Synthesis and properties of triplex-forming oligonucleotides containing 2′-O-(2-methoxyethyl)-5-(3-aminoprop-1-ynyl)-uridine

Article abstract of DOI:10.1016/j.bmc.2010.07.005

2′-O-(2-Methoxyethyl)-5-(3-aminoprop-1-ynyl)-uridine phosphoramidite (MEPU) has been synthesized from d-ribose and 5-iodouracil and incorporated into triplex-forming oligonucleotides (TFOs) by automated solid-phase oligonucleotide synthesis. The TFOs gave very high triplex stability with their target duplexes as measured by ultraviolet/fluorescence melting and DNase I footprinting. The incorporation of MEPU into TFOs renders them resistant to degradation by serum nucleases.

Full text of DOI:10.1016/j.bmc.2010.07.005

Bioorganic & Medicinal Chemistry 18 (2010) 6389–6397
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Synthesis and properties of triplex-forming oligonucleotides containing
20-O-(2-methoxyethyl)-5-(3-aminoprop-1-ynyl)-uridine
Chenguang Lou a, Qiang Xiao a, Lavinia Brennan a, Mark E Light a, Nuria Vergara-Irigaray b,
Elizabeth M. Atkinson b, Lindy M. Holden-Dye b, Keith R. Fox b, Tom Brown a,
*
a School of Chemistry, University of Southampton, Highfield, Southampton SO17 1BJ, UK
b School of Biological Sciences, University of Southampton, Bassett Crescent East, Southampton SO16 7PX, UK
a r t i c l e i n f o
a b s t r a c t
20-O-(2-Methoxyethyl)-5-(3-aminoprop-1-ynyl)-uridine phosphoramidite (MEPU) has been synthesized
Article history:
Received 8 April 2010
Revised 1 July 2010
Accepted 6 July 2010
Available online 30 July 2010
from D-ribose and 5-iodouracil and incorporated into triplex-forming oligonucleotides (TFOs) by auto-
mated solid-phase oligonucleotide synthesis. The TFOs gave very high triplex stability with their target
duplexes as measured by ultraviolet/fluorescence melting and DNase I footprinting. The incorporation
of MEPU into TFOs renders them resistant to degradation by serum nucleases.
Ó 2010 Elsevier Ltd. All rights reserved.
Keywords:
20-Methoxyethyluridine
Stable triplex-forming oligonucleotide (TFO)
Serum nuclease resistance
1. Introduction
charged backbone of the target duplex.11–13 Modification of the
20-position of the ribose sugar in the TFO is particularly desirable
Triplex-forming oligonucleotides (TFOs)1 have been used as se-
quence-selective agents for gene-knockout and mutation correc-
tion, hence the synthesis of chemically modified TFOs with
improved biological activity is potentially important.2–8 TFOs bind
to DNA duplexes to form triplexes by binding in the major groove
of the double strand. In the more stable (parallel) version of DNA
triple helices, the third strand runs in the same direction as the du-
plex purine-rich strand to which it binds. The TFO binds to the ex-
posed edges of the base pairs and makes sequence-specific
contacts to produce C+.GC and T.AT triplets. The three-stranded
structure is usually less stable than the underlying duplex, and
has a requirement for low pH. This is because protonation of cyto-
sine N3 (pKa ꢀ 4.5) is necessary for formation of a stable C+.GC trip-
let.9,10 Protonated cytosine bases and analogues contribute
disproportionally to the stability of parallel triplexes, so to increase
triplex stability and restore the balance between the stability of
C.GC and T.AT triplets, a number of thymidine analogues have been
synthesized for incorporation into TFOs. One successful stabiliza-
tion strategy has been to incorporate positively charged groups
into the TFO to provide favorable interactions with the negatively
as this greatly reduces degradation of the TFO by nuclease enzymes
in vivo. Because of this stabilizing effect, oligonucleotides modified
at the 20-position are of importance in other biological applications,
for example as antisense agents or siRNA analogues. Several 20-O-
modified nucleoside monomers have been incorporated into TFOs
and the effects of the modifications quantified.14
The objective of this study was to synthesize a novel analogue
of thymidine, 20-O-(2-methoxyethyl)-5-(3-aminoprop-1-ynyl)-uri-
dine (MEPU), designed to stabilize T.AT triplets in triple helices
TFO
O
MEPU
NH3
TFO O
O
O
N
O
N
H
O
O
H
CH3
CH3
O
H
N
N
T
N
H
N
A
N
N
R
N
R
Abbreviations: MEPU, 20-O-(2-methoxyethyl)-5-(3-aminoprop-1-ynyl)-uridine;
TFOs, triplex-forming oligonucleotides; Tm, melting (dissociation) temperature;
FCS, fetal calf serum; CEE, Caenorhabditis elegans extract.
* Corresponding author. Tel.: +44 (0) 2380 592974; fax: +44 (0) 2380 592991.
E-mail address: tb2@soton.ac.uk (T. Brown).
O
Figure 1. The MEPU-A.T triplet. TFO = triplex-forming oligonucleotide backbone,
R = deoxyribose sugar. TFO in blue, duplex in black.
0968-0896/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2010.07.005

6390
C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
(Fig. 1). The amino group is protonated at physiological pH, thus
providing a favorable electrostatic interaction with the DNA phos-
phodiester backbone, the alkyne further stabilizes the triplex
through base stacking interactions and the 20-substituent is de-
signed to confer in vivo stability.13,15,16
the 30- and 50-positions with benzoyl chloride in pyridine to give
protected sugar 7 (95% yield for two steps). The benzyl groups on
3 and 5-positions of the sugar had to be removed and replaced
with benzoyl before coupling to 5-iodouracil because reduction
of the C5@C6 bond of the pyrimidine ring occurs under the condi-
tions of catalytic hydrogenation required for debenzylation. Com-
pound 7 was reacted with acetic anhydride and catalytic conc.
2. Results and discussion
sulfuric acid in acetic acid to afford activated sugar 8 (a- and b-
anomers, 85% yield) after which 5-iodouracil was coupled to 8 to
yield nucleoside 9 exclusively in the desired b-configuration (80%
yield). The selectivity is probably due to steric hindrance from
the side chain at the 20-position preventing approach of the uracil
base from below the sugar ring.19 The benzoyl groups on the 50-
and 30-positions of 9 were removed by reaction with NaOMe in
anhydrous MeOH to generate 10 which was protected at the 50-po-
sition with 4,40-dimethoxytrityl chloride in 98% yield. In order to
confirm its stereochemistry, intermediate 10 was also synthesized
from uridine (Supplementary data, S1), from which identical spec-
troscopic properties were obtained. Continuing the synthesis of 13,
the iodine atom on the 5-position of 11 was substituted by 3-triflu-
oroacetamidoprop-1-yne using Sonogashira chemistry. This strat-
egy allows for the introduction of other functional groups at the
5-position of the pyrimidine base. Finally compound 12 was phos-
phitylated with 2-cyanoethyl-N, N-diisopropylchlorophosphine to
give phosphoramidite 13 in 91% yield. The overall yield of 13
2.1. Synthesis of 1-O-methyl-3,5-di-O-benzyl-a-D-ribofuranoside
1-O-Methyl-3,5-di-O-benzyl-
pared by minor modifications to the published methods
(Scheme 1).17,18 Firstly,
-ribose was reacted with anhydrous
MeOH in the presence of Dowex-50 H+ resin to produce 1-
methyl- -ribofuranoside 2 in quantitative yield. Benzylation of 2
a-D-ribofuranoside (4) was pre-
D
D
with benzyl bromide in the presence of NaH gave the protected
glycoside 3 (91% yield for two steps). Benzyl protection was chosen
because of its stability under the reaction conditions and subse-
quent ease of removal by hydrogenation. The 20-O-benzyl group
of 1-O-methyl-2,3,5-tri-O-benzyl-D-ribose 3 was selectively depro-
tected with SnCl4 in DCM to give dibenzyl sugar 4 in 86% yield. The
20-OH of 4 was then functionalised with a p-tolouyl group to facil-
itate crystallization of compound 14 (Fig. 2). The X-ray structure of
14 confirmed the selectivity of debenzylation of 3 and the a-con-
figuration at the anomeric center. Compound 4 is a potentially use-
ful intermediate in the synthesis of various 20-O-modified
nucleosides as it has a single free hydroxyl group which can be
readily alkylated prior to coupling the sugar with the appropriate
nucleobase.
was 22.4% from D-ribose.
