Structural and biochemical analyses of glycoside hydrolase families 5 and 26 β-(1,4)-mannanases from Podospora anserina reveal differences upon manno-oligosaccharide catalysis

Article abstract of DOI:10.1074/jbc.M113.459438

The microbial deconstruction of the plant cell wall is a key biological process that is of increasing importance with the development of a sustainable biofuel industry. The glycoside hydrolase families GH5 (PaMan5A) and GH26 (PaMan26A) endo-β-1,4-mannanases from the coprophilic ascomycete Podospora anserina contribute to the enzymatic degradation of lignocellulosic biomass. In this study, P. anserina mannanases were further subjected to detailed comparative analysis of their substrate specificities, active site organization, and transglycosylation capacity. Although PaMan5A displays a classical mode of action, PaMan26A revealed an atypical hydrolysis pattern with the release of mannotetraose and mannose from mannopentaose resulting from a predominant binding mode involving the -4 subsite. The crystal structures of PaMan5A and PaMan26A were solved at 1.4 and 2.85 A resolution, respectively. Analysis of the PaMan26A structure supported strong interaction with substrate at the -4 subsite mediated by two aromatic residues Trp-244 and Trp-245. The PaMan26A structure appended to its family 35 carbohydrate binding module revealed a short and proline-rich rigid linker that anchored together the catalytic and the binding modules.

Full text of DOI:10.1074/jbc.M113.459438

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 20, pp. 14624–14635, May 17, 2013
© 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
Structural and Biochemical Analyses of Glycoside Hydrolase
Families 5 and 26 ␤-(1,4)-Mannanases from Podospora
anserina Reveal Differences upon Manno-oligosaccharide
□
S
Catalysis*
Received for publication, February 8, 2013, and in revised form, March 26, 2013 Published, JBC Papers in Press, April 4, 2013, DOI 10.1074/jbc.M113.459438
Marie Couturier‡, Alain Roussel§, Anna Rosengren¶, Philippe Leone§, Henrik Stålbrand¶, and Jean-Guy Berrin‡1
From the ‡INRA, UMR1163 BCF, Aix Marseille Université, Polytech Marseille, F-13288 Marseille, France, §Architecture et Fonction des
Macromolécules Biologiques, Aix Marseille Université, CNRS UMR7257, F-13288 Marseille, France, and the ¶Department of
Biochemistry and Structural Biology, Lund University, P. O. Box 124, S-221 00, Lund, Sweden
Background: Fungal mannanases contribute to enzymatic degradation of lignocellulose.
Results: New fungal mannanases reveal striking differences in substrate specificities. A rigid linker tightly connects the family
26 glycoside hydrolase to its binding module.
Conclusion: Podospora anserina mannanases display differences in substrate binding modes, transglycosylation activity, and
modular organization.
Significance: Information on the structure-function relationships of fungal mannanases is essential to improve the compre-
hension of biomass deconstruction.
The microbial deconstruction of the plant cell wall is a key
biological process that is of increasing importance with the
development of a sustainable biofuel industry. The glycoside
hydrolase families GH5 (PaMan5A) and GH26 (PaMan26A)
endo-␤-1,4-mannanases from the coprophilic ascomycete
Podospora anserina contribute to the enzymatic degradation of
lignocellulosic biomass. In this study, P. anserina mannanases
were further subjected to detailed comparative analysis of their
substrate specificities, active site organization, and transglyco-
sylation capacity. Although PaMan5A displays a classical mode
of action, PaMan26A revealed an atypical hydrolysis pattern
with the release of mannotetraose and mannose from manno-
pentaose resulting from a predominant binding mode involving
the ؊4 subsite. The crystal structures of PaMan5A and
PaMan26A were solved at 1.4 and 2.85 Å resolution, respec-
tively. Analysis of the PaMan26A structure supported strong
interaction with substrate at the ؊4 subsite mediated by two
aromatic residues Trp-244 and Trp-245. The PaMan26A struc-
ture appended to its family 35 carbohydrate binding module
revealed a short and proline-rich rigid linker that anchored
together the catalytic and the binding modules.
in smaller amounts in angiosperms (1). Mannans comprise a
backbone of ␤-1,4-linked D-mannose residues, known as man-
nan, or a heterogeneous combination of ␤-1,4-D-mannose and
␤-1,4-D-glucose units, termed glucomannan. Both can be dec-
orated with ␣-1,6-linked galactose side chains, and these poly-
saccharides are referred to as galactomannan and galactogluco-
mannan, respectively.
Several types of glycoside hydrolases (GH)2 are required for
complete degradation of mannans, and endo-␤-1,4-man-
nanases are the key enzymes. In the CAZy database (2), ␤