticulturae 92, 29–39.
Aubert, C., Bourger, N., 2004. Investigation of volatiles in Charentais cantaloupe
melons (Cucumis melo Var. Cantalupensis). Characterization of aroma
constituents in some cultivars. J. Agric. Food Chem. 52, 4522–4528.
Burdock, G.A., 2004. Fenaroli’s Handbook of Flavor Ingredients, fifth ed.. CRC Press,
Boca Raton.
Crowhurst, R.N., Gleave, A.P., MacRae, E.A., Ampomah-Dwamena, C., Atkinson, R.G.,
Beuning, L.L., Bulley, S.M., Chagne, D., Marsh, K.B., Matich, A.J., Montefiori, M.,
Newcomb, R.D., Schaffer, R.J., Usadel, B., Allan, A.C., Boldingh, H.L., Bowen, J.H.,
Davy, M.W., Eckloff, R., Ferguson, A.R., Fraser, L.G., Gera, E., Hellens, R.P., Janssen,
B.J., Klages, K., Lo, K.R., MacDiarmid, R.M., Nain, B., McNeilage, M.A., Rassam, M.,
Richardson, A.C., Rikkerink, E.H., Ross, G.S., Schroeder, R., Snowden, K.C.,
Souleyre, E.J., Templeton, M.D., Walton, E.F., Wang, D., Wang, M.Y., Wang,
Y.Y., Wood, M., Wu, R., Yauk, Y.K., Laing, W.A., 2008. Analysis of expressed
sequence tags from Actinidia: applications of a cross species EST database for
gene discovery in the areas of flavor, health, color and ripening. BMC Genom. 9,
351.
Cuevas, J.C., Lopez-Cobollo, R., Alcazar, R., Zarza, X., Koncz, C., Altabella, T., Salinas, J.,
Tiburcio, A.F., Ferrando, A., 2008. Putrescine is involved in Arabidopsis freezing
tolerance and cold acclimation by regulating abscisic acid levels in response to
low temperature. Plant Physiology 148, 1094–1105.
El-Sharkawy, I., Manriquez, D., Flores, F.B., Regad, F., Bouzayen, M., Latche, A., Pech,
J.C., 2005. Functional characterization of a melon alcohol acyl-transferase gene
family involved in the biosynthesis of ester volatiles. Identification of the crucial
role of a threonine residue for enzyme activity. Plant Mol. Biol. 59, 345–362.
Escudero, A., Hernandez-Orte, P., Cacho, J., Ferreira, V., 2000. Clues about the role of
methional as character impact odorant of some oxidized wines. J. Agric. Food
Chem. 48, 4268–4272.
4.5. (Methylsulfanyl)alkanoate- ester production of cell free extract
All chemicals were purchased by Sigma–Aldrich New Zealand
LTD unless stated otherwise.
4.5.1. (Methylsulfanyl)alkyl-CoA synthesis
2-(methylsulfanyl)acetyl-CoA (99% purity) and 3-(methylsulfa-
nyl)propionyl-CoA (purity 99.5%) were synthesised by reaction be-
tween the corresponding MeS-anhydride (see 2.3.1) and Coenzyme
A Lithium salt according to Goldman and Vagelos (1961). The crude
product was purified by RP-HPLC after Pourfarzam and Bartlett
(1991), and quantified using the hydroxamate assay, modified
from Lipmann and Tuttle (1945).
Escudero, A., Gogorza, B., Melus, M.A., Ortin, N., Cacho, J., Ferreira, V., 2004.
Characterization of the aroma of a wine from maccabeo. Key role played by
compounds with low odor activity values. J. Agric. Food Chem. 52, 3516–3524.

750
C.S. Günther et al. / Phytochemistry 71 (2010) 742–750
Escudero, A., Campo, E., Farina, L., Cacho, J., Ferreira, V., 2007. Analytical
characterization of the aroma of five premium red wines. Insights into the
role of odor families and the concept of fruitiness of wines. J. Agric. Food Chem.
55, 4501–4510.
Ferreira, V., Pet’ka, J., Cacho, J., 2005. Intensity and persistence profiles of flavor
compounds in synthetic solutions. Simple model for explaining the intensity
and persistence of their aftersmell.. J. Agric. Food Chem. 54, 489–496.
Friel, E.N., Wang, M., Taylor, A.J., MacRae, E.A., 2007. In vitro and in vivo release of
aroma compounds from yellow-fleshed kiwifruit. J. Agric. Food Chem. 55, 6664–
6673.