2.3. TFO design, synthesis, and triplex melting studies
Standard solid-phase phosphoramidite methods were used to
prepare a series of modified oligonucleotides (Fig. 3) which were
used in ultraviolet melting experiments to determine triplex sta-
bility. TFO-1 was synthesized as a control without any modifica-
tions at thymidine, TFO-2 consists of six 20-O-(2-methoxyethyl)-
2.2. Synthesis of 20-O-(2-methoxyethyl)-5-(3-
trifluoroacetamidoprop-1-ynyl)-uridine phosphoramidite and
incorporation into triplex-forming oligonucleotides
5-(3-aminoprop-1-ynyl)-uridine
(MEPU)
units
distributed
The synthesis of the desired phosphoramidite 13 is illustrated in
Scheme 2. To prepare the required 20-O-(2-methoxyethyl) ribose
moiety, the 20-OH group of compound 4 was reacted with bro-
momethylethyl ether in the presence of NaH in DMF to give com-
pound 5 in 94% yield. This was heated in the presence of palladium
hydroxide on carbon in ethanol to yield 6 which was protected at
throughout the sequence, while TFO-3 contains two clusters of
the modified nucleoside, one of two clusters with two MEPU mod-
ifications and the other with four. Theoretically, when clustered,
the ability of the 20-O-modified nucleoside to stabilize triplexes
might be decreased due to steric hindrance and the high concen-
Scheme 1. Reagents and conditions: (a) Dowex-50 (H+), methanol, 0 °C, 24 h; (b) benzyl bromide (6.1 equiv), sodium hydride (6.1 equiv), DMF, rt, 14 h, 91% for two steps; (c)
1 M SnCl4/DCM solution (1 equiv), DCM, 0 °C, 24 h, 86%.
Figure 2. The X-ray crystal structure (left) and the chemical structure (right) of 1-O-methyl-2-(p-tolouyl)-3,5-di-O-benzyl-D-a-ribofuranoside (14).

C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
6391
Scheme 2. Reagents and conditions: (a) NaH (3.4 equiv), anhydrous DMF, 0 °C, 1 h; BrCH2CH2OMe (6.2 equiv), rt, 8 h, 94%; (b) Pd(OH)2 20% on carbon (0.1 equiv), H2,
anhydrous EtOH, 50 °C, 3 h; (c) PhCOCl (2.6 equiv), anhydrous pyridine, rt, overnight, 95% for two steps; (d) AcOAc/AcOH (1:1), 1% concd sulfuric acid, rt, 5 h, 85%; (e) 5-
iodouracil (1.2 equiv), N,O-bis(trimethylsilyl)acetamide (5.5 equiv), anhydrous CH3CN, rt, overnight; 8, SnCl4 (1.2 equiv), anhydrous CH3CN, 50 °C, 16 h, 80%; (f) NaOMe
(2.8 equiv), anhydrous MeOH, rt, 1.5 h, 68%; (g) DMTCl (1.2 equiv), anhydrous pyridine, rt, 18 h, 98%; (h), 3-trifluoroacetamidoprop-1-yne (1.2 equiv), CuI (0.8 equiv),
(Ph3P)4Pd(0) (0.07 equiv), Et3N (10 equiv), anhydrous DMF, rt, overnight, 78%; (i) 2-cyanoethyl-N,N-diisopropylchlorophosphine (1.4 equiv), DIPEA (5 equiv), anhydrous DCM,
rt, 3 h, 91%.
Table 1
Tm values (°C) of TFOs and hairpin target measured by UV melting and fluorescence
melting (in parentheses)
pH 6.2
pH 6.6
pH 7.0
pH 7.5
pH 8.0
TFO-1
TFO-2
TFO-3
44.3 (43.9)
71.9 (71.0)
71.9 (69.8)
38.5 (37.5)
64.6 (62.7)
62.5 (60.9)
33.3 (—)
57.0 (53.2)
54.5 (50.5)
34.1
43.8
40.6
—
32.5
29.9
All experiments were performed in 10 mM sodium phosphate (pH 6.2, 6.6, 7.0, 7.5
or 8.0), containing 200 mM NaCl. The concentration of TFOs: target duplex were
3.0 lM:1.0 lM for uv and 2.5 lM:0.25 lM for fluorescence melting. The fluores-
cence experiments were carried out with very slow melting to eliminate hysteresis,
whereas the ultraviolet melting experiments were carried at heating rates typically
used in the literature.
Figure 3. Oligonucleotide sequences used in ultraviolet and fluorescence melting
experiments. In each case the third strand is shown in bold and the duplex target is
boxed: H = hexaethylene glycol linker, 2 = dabcyl, 5 = 5-methyldeoxycytidine,
6 = fluorescein dT, X = 5-aminopropynyl-20-O-methoxyethyluridine. Modifications
2 and 6 enable fluorescence melting experiments to be carried out.
tration of mutually repulsive adjacent positive charges in the third
strand. In contrast, with the six 20-O-modified nucleosides dis-
persed, the steric hindrance and concentration of charge would
be avoided and triplex-stabilizing capacity maximized.
Melting studies show that as the pH increases, the stability of all
the triplexes is reduced markedly, largely due to destabilization of
the MeC.GC triplets, and to a lesser extent as a result of deprotona-
tion of the 5-aminopropynyl group of MEPU (Table 1). It is evident
that MEPU greatly enhances triplex stability relative to thymidine.
Figure 3A shows UV melting studies at pH 6.6 (melting curves at
pH 6.2, 7.0, 7.5, and 8.0 are shown in Supplementary data
Fig. S1). At pH 7.0, compared to thymidine, there is on average a
3.9 °C increase in Tm per MEPU residue. This is greater than most
previously studied 20-O-modified ribothymidine analogues such
as 20-O-(aminoethyl)ribothymidine (+3.5 °C per modification),20
20-O-methyl-5-propynyluridine (+3.2 °C), and 20-O-methyl-5-(3-
amino-1-prop-1-ynyl)uridine (+3.7 °C).14,21–23 Stabilization due to
MEPU is good, but it is not as effective as 20-O-(aminoethoxy)-5-
(3-aminoprop-1-ynyl)uridine (+5.2 °C per modification).24 How-
ever, the latter is more difficult to synthesize. The positioning of
the MEPU monomer in the TFO has a small influence on triplex sta-
bility; Tm values for TFO-2 are always slightly higher than the cor-
responding values for TFO-3 (Fig. 4A), which confirms that

6392
C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
Figure 4. Melting curves (left) and derivatives (right) of TFO-1 (black), TFO-2 (green), TFO-3 (red) with target hairpin duplex at pH 6.6. (A) UV melting. (B) Fluorescence
melting. Experiments were performed in 10 mM sodium phosphate pH 6.6 containing 200 mM NaCl. The concentration of TFOs: target duplex were 3.0 M:1.0 M for UV
melting and 2.5 M:0.25 M for fluorescence melting.
l
l
l
l
dispersed modified bases are slightly more effective than clustered
ones.9,10 The high stability of triplexes containing MEPU was con-
firmed by fluorescence melting experiments (Table 1, Tm values
in parentheses). Figure 4B shows fluorescence melting studies at
pH 6.6 (melting curves and derivatives at pH 6.2 and 7.0 are shown
in Supplementary data Fig. S3).25 The fluorescence experiments
were carried out with very slow melting to eliminate hysteresis
and ensure that the systems are under thermodynamic control,
whereas the ultraviolet melting experiments were carried at heat-
ing rates typically used in the literature. This difference in heating
rate explains the small differences between UV and fluorescence
melting temperatures at higher pH. The above ultraviolet and fluo-
rescence melting experiments confirm that MEPU is a potentially
useful triplex-stabilizing monomer for in vivo applications.
shown in the left hand panel of Figure 5 and reveals the presence
of a clear footprint at the intended target site.
2.5. Biological stability
The footprinting TFO, and a control oligonucleotide in which
X = thymidine, were incubated in either fetal calf serum (FCS) or
an extract prepared from C. elegans (CEE), Samples were taken at
various times and the products were separated on denaturing
polyacrylamide gels. The results are shown in the right hand panels
of Figure 5. The control oligonucleotide was rapidly degraded
(especially in FCS) while the oligonucleotide containing MEPU re-
mained largely intact, even after 20 h incubation at 37 °C. This con-
firms the stabilizing effect of the 2-methoxyethyl group.
2.4. DNase I footprinting
3. Conclusions
20-O-(2-Methoxyethyl)-5-(3-aminoprop-1-ynyl)-uridine phos-
phoramidite (MEPU) has been synthesized from D-ribose and 5-
We confirmed the ability of oligonucleotides containing MEPU
to form stable triplex helices by DNase I footprinting. For these
experiments we prepared a target template based on the promoter
region of the unc-22 gene from Caenorhabditis elegans, containing
the target site GGAAGGAAACAAAA and examined the interaction
with 50-FAM-CCXTCCXTXMXXXT where C is 5-methylcytosine, X
is MEPU and M is an N-methylpyrrolopyrimidine monomer de-
signed for recognizing CG base pairs.26 The DNase I footprint is
iodouracil. The phosphoramidite monomer has been incorporated
into triplex-forming oligonucleotides which were shown to pro-
duce very stable triplexes as measured by ultraviolet and fluores-
cence melting studies and DNase I footprinting. The TFOs are also
more stable than natural counterparts to enzymatic degradation
in serum extracts. The synthetic strategy presented here could be

C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
6393
100 MHz on the same spectrometers. Chemical shifts are given in
ppm and J values are given in Hertz. All assignments for 1H NMR
and 13C NMR have been confirmed by H–H COSY, HMQC, and HMBC.
31P NMR spectra were recorded on a Bruker AV 300 spectrometer at
121 MHz. CDCl3 and DMSO-d6 were used as solvents. The IR spectra
wereobtainedonThermoNicolet380FT-IRspectrometerwithSmart
Orbit Goldengate attachment. Low resolution mass spectra were re-
corded in acetonitrile using the electrospray technique on a Fisons
VG platform instrument. High resolution mass spectra were re-
corded in acetonitrile or methanol using the electrospray technique
on a Bruker APEX III FT-ICR mass spectrometer. HPLC grade of MeOH
or CH3CN were used as solvents.
4.1.1. 1-O-Methyl-2,3,5-O-tri-benzyl-D-ribofuranoside (3)
A solution of -ribose (5.53 g, 36.8 mmol) in anhydrous MeOH
D
(50 mL) was cooled to 0 °C, Dowex-50w (H+) was added and the
mixture was stirred at 0 °C for 24 h. After filtration, the solvent
was removed in vacuo and the residue was dried under high vac-
uum overnight before dissolving in anhydrous DMF (70 mL). Ben-
zyl bromide (26.75 mL, 225 mmol) was added and the reaction
mixture cooled to 0 °C before adding NaH in portions (60% disper-
sion in mineral oil, 9.0 g, 225 mmol). The reaction mixture was left
to stir at room temperature for 14 h after which water (5 mL) was
added. The mixture was evaporated to dryness then portioned be-
tween DCM (300 mL) and water (150 mL). The organic layer was
washed with diluted hydrochloric acid (0.5%, 150 mL ꢁ 2), satu-
rated sodium bicarbonate (150 mL), water (150 mL), and brine
(150 mL). After drying over sodium sulfate, the solvent was re-
moved in vacuo and the residue was purified by silica gel column
chromatography (23% ethyl acetate in petroleum ether) to give the
title product as an amber oil (14.59 g, b:
a = 3:1, 91%). Rf b-anomer:
0.49;
a
-anomer: 0.30 (ethyl acetate/hexane, 1:2). b-anomer: 1H
NMR: (300 MHz, CDCl3) d ppm 7.38–7.13 (m, 15H, Ar-H), 4.84 (s,
1H, CH1), 4.60 (d, J = 12.10 Hz, 1H, CHH), 4.53 (d, J = 12.10 Hz, 1H,
CHH), 4.52 (d, J = 12.16 Hz, 1H, CHH), 4.48 (m, 1H, CHH), 4.47 (d,
J = 12.14 Hz, 1H, CHH); 4.40 (d, J = 11.90 Hz, 1H, CHH), 4.26 (m,
1H, CH), 3.94 (dd, J = 6.99, 4.73 Hz, 1H, CH), 3.76 (d, J = 4.55 Hz,
1H, CH2), 3.54 (dd, J = 10.60, 3.76 Hz, 1H, CHH5), 3.43 (dd,
J = 10.60, 5.78 Hz, 1H; CHH5), 3.22 (s, 3H, CH3). 13C NMR:
(75 MHz, CDCl3) d ppm 138.3 (C-Ar), 137.8 (C-Ar), 128.4 (CH-Ar),
128.3 (CH-Ar), 128.0 (CH-Ar), 127.9 (CH-Ar), 127.8 (CH-Ar), 127.6
(CH-Ar), 127.5 (CH-Ar), 106.3 (CH1), 80.5 (CH), 79.6 (CH2), 78.4
Figure 5. Left hand panel: DNase
concentrations of TFO 50-FAM-CCXTCCXTXMXXXT (X = MEPU, C = 5-methylcyto-
sine, M = CG recognition monomer. The oligonucleotide concentration M) is
I footprinting in the presence of various
(
l
shown at the top of each gel lane. The track labeled ‘GA’ is a marker specific for the
purines. The locations of the two target sites are indicated by the bars. The upper
site shows the purine-containing strand of the target, while the lower site reveals
the pyrimidine-containing strand. Right hand panels: stability of oligonucleotides
(X = T or MEPU) in fetal calf serum (FCS) or C. elegans extract (CEE). Samples were
removed from the mixture at the times (min) as indicated at the top of each gel lane
and separated on 15% polyacrylamide gels containing 8 M urea. Note that the
MEPU-containing oligonucleotide has a lower mobility as a result of the additional
positive charges.
(CH), 73.2 (CH2), 72.4, 72.3 (CH2, CH2), 71.3 (CH5), 55.0 (CH3). IR
2
(neat): 3062, 3029, 2911, 1605, 1496, 1453, 1360, 1205, 1103,
1065, 1026, 946, 734, 696 cmꢂ1. m/z (%) LRMS [ES+, MeCN]: 452.3
([M+NH4]+, 100%), 891.6 ([2 M+Na]+, 30%). HRMS [ES+]:
adapted for the synthesis of other ribonucleoside analogues with
substituents on the 20-position of the sugar.