Pourfarzam, M., Bartlett, K., 1991. Products and intermediates of the beta-oxidation
of [U-14C]hexadecanedionoyl-mono-CoA by rat liver peroxisomes and
mitochondria. Biochem. J. 273 (Pt 1), 205–210.
Pripis-Nicolau, L., de Revel, G., Bertrand, A., Lonvaud-Funel, A., 2004. Methionine
catabolism and production of volatile sulphur compounds by Oenococcus oeni. J.
Appl. Microbiol. 96, 1176–1184.
Ritenour, M.A., Crisosto, C.H., Garner, D.T., Cheng, G.W., Zoffoli, J.P., 1999.
Temperature, length of cold storage and maturity influence the ripening rate
of ethylene-preconditioned kiwifruit. Postharvest Biol. Technol. 15, 107–115.
Schaffer, R.J., Friel, E.N., Souleyre, E.J.F., Bolitho, K., Thodey, K., Ledger, S., Bowen, J.H.,
Ma, J.H., Nain, B., Cohen, D., Gleave, A.P., Crowhurst, R.N., Janssen, B.J., Yao, J.L.,
Newcomb, R.D., 2007. A Genomics approach reveals that aroma production in
apple is controlled by ethylene predominantly at the final step in each
biosynthetic pathway. Plant Physiol. 144, 1899–1912.
Goldman, P., Vagelos, P.R., 1961. The specificity of triglyceride synthesis from
diglycerides in chicken adipose tissue. J. Biol. Chem. 236, 2620–2623.
Groppa, M.D., Benavides, M.P., 2008. Polyamines and abiotic stress: Recent
advances. Amino Acids 34, 35–45.
Jaeger, S.R., Rossiter, K.L., Wismer, W.V., Harker, F.R., 2003. Consumer-driven
product development in the kiwifruit industry. Food Qual. Pref. 14, 187–198.
Johnston, J.W., Gunaseelan, K., Pidakala, P., Wang, M., Schaffer, R.J., 2009. Co-
ordination of early and late ripening events in apples is regulated through
differential sensitivities to ethylene. J. Exp. Bot. 60, 2689–2699.
Jordan, M.J., Margaria, C.A., Shaw, P.E., Goodner, K.L., 2002. Aroma active
components in aqueous kiwi fruit essence and kiwi fruit puree by GC–MS and
multidimensional GC/GC–O. J. Agric. Food Chem. 50, 5386–5390.
Klesk, K., Qian, M., 2003. Aroma extract dilution analysis of cv. Marion (Rubus spp.
hyb) and cv. Evergreen (R-laciniatus L.) blackberries. J. Agric. Food Chem. 51,
3436–3441.
Landaud, S., Helinck, S., Bonnarme, P., 2008. Formation of volatile sulfur compounds
and metabolism of methionine and other sulfur compounds in fermented food.
Appl. Microbiol. Biotechnol. 77, 1191–1205.
Lipmann, F., Tuttle, C., 1945. A specific micromethod for the determination of acyl
phosphates. J. Biol. Chem. 159, 21–28.
Schotsmans, W.C., Mackay, B., Mawson, A.J., 2008. Temperature kinetics of texture
changes in Actinidia chinensis ‘Hort 16A’ during storage. J. Horticult. Sci.
Biotechnol. 83, 760–764.
Sen, A., Grosch, W., 1991. Synthesis of 6 deuterated sulfur-containing odorants to be
used as internal standards in quantification assays. Z. Lebensm. Unters. For. 192,
541–547.
Souleyre, E.J., Greenwood, D.R., Friel, E.N., Karunairetnam, S., Newcomb, R.D., 2005.
An alcohol acyl transferase from apple (cv. Royal Gala), MpAAT1, produces
esters involved in apple fruit flavour. Febs J. 272, 3132–3144.
Steinhaus, M., Sinuco, D., Polster, J., Osorio, C., Schieberle, P., 2008. Characterization
of the aroma-active compounds in pink guava (Psidium guajava L.) by
application of the aroma extract dilution analysis. J. Agric. Food Chem. 56,
4120–4127.
Steinhaus, M., Sinuco, D., Polster, J., Osorio, C., Schieberle, P., 2009. Characterization
of the key aroma compounds in pink guava (Psidium guajava L.) by means of
aroma re-engineering experiments and omission tests. J. Agric. Food Chem 57,
2882–2888.
Szego, D.K., Horvath, E., 2007. Role of S-methylmethionine in the plant metabolism.
Acta Agron. Hung. 55, 491–508.