C
27H30O5Na requires 457.1985 found 457.1979. a
-anomer: 1H
4. Experimental
NMR: (300 MHz, CDCl3) d ppm 7.25–7.10 (15H, m, CH-Ar), 4.91
(d, J = 4.10 Hz, 1H, CH1), 4.75–4.58 (m, 4H, CH2), 4.52 (d,
J = 12.11 Hz, 1H, CHH), 4.45 (d, J = 12.10 Hz, 1H, CHH), 4.30–4.25
(m, 1H, CH), 3.88–3.78 (m, 2H, CH), 3.39 (s, 3H, CH3), 3.45 (dd,
J = 10.44, 4.11 Hz, 1H, CHH5), 3.38 (dd, J = 10.43, 4.19 Hz, 1H;
CHH5). 13C NMR: (75 MHz, CDCl3) d ppm 138.3 (C-Ar), 138.0 (C-
Ar), 137.8 (C-Ar), 128.4 (CH-Ar), 128.3 (CH-Ar), 128.0 (CH-Ar),
127.8 (CH-Ar), 127.7 (CH-Ar), 102.5 (CH1), 82.1 (CH), 77.8 (CH),
4.1. General experimental
All reagents used were purchased from Aldrich, Fluka or Lancas-
terandusedwithoutpurification. DNAphosphoramiditemonomers,
solid supports and additional reagents were purchased from Link
Technologies Ltd, Glen Research or Applied Biosystems Ltd. Dichlo-
romethane(DCM), acetonitrile (CH3CN), N,N-diisopropylethylamine
(DIPEA), triethylamine (Et3N), and pyridine were distilled over cal-
cium hydride. All reactions were carried out under an argon atmo-
sphere using glassware that had been dried at 120 °C overnight.
Column chromatography was carried out under pressure using Fish-
75.0 (CH), 73.5 (CH2), 72.5 (CH2), 72.3 (CH2), 70.2 (CH5), 55.6
2
(CH3). IR (neat): 3062, 3029, 2910, 1605, 1496, 1453, 1360, 1205,
1104, 1026, 911, 853, 734, 696 cm-1. m/z (%) LRMS [ES+, MeCN]:
457.3 ([M+Na]+, 70%), 891.7 ([2 M+Na]+, 100%). HRMS [ES+]:
C27H30O5Na requires 457.1985 found 457.1988.
er scientific DAVSIL 60A 30–70
l silica. Thin layer chromatography
(TLC) was performed using Merck Kieselgel 60 F254 (0.22 mm thick-
ness, aluminum backed). Compounds were visualized at 254 nm or
stained with 10% sulfuric acid in EtOH. 1H NMR spectra were mea-
sured at 300 MHz or 400 MHz on a Bruker AV 300 or a Bruker DPX
400 spectrometer. 13C NMR spectra were measured at 75 MHz or
4.1.2. 1-O-Methyl-3,5-di-O-benzyl-
a-D-ribofuranoside (4)
A
solution of (14.60 g, 33.6 mmol) in anhydrous DCM
3
(200 mL) was cooled to 0 °C before SnCl4/DCM solution (1 M,
33.6 mL, 33.6 mmol) was added dropwise into the mixture. The
solution was stirred at 0 °C for 24 h then water (10 mL) was added.

6394
C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
After addition of DCM (200 mL), the organic layer was washed with
water (150 mL ꢁ 3), diluted hydrochloric acid (0.5%, 150 mL ꢁ 2),
saturated sodium bicarbonate (150 mL), water (150 mL), and brine
(150 mL), then dried over anhydrous sodium sulfate. After filtra-
tion, the solvent was removed in vacuo and the residue was puri-
fied by silica gel column chromatography (23%, ethyl acetate in
petroleum ether) to give the product as an amber oil (10.0 g,
86%). Rf 0.33 (ethyl acetate/hexane, 1:2) 1H NMR: (300 MHz, CDCl3)
d ppm 7.49–7.22 (m, 10H, CH-Ar), 4.91 (d, J = 4.63 Hz, 1H, CH1),
4.75 (d, J = 12.38 Hz, 1H, CHH), 4.60 (d, J = 12.37 Hz, 1H; CHH),
4.54 (d, J = 12.11 Hz, 1H, CHH), 4.47 (d, J = 12.11 Hz, 1H; CHH),
4.21–4.09 (m, 2H, CH), 3.81 (dd, J = 7.10, 3.19 Hz, 1H, CH3), 3.50
(s, 3H, CH3), 3.47 (dd, J = 10.45, 4.11 Hz, 1H, CHH5), 3.39 (dd,
J = 10.39, 4.26 Hz, 1H; CHH5), 2.97 (d, J = 11.16 Hz, 1H, OH). 13C
NMR: (75 MHz, CDCl3) d ppm 137.9 (C-Ar), 137.8 (C-Ar), 128.4
(CH-Ar), 128.0 (CH-Ar), 127.9 (CH-Ar), 127.7 (CH-Ar), 103.0 (CH1),
82.0 (CH), 76.3 (CH3), 73.5 (CH2), 73.0 (CH2), 71.8 (CH), 70.0
(70 mL). The mixture was stirred at room temperature overnight.
After removal of the solvent in vacuo the residue was dissolved
in DCM (200 mL) and washed with water (150 mL ꢁ 2), diluted
hydrochloric acid (0.5%, 150 mL), saturated sodium bicarbonate
(150 mL), water (150 mL), and brine (150 mL). After drying over
anhydrous sodium sulfate, the solvent was removed in vacuo and
the residue was purified by silica gel column chromatography
(40% ethyl acetate in hexane) to give the product as a colorless
oil (13.50 g, 95% for two steps). Rf 0.64 (ethyl acetate/hexane,
3:1). 1H NMR: (400 MHz, CDCl3) d ppm 8.03 (dd, J = 8.35, 1.29 Hz,
2H, CH-Ar), 7.97 (dd, J = 8.32, 1.22 Hz, 2H, CH-Ar), 7.52–7.46 (m,
2H, CH-Ar), 7.40–7.33 (m, 4H, CH-Ar), 5.44 (dd, J = 6.73, 2.93 Hz,
1H, CH3), 5.03 (d, J = 4.37 Hz, 1H, CH1), 4.58 (dd, J = 13.12,
4.76 Hz, 1H, CHH5), 4.52–4.45 (m, 2H, CHH5, CH4), 4.12 (dd,
J = 6.73, 4.40 Hz, 1H, CH2), 3.72–3.64 (m, 2H, CH2), 3.45 (s, 3H,
CH3), 3.48–3.36 (m, 2H, CH2), 3.17 (s, 3H, CH3). 13C NMR:
(100 MHz, CDCl3) d ppm 166.2 (C@O), 166.0 (C@O), 133.1, 129.9,
129.7, 129.5, 128.3, 128.2 (CH-Ar, C-Ar), 102.8 (CH1), 80.7 (CH4),
79.7 (CH2), 72.8 (CH2), 71.3 (CH2), 71.0 (CH3), 64.8 (CH52), 59.3
(CH3), 55.9 (CH3). IR (neat): 2927, 1716, 1601, 1584, 1491, 1451,
1375, 1266, 1176, 1111, 1067, 1024, 953, 855, 708, 687 cmꢂ1. m/
z (%) LRMS [ES+, MeCN]: 453.3 ([M+Na]+, 90%), 883.7 ([2 M+Na]+,
100%). HRMS [ES+]: C23H26O8Na requires 453.1520 found
453.1518.
(CH5), 55.7 (CH3). IR (neat): 3334, 3030, 2913, 1496, 1453, 1412,
2
1361, 1271, 1187, 1090, 1025, 850, 737, 697 cmꢂ1. m/z (%) LRMS
[ES+, MeCN]: 367.2 ([M+Na]+, 100%), 711.5 ([2 M+Na]+, 65%). HRMS
[ES+]: C20H24O5Na requires 367.1516 found 367.1514.
4.1.3. 1-O-Methyl-2-O-(2-methoxyethyl)-3,5-di-O-benzyl-a-D-
ribofuranoside (5)
A solution of 4 (6.11 g, 17.7 mmol) in anhydrous DMF (60 mL)
was cooled to 0 °C and NaH was added (60% dispersion in mineral
oil, 2.40 g, 60.0 mmol). The mixture was stirred at 0 °C for 1 h then
2-bromoethyl methyl ether was added dropwise (10.40 mL,
110.6 mmol). The suspension was stirred at room temperature
for 8 h, after which water (5 mL) was added. After the solvent
was removed in vacuo, the residue was dissolved in DCM
(300 mL) and washed with water (100 mL ꢁ 3), diluted hydrochlo-
ric acid (0.5%, 150 mL), saturated sodium bicarbonate (150 mL),
water (150 mL) and brine (150 mL). After drying over anhydrous
sodium sulfate, the DCM was evaporated in vacuo. The residue
was purified by silica gel column chromatography (55% ethyl ace-
tate in petroleum ether) to give the product as a pale yellow oil
(6.74 g, 94%). Rf 0.22 (ethyl acetate/hexane, 1:1). 1H NMR:
(300 MHz, CDCl3) d ppm 7.39–7.11 (m, 10H, CH-Ar), 4.91 (d,
J = 3.73 Hz, 1H, CH1), 4.63 (d, J = 12.72 Hz, 1H, CHH), 4.51 (d,
J = 12.71 Hz, 1H; CHH), 4.45 (d, J = 12.13 Hz, 1H, CHH), 4.38 (d,
J = 12.13 Hz, 1H; CHH), 4.16 (dd, J = 6.80, 4.08 Hz, 1H, CH4), 3.82–
3.74 (m, 2H, CH3, CH2), 3.66–3.59 (m, 2H, CH2), 3.56–3.50 (m, 2H,
4.1.6. 1-O-Acetyl-2-O-(2-methoxyethyl)-3,5-di-O-benzoyl-D-
ribofuranoside (8)
Concentrated sulfuric acid (0.3 mL) was added with care to a
solution of 7 (3.00 g, 6.97 mmol) in acetic anhydride and acetic
acid (1:1, 30 mL). The solution was stirred at room temperature
for 5 h, after which water (30 mL) was added, followed by sodium
bicarbonate (solid) to adjust the pH to 7. The mixture was ex-
tracted with DCM (50 mL ꢁ 2) and the organic layer was washed
with water (30 mL ꢁ 2) and brine (30 mL). After drying over anhy-
drous sodium sulfate, the solvent was removed in vacuo and the
residue was purified by silica gel column chromatography (50%
ethyl acetate in hexane) to give the title product as a colorless oil
(2.71 g, 85%). Rf 0.80 (ethyl acetate/hexane, 3:1). m/z (%) LRMS
[ES+, MeCN]: 481.3 ([M+Na]+, 90%), 939.7 ([2 M+Na]+, 100%). HRMS
[ES+]: C24H26O9Na requires 481.1469 found 481.1470.
4.1.7. 20-O-(2-Methoxyethyl)-30,50-di-O-benzoyl-5-iodouridine
b-anomer (9)
CH2), 3.39 (s, 3H, CH3), 3.41–3.27 (m, 2H, CH5), 3.30 (s, 3H, CH3).
2
5-Iodouracil (0.31 g, 1.30 mmol) was suspended in anhydrous
CH3CN (15 mL), N,O-bis(trimethylsilyl)acetamide (1.47 mL,
6.01 mmol) was added and the mixture was stirred at room tem-
perature for overnight. The reaction mixture became colorless
and was then cooled to 0 °C before a solution of 8 (0.50 g,
1.09 mmol) in anhydrous CH3CN (5 mL) and SnCl4 (0.15 mL,
1.28 mmol) were added dropwise. After 20 min, the reaction mix-
ture was then heated to 50 °C and stirred for 16 h. DCM (100 mL)
was added and the solution was washed with water (60 mL ꢁ 3),
diluted hydrochloric acid (0.5%, 20 mL), saturated sodium bicar-
bonate (20 mL), water (20 mL), brine (20 mL) and dried over anhy-
drous sodium sulfate. After filtration, the solvent was removed in
vacuo and the residue was purified by silica gel column chroma-
tography (60% ethyl acetate in hexane) to afford the title product
as a white foam (0.56 g, 80%). Rf 0.36 (ethyl acetate/hexane, 1:1).
1H NMR: (400 MHz, DMSO-d6) d ppm 11.95 (s, 1H, NH3), 8.28 (s,
13C NMR: (75 MHz, CDCl3) d ppm 138.4 (C-Ar), 138.0 (C-Ar),
128.4 (CH-Ar), 128.2 (CH-Ar), 127.7 (CH-Ar), 127.6 (CH-Ar), 102.4
(CH1), 82.0 (CH4), 79.7 (CH), 75.0 (CH), 73.5 (CH2), 72.3 (CH2),
72.1 (CH2), 70.2 (CH5), 70.1 (CH2), 59.1 (CH3), 55.4 (CH3). IR (neat):
2
3029, 2911, 1604, 1496, 1453, 1243, 1106, 1025, 852, 736,
697 cmꢂ1. m/z (%) LRMS [ES+, MeCN]: m/z 425.3 ([M+Na]+, 100%),
827.6 ([2 M+Na]+, 45%). HRMS [ES+]: C23H30O6Na requires
425.1935 found 425.1942.
4.1.4. 1-O-Methyl-2-O-(2-methoxyethyl)-a-D-ribofuranoside (6)
Palladium hydroxide (1.30 g, 3.0 mmol, 20% on activated car-
bon) was added to a solution of 5 (13.28 g, 33.0 mmol) in anhy-
drous EtOH (75 mL). The suspension was stirred under
a
hydrogen atmosphere at 50 °C for 3 h. After filtration, the solvent
was removed in vacuo and the residue was used in next step with-
out any further purification. Rf 0.11 (ethyl acetate). m/z (%) LRMS
[ES+, MeCN]: 245.2 ([M+Na]+, 100%).
1H, CH6), 8.17–8.10 (m, 4H, CH-Ar), 7.84–7.75 (m, 2H, CH-Ar),
0
7.70–7.62 (m, 4H, CH-Ar), 6.02 (d, J = 5.45 Hz, 1H, CH1 ), 5.72 (dd,
0
J = 5.65, 4.86 Hz, 1H, CH), 4.77–4.68 (m, 4H, CH, CH, CH52 ), 3.81–
3.65 (m, 2H, CH2), 3.46–3.40 (m, 2H, CH2), 3.17 (s, 3H, CH3). 13C
NMR: (100 MHz, DMSO-d6) d ppm 166.8 (C@O), 166.2 (C@O),
4.1.5. 1-O-Methyl-2-O-(2-methoxyethyl)-3,5-di-O-benzoyl-a-D-
ribofuranoside (7)
Benzoyl chloride (10.0 mL, 86.1 mmol) was added dropwise to a
solution of the crude product 6 (7.80 g) in anhydrous pyridine
161.7 (C@O), 151.4 (C@O), 146.7 (CH6), 134.9, 130.7, 130.6, 130.5,
0
130.1, 130.0 (C-Ar, CH-Ar), 89.2 (CH1 ), 79.5 (CH), 79.4 (CH), 72.0

C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
6395
20
0
30
(CH2), 71.6 (CH), 70.4 (CH2), 64.4 (CH5 ), 58.6 (CH3). m/z (%) LRMS
1H, 30-OH), 4.29–4.23 (m, 1H, CH ), 4.21–4.17 (m, 1H, CH ),
2
0
[ES+, MeCN]: 659.4 ([M+Na]+, 100%). HRMS [ES+]: C26H25IN2O9Na
requires 659.0502 found 659.0491.