Lopez-Gomez, R., Gomez-Lim, M., 1992. A method for extracting intact RNA from
fruits rich in polysaccharides using ripe mango mesocarp. Hortscience 27, 440–
442.
Lucchetta, L., Manriquez, D., El-Sharkawy, I., Flores, F.B., Sanchez-Bel, P., Zouine, M.,
Ginies, C., Bouzayen, M., Rombaldi, C., Pech, J.C., Latche, A., 2007. Biochemical
and catalytic properties of three recombinant alcohol acyltransferases of melon.
Sulfur-containing ester formation, regulatory role of CoA-SH in activity, and
sequence elements conferring substrate preference. J. Agric. Food Chem. 55,
5213–5220.
Mahattanatawee, K., Perez-Cacho, P.R., Davenport, T., Rouseff, R., 2007.
Comparison of three lychee cultivar odor profiles using gas
chromatography–olfactometry and gas chromatography-sulfur detection. J.
Agric. Food Chem. 55, 1939–1944.
Takeoka, G., Buttery, R.G., Flath, R.A., Teranishi, R., Wheeler, E.L., Wieczorek, R.L.,
Guentert, M., 1989. Volatile constituents of pineapple (Ananas-Comosus [L.]
Merr). ACS Symp. Ser. 388, 223–237.
Takeoka, G.R., Buttery, R.G., Teranishi, R., Flath, R.A., Guentert, M., 1991. Identification
of additional pineapple volatiles. J. Agric. Food Chem. 39, 1848–1851.
Takeoka, G.R., Buttery, R.G., Flath, R.A., 1992. Volatile constituents of Asian pear
(Pyrus serotina). J. Agric. Food Chem. 40, 1925–1929.
Vallet, A., Lucas, P., Lonvaud-Funel, A., de Revel, G., 2008. Pathways that produce
volatile sulphur compounds from methionine in Oenococcus oeni. J. Appl.
Microbiol. 104, 1833–1840.
Marsh, K.B., Friel, E.N., Gunson, A., Lund, C., MacRae, E., 2006. Perception of flavour
in standardised fruit pulps with additions of acids or sugars. Food Qual. Pref. 17,
376–386.
Matich, A., Rowan, D., 2007. Pathway analysis of branched-chain ester biosynthesis
in apple using deuterium labeling and enantioselective gas chromatography-
mass spectrometry. J. Agric. Food Chem. 55, 2727–2735.
Olias, R., Perez, A.G., Sanz, C., 2002. Catalytic properties of alcohol acyltransferase in
different strawberry species and cultivars. J. Agric. Food Chem. 50, 4031–4036.
Patterson, K., Burdon, J., Lallu, N., 2003. ‘Hort 16A’ kiwifruit: progress and issues
with commercialisation. Acta Horticulturae 610, 267–273.
Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-
time RT-PCR. Nucleic Acids Res. 29 (9), e45.
Weenen, H., Koolhaas, W.E., Apriyantono, A., 1996. Sulfur-Containing Volatiles of
Durian Fruits (Durio zibethinus Murr.). J. Agric. Food Chem. 44, 3291–3293.
Werkhoff, P., Guntert, M., Krammer, G., Sommer, H., Kaulen, J., 1998. Vacuum
headspace method in aroma research: flavor chemistry of yellow passion fruits.
J. Agric. Food Chem. 46, 1076–1093.
Wyllie, S.G., Fellman, J.K., 2000. Formation of volatile branched chain esters in
bananas (Musa sapientum L.). J. Agric. Food Chem. 48, 3493–3496.
Wyllie, S.G., Leach, D.N., 1992. Sulfur-containing-compounds in the aroma volatiles
of melons (Cucumis melo). J. Agric. Food Chem. 40, 253–256.
Yahyaoui, F.E., Wongs-Aree, C., Latche, A., Hackett, R., Grierson, D., Pech, J.C., 2002.
Molecular and biochemical characteristics of a gene encoding an alcohol acyl-
transferase involved in the generation of aroma volatile esters during melon
ripening. Eur. J. Biochem. 269, 2359–2366.
Young, H., Paterson, V.J., 1985. The effects of harvest maturity, ripeness and storage
on kiwifruit aroma. J. Sci. Food Agric. 36, 352–358.
Pineau, B., Barbe, J.C., Van Leeuwen, C., Dubourdieu, D., 2009. Examples of
perceptive interactions involved in specific ‘‘red-‘‘ and ‘‘black-berry” aromas
in red wines. J. Agric. Food Chem. 57, 3702–3708.