4.08–4.02 (m, 3H, CH2NH, CH4 ), 3.80 (s, 6H, CH3), 3.81–3.73 (m,
2H, CH2), 3.53 (t, J = 4.75, 4.75 Hz, 2H, CH2), 3.41–3.37, 3.21–3.13
0
(m, 2H, CH5 ), 3.29 (s, 3H, CH3). 13C NMR: (100 MHz, DMSO-d6) d
2
4.1.8. 20-O-(2-Methoxyethyl)-5-iodouridine (10)
ppm 167.8 (C@O), 158.6 (C@O), 150.1 (C@O), 144.3 (CH6), 130.2
(CH-Ar), 130.1 (CH-Ar), 128.4 (CH-Ar), 128.0 (CH-Ar), 127.1 (CH-
NaOMe (0.20 g, 3.70 mmol) was added to a solution of 9 (0.83 g,
1.31 mmol) in anhydrous MeOH (15 mL) and was stirred at room
temperature for 1.5 h under argon. Dowex-50w (H+) was added
and the mixture was stirred for 15 min at room temperature. The
resin was removed by filtration and washed extensively with
MeOH. The filtrate was then reduced to dryness in vacuo and the
residue was purified by silica gel column chromatography (10%
MeOH in ethyl acetate) to give the title product as a white foam
(0.38 g, 68%). Rf 0.52 (ethyl acetate/MeOH, 10:1). 1H NMR:
(400 MHz, DMSO-d6) d ppm 11.74 (s, 1H, NH3), 8.57 (s, 1H, CH6),
0
0
0
Ar), 113.7 (CH-Ar), 88.2 (CH1 ), 83.6 (CH4 ), 81.4 (CH2 ), 71.8 (CH2),
50
2
0
69.7 (CH2), 69.1 (CH3 ), 63.5 (CH ), 58.6 (CH3), 55.5 (CH3), 29.8
(CH2NH). m/z (%) LRMS [ES+, MeCN]: 776.5 ([M+Na]+, 100%). HRMS
[ES+]: C38H38F3N3O10Na requires 776.2402 found 776.2408.
4.1.11. 20-O-(2-Methoxyethyl)-30-O-(2-cyanoethyl(diisopropyl-
amino)phosphanyl)-50-O-(4,40-dimethoxytrityl)-5-(3-
trifluoroacetamidoprop-1-ynyl)-uridine (13)
N,N-Diisopropylethylamine (0.57 mL, 3.33 mmol) was added to
a solution of 12 (0.50 g, 0.66 mmol) in anhydrous DCM (15 mL),
followed by N,N-diisopropylethylamine (0.57 mL, 3.33 mmol) and
10
5.84 (d, J = 4.08 Hz, 1H, CH ), 5.34 (t, J = 4.60, 4.60 Hz, 1H, 50-OH),
30
5.06 (d, J = 6.01 Hz, 1H, 30-OH), 4.16 (m, 1H, CH ), 4.02 (t,
0
0
J = 4.51, 4.51 Hz, 1H, CH2 ), 3.95–3.91 (m, 1H, CH4 ), 3.78–3.72 (m,
2-cyanoethyl-N,N-diisopropyl
chlorophosphine
(0.20 mL,
0
0
3H, CH2, CHH5 ), 3.67–3.59 (m, 1H, CHH5 ), 3.53–3.49 (m, 2H,
CH2), 3.29 (s, 3H, CH3). 13C NMR: (100 MHz, DMSO-d6) d ppm
0.89 mmol). The mixture was stirred under argon for 3 h at room
temperature then saturated potassium chloride and anhydrous
DCM (50 mL) were added. The organic layer was separated under
an argon atmosphere and the solvent was removed in vacuo. The
residue was purified under an argon atmosphere by silica gel col-
umn chromatography (50% ethyl acetate in hexane with 2.5% tri-
ethylamine) to yield the product as a white foam (0.57 g, 91%). Rf
0.45, 0.57 (ethyl acetate/hexane, 3:1). 1H NMR: (400 MHz,
DMSO-d6) d ppm 11.89–11.67 (m, 1H, NH3), 10.09–9.96 (m, 1H,
NH), 8.06 (s, 1H, CH6), 7.53–7.26 (m, 9H, CH-Ar), 6.98–6.91 (m,
0
0
160.9 (C@O), 150.6 (C@O), 145.3 (CH6), 87.2 (CH1 ), 85.2 (CH4 ),
50
0
0
82.3 (CH2 ), 71.7 (CH2), 69.5 (CH2), 68.4 (CH3 ), 60.2 (CH ), 58.6
2
(CH3). m/z (%) LRMS [ES+, MeCN]: 451.1 ([M+Na]+, 100%), 879.4
([2 M+Na]+, 22%). HRMS [ES+]: C12H17IN2O7Na requires 450.9973
found 450.9972.
4.1.9. 20-O-(2-Methoxyethyl)-50-O-(4,40-dimethoxytrityl)-5-
iodouridine (11)
0
0
4,40-Dimethoxytrityl chloride (0.14 g, 0.42 mmol) in anhydrous
pyridine (3 mL) was added dropwise to a solution of 10 (0.15 g,
0.35 mmol) in anhydrous pyridine (5 mL). The reaction mixture
was stirred at room temperature for 18 h then MeOH (5 mL) was
added to quench the reaction. After removing the solvent in vacuo,
the residue was purified by silica gel column chromatography (65%
ethyl acetate in hexane with 2.5% pyridine) to give the title product
as a white foam (0.250 g, 98%). Rf 0.41 (ethyl acetate/hexane, 3:1).
1H NMR: (400 MHz, DMSO-d6) d ppm 11.83 (s, 1H, NH3), 8.05 (s,
1H, CH6), 7.43–7.25 (m, 9H, CH-Ar), 6.96 (d, J = 8.82 Hz, 4H, CH-
4H, CH-Ar), 5.85–5.79 (m, 1H, CH1 ), 4.57–4.29 (m, 2H, CH3 ,
0
0
CH2 ), 4.23–4.12 (m, 1H, CH4 ), 4.10–3.98 (m, 2H, CH2NH), 3.79,
3.80 (s, 6H, CH3), 3.92–3.46 (m, 2H, CH), 3.92–3.46 (m, 6H, CH2),
0
0
3.45–3.38 (m, 1H, CHH5 ), 3.26–3.17 (m, 1H, CHH5 ), 3.28, 3.27 (s,
3H, CH3), 2.89–2.62 (m, 2H, CH2), 1.38–0.93 (m, 12H, CH3). 13C
NMR: (100 MHz, DMSO-d6) d ppm 167.8 (C@O), 158.6 (C@O),
150.1 (C@O), 144.8 (CH6), 130.2 (CH-Ar), 130.1 (CH-Ar), 128.4
0
(CH-Ar), 128.0 (CH-Ar), 127.1 (CH-Ar), 113.7 (CH-Ar), 89.2 (CH1 ),
0
0
0
83.6 (CH4 ), 80.3 (CH2 ), 71.9 (CH2), 71.8 (CH2), 70.5 (CH3 ), 63.8
0
(CH5 ), 58.9 (CH2), 58.6 (CH3), 55.5 (CH3), 29.8 (CH2NH), 24.8
2
10
Ar), 5.85 (d, J = 4.33 Hz, 1H, CH ), 5.15 (d, J = 5.81 Hz, 1H, 30-OH),
(CH3), 20.3 (CH2). 31P NMR (121 MHz, DMSO-d6): d ppm 150.28,
149.81. m/z (%) LRMS [ES+, MeCN]: 976.8 ([M+Na]+, 100%). HRMS
[ES+]: C47H55F3N5O11PNa requires 976.3480 found 976.3481.
0
0
0
4.27–4.15 (m, 2H, CH3 , CH2 ), 4.06–4.00 (m, 1H, CH4 ), 3.80 (s, 6H,
CH3), 3.83–3.70 (m, 2H, CH2), 3.46 (dd, J =0 5.62, 3.93 Hz, 2H, CH2),
3.29 (s, 3H, CH3), 3.40–3.19 (m, 2H, CH5 ). 13C NMR: (100 MHz,
2
DMSO-d6) d ppm 160.9, 150.6 (C4, C2), 144.8 (CH6), 130.2 (CH-Ar),
128.4 (CH-Ar), 128.1 (CH-Ar), 127.2 (CH-Ar), 124.4 (CH-Ar), 113.8
4.2. Oligonucleotide synthesis purification and analysis
0
0
(CH-Ar), 87.8 (CH1 ), 83.7 (CH4 ), 81.4 (CH), 71.9 (CH2), 69.7 (CH2),
Oligonucleotide synthesis was carried out on an Applied Biosys-
tems 394 automated DNA/RNA synthesizer using a standard
0.2 lmol or 1.0 lmol phosphoramidite cycle of acid-catalyzed det-
50
2
69.1 (CH), 63.7 (CH ), 58.7 (CH3), 55.5 (CH3). m/z (%) LRMS [ES+,
MeCN]: 753.4 ([M+Na]+, 30%). HRMS [ES+]: C33H35IN2O9Na requires
753.1279 found 753.1261.
ritylation, coupling, capping, and iodine oxidation. All b-cyanoethyl
phosphoramidite monomers were dissolved in anhydrous CH3CN
to a concentration of 0.1 M immediately prior to use. The coupling
time for normal A, G, C, and T monomers was 25 s and this was ex-
tended to 6 min for all modified monomers. Stepwise coupling effi-
ciencies and overall yields were determined by automated trityl
cation conductivity monitoring and in all cases were >98.0%. The
oligonucleotides attached to the synthesis columns were treated
with 20% diethylamine in acetonitrile for 20 min then washed with
acetonitrile (5 ꢁ 1 mL). This procedure removes cyanoethyl groups
from the phosphotriesters and scavenges the resultant acryloni-
trile, preventing cyanoethyl adducts being formed at the primary
amines of MEPU. After this, cleavage of oligonucleotides from the
solid support and deprotection were achieved by exposure to con-
centrated aqueous ammonia for 12 h at room temperature. Purifi-
cation of oligonucleotides was carried out by reversed-phase HPLC
on a Gilson system using a Brownlee Aquapore column (C8,
8 mm ꢁ 250 mm, 300 Å pore) with a gradient of CH3CN in NH4OAc
increasing from 0% to 50% buffer B over 30 min with a flow rate of
4.1.10. 20-O-(2-Methoxyethyl)-50-O-(4,40-dimethoxytrityl)-5-(3-
trifluoroacetamidoprop-1-ynyl)-uridine (12)
Copper iodide (0.13 g, 0.68 mmol) was added to a solution of 11
(0.62 g, 0.84 mmol) in anhydrous DMF (15 mL) in a 50 mL round
bottom flask, followed by N-propargyltrifluoroacetamide (0.15 g,
0.99 mmol) and distilled triethylamine (1.2 mL, 8.6 mmol). The
flask was covered by aluminum foil to exclude light. After stirring
at room temperature for 20 min, tetrakis(triphenylphosphine)-pal-
ladium (0) (0.07 g, 0.06 mmol) was added and the reaction was
stirred under argon at room temperature overnight. The mixture
was reduced to dryness in vacuo, the residue was purified by silica
gel column chromatography (70% ethyl acetate in hexane with
2.5% pyridine) to afford the product as a white foam (0.50 g,
78%). Rf 0.21 (ethyl acetate/hexane, 3:1). 1H NMR: (400 MHz,
DMSO-d6) d ppm 11.78 (s, 1H, NH3), 10.02 (t, J = 5.31, 5.31 Hz,
1H, NH), 7.99 (s, 1H, CH6), 7.51–7.24 (m, 9H, CH-Ar), 6.98–6.92
0
(m, 4H, CH-Ar), 5.82 (d, J = 4.28 Hz, 1H, CH1 ), 5.18 (d, J = 6.38 Hz,

6396
C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
4 mL/min (buffer A: 0.1 M NH4OAc, pH 7.0; buffer B: 0.1 M NH4OAc
with 50% CH3CN, pH 7.0). Elution of oligonucleotides was moni-
tored by ultraviolet absorption at 298 nm (or 310 nm for TFOs con-
taining MEPU). After HPLC purification, oligonucleotides were
desalted using NAP-10 Sephadex columns (GE Healthcare) accord-
ing to the manufacturer’s instructions.
TFOs were analysed by negative mode electrospray MS on a Fi-
sons VG platform spectrometer in water with triisopropylamine
(0.02%). Hairpin duplexes were analysed by MALDI-TOF using a
ThermoBioAnalysis Dynamo MALDI-TOF spectrometer in positive
ion mode.27
site underlined) into the BamHI site of pUC19. The resulting clone
contained a dimer of this sequence with the two copies oriented in
opposite directions, enabling simultaneous visualization of the
pyrimidine (lower site) and purine (upper site) strands. The radio-
labelled footprinting fragment was prepared by digesting the plas-
mid with EcoRI and HindIII and labeling the insert at the 30-end of
the EcoRI site with
I digestion was performed as previously described.28 Radiolabelled
DNA (1.5 L) was incubated overnight with 3 L oligonucleotide
a
-[32P]-dATP using reverse transcriptase. DNase
l
l
(dissolved in 50 mM sodium acetate pH 5.0 containing 2.5 mM
MgCl2). Samples were digested with DNase I (0.01 units/mL, dis-
solved in 20 mM NaCl, 2 mM MgCl2, 2 mM MnCl2) for 2 min before
stopping the reaction by adding 4 lL of formamide containing
4.3. Ultraviolet melting studies
10 mM EDTA. The products of the reaction were separated on
10% polyacrylamide gels containing 8 M urea. The gel was fixed,
dried and exposed to a phosphorimager screen overnight.
To determine triplex melting temperatures (Tm), UV melting
studies were carried out on a Varian Cary 400 scan UV–vis spectro-
photometer using Hellma SUPRASIL synthetic quartz 10 mm path
length cuvettes, monitoring at 280 nm with a DNA duplex concen-
4.6. Serum stability studies
tration of 1.0 lM and a volume of 1.2 mL. Samples were prepared
as follows: The third strand and the duplex were mixed in a 3:1 ra-
tio in 2 mL Eppendorf tubes then lyophilized before suspending in
1.2 mL of the appropriate buffer solution (10 mM sodium phos-
phate, pH 6.2, 6.6, 7.0, 7.5 or 8.0 containing 200 mM NaCl). The
samples were then filtered into the cuvettes with Kinesis regener-
Oligonucleotides (2–4
C. elegans extract (2.75 mg/mL protein) at 20 °C in a total volume
of 100
L. For the C. elegans extract, adult worms were cultured29
and washed off plates with M9 buffer (KH2PO4 22 mM, Na2HPO4
42 mM, NaCl 85 mM, MgSO4 1 mM), spun at 2000 rpm for 2 min,
washed again to remove bacteria and spun as before. The worms
were resuspended in 1.5 mL of M9 buffer, cooled on ice and soni-
cated on ice for a total of 2 min in 5 s bursts, separated by 10 s. This
was then spun at 13,000 rpm for 2 min, the supernatant was care-
fully removed, and the protein concentration was determined from
lg) were incubated with FCS at 37 °C or
l
ated cellulose 13 mm, 0.45 lm syringe filters. The UV melting pro-
tocol involved initial denaturation by heating to 80 °C at 10 °C/min
followed by annealing by cooling to 15 °C at 0.5 °C/min, then main-
taining at 15 °C for 20 min before starting the melting experiment
which involved heating from 15 °C to 80 °C at 0.5 °C/min, holding
at 80 °C for 2 min then cooling to 15 °C at 0.5 °C/min. Two succes-
sive melting curves were measured before fast annealing from
80 °C to 20 °C at 10 °C/min. Tm values were calculated using Cary
Win UV thermal application software, taking an average of the
two melting curves.
the absorbance at 280 nm. 15
lL samples were removed at various
times and the reaction stopped by adding 7.5
lL of formamide con-
taining 10 mM EDTA and bromophenol blue. The products of the
reaction were separated on 15% polyacrylamide gels containing
8 M urea. The gels were visualized under UV light observing the
fluorescence of the attached 50-FAM.
4.4. Fluorescence melting studies
4.7. Crystallographic data
Fluorescence melting studies were conducted on a Roche Light-
Cycler 1.5 instrument with 10 mM phosphate buffer solution at pH
6.2, 6.6 or 7.0 containing 200 mM NaCl. Melting experiments were
Crystallographic data (excluding structure factors) for the
structures in this paper have been deposited with the Cam-
bridge Crystallographic Data Centre as supplementary publica-
tion nos. CCDC 770522. Copies of the data can be obtained,
free of charge, on application to CCDC, 12 Union Road, Cam-
bridge CB2 1EZ, UK, (fax: +44-(0)1223-336033 or e-mail:
deposit@ccdc.cam.ac.uk).
Data were collected on a Bruker Nonius KappaCCD with a Mo
rotating anode generator; standard data collection and processing
procedures were followed. Absolute structure was not determined
experimentally but inferred from the synthetic procedure.
performed in a total reaction volume of 20
lL which contained
0.25 M duplex and 2.5 M third strand. These complexes were first
l
l
denatured by rapidly heating to 95 °C at 20 °C/s and left to equili-
brate for 5 min. They were then slowly cooled to 30 °C at 0.5 °C/s
in 0.5 °C steps (each step held for 80 s) and held at 30 °C for a further
1 h. The complexes were heated again to 95 °C at 0.5 °C/s in 0.5 °C
steps (each step held for 80 s). Samples were maintained at 95 °C
for 5 min before annealing by cooling to 30 °C at the same slow rate
as above. After they were held at 30 °C for another 1 h, these com-
plexes were then melted again by heating to 95 °C at the same rate
as the same steps. Two successive melting curves were recorded be-
fore fast annealing from 95 °C to 30 °C at 20 °C/s. Recordingswere ta-
ken during both the melting steps as well as during annealing. The
LightCycler has one excitation source (480 nm) and fluorescence
emission was recorded at 525 nm. Tm values were calculated using
Roche LightCycler software, taking an average of the two melting
curves. This slow melting and annealing procedure was designed
to eliminate hysteresis ands produce reliable melting temperatures
under thermodynamic control.
Crystal data for 1-O-methyl-2-(p-tolouyl)-3,5-di-O-benzyl-D-a-
ribofuranoside: M = 462.52, Monoclinic, a = 10.5849(6), b =
4.9348(2), c = 22.8500(12) Å, b = 91.029(2)°, U = 1193.36(10) Å3,
T = 120(2) K, space group P2(1), Z = 2, 9138 reflections measured,
2360 unique reflections (Rint = 0.0668). The final R1 values were
0.0480 (I>2r(I)). The final wR(F2) values were 0.1016 (I>2r(I)).
The final R1 values were 0.0676 (all data). The final wR(F2) values
were 0.1108 (all data).
Acknowledgments
4.5. DNase I footprinting
This work was supported by a research Grant from BBSRC (SCIBS
initiative) and the European Commission’s Sixth framework Pro-
gramme (Project reference ZNIP) [037783]. We thank ORSAS for
funding a studentship to C.L. and ATDBio for oligonucleotide
synthesis.
The target sequence for the DNase I footprinting experiments
with the TFOs was prepared by ligating the sequence 50-GAT-
CAAAAACAAAGCTGGAAGGAAACAAAACAACTGTATGC (TFO target

C. Lou et al. / Bioorg. Med. Chem. 18 (2010) 6389–6397
6397
12. Puri, N.; Majumdar, A.; Cuenoud, B.; Natt, F.; Martin, P.; Boyd, A.; Miller, P. S.;
Seidman, M. M. J. Biol. Chem. 2001, 276, 28991.
Supplementary data
13. Bijapur, J.; Keppler, M. D.; Bergqvist, S.; Brown, T.; Fox, K. R. Nucleic Acids Res.
1999, 27, 1802.
14. Li, H.; Miller, P. S.; Seidman, M. M. Org. Biomol. Chem. 2008, 6, 4212.
15. Buchini, S.; Leumann, C. J. Angew. Chem., Int. Ed. 2004, 43, 3925.
16. Henry, S. P.; Miner, R. C.; Drew, W. L.; Fitchett, J.; York-Defalco, C.; Rapp, L. M.;
Levin, A. A. Invest. Ophthalmol. Vis. Sci. 2001, 42, 2646.
17. Li, N.-S.; Lu, J.; Piccirilli, J. A. Org. Lett. 2007, 9, 3009.
18. Martin, O. R.; Kurz, K. G.; Rao, S. P. J. Org. Chem. 1987, 52, 2922.
19. Papageorgiou, C.; Tamm, C. Tetrahedron Lett. 1986, 27, 555.
20. Cuenoud, B.; Casset, F.; Husken, D.; Natt, F.; Wolf, R. M.; Altmann, K. H.; Martin,
P.; Moser, H. E. Angew. Chem., Int. Ed. 1998, 37, 1288.
Supplementary data (alternative synthesis of 20-O-(2-methoxy-
ethyl)-5-iodouridine, UV and fluorescence melting curves and
derivatives of TFO-1-3 and target hairpin duplex at different pH
values) associated with this article can be found, in the online ver-
sion, at doi:10.1016/j.bmc.2010.07.005.
References and notes
1. Felsenfeld, G.; Davies, D. R.; Rich, A. J. Am. Chem. Soc. 1957, 79, 2023.
2. Gorman, L.; Glazer, P. M. Curr. Mol. Med. 2001, 1, 391.
3. Chan, P. P.; Glazer, P. M. J. Mol. Med. (Berlin) 1997, 75, 267.
4. Wang, G.; Seidman, M. M.; Glazer, P. M. Science 1996, 271, 802.
5. Praseuth, D.; Guieysse, A. L.; Helene, C. Biochim. Biophys. Acta, Gene Struct. Expr.
1999, 1489, 181.
6. Majumdar, A.; Khorlin, A.; Dyatkina, N.; Lin, F. L. M.; Powell, J.; Liu, J.; Fei, Z.;
Khripine, Y.; Watanabe, K. A.; George, J.; Glazer, P. M.; Seidman, M. M. Nat.
Genet. 1998, 20, 212.
21. Shimizu, M.; Konishi, A.; Shimada, Y.; Inoue, H.; Ohtsuka, E. FEBS Lett. 1992,
302, 155.
22. Escude, C.; Sun, J. S.; Rougee, M.; Garestier, T.; Helene, C. Comptes Rendus De L
Academie Des Sciences Serie Iii-Sciences De La Vie-Life Sciences 1992, 315, 521.
23. Asensio, J. L.; Carr, R.; Brown, T.; Lane, A. N. J. Am. Chem. Soc. 1999, 121, 11063.
24. Osborne, S. D.; Powers, V. E. C.; Rusling, D. A.; Lack, O.; Fox, K. R.; Brown, T.
Nucleic Acids Res. 2004, 32, 4439.
25. Darby, R. A. J.; Sollogoub, M.; McKeen, C.; Brown, L.; Risitano, A.; Brown, N.;
Barton, C.; Brown, T.; Fox, K. R. Nucleic Acids Res. 2002, 30, e39/1.
26. Ranasinghe, R. T.; Rusling, D. A.; Powers, V. E. C.; Fox, K. R.; Brown, T. Chem.
Commun. (Cambridge, UK) 2005, 2555.
27. Langley, G. J.; Herniman, J. M.; Davies, N. L.; Brown, T. Rapid Commun. Mass
Spectrom. 1999, 13, 1717.
28. Hampshire, A. J.; Rusling, D. A.; Broughton-Head, V. J.; Fox, K. R. Methods
(Oxford, UK) 2007, 42, 128.
7. Neidle, S. Anti-Cancer Drug Des. 1997, 12, 433.
8. Knauert, M. P.; Glazer, P. M. Hum. Mol. Genet. 2001, 10, 2243.
9. Gowers, D. M.; Fox, K. R. Nucleic Acids Res. 1999, 27, 1569.
10. Rusling, D. A.; Broughton-Head, V. J.; Brown, T.; Fox, K. R. Curr. Chem. Biol. 2008,
2, 1.
11. Puri, N.; Majumdar, A.; Cuenoud, B.; Natt, F.; Martin, P.; Boyd, A.; Miller Paul,
S.; Seidman Michael, M. Biochemistry 2002, 41, 7716.
29. Brenner, S. Genetics 1974, 77, 71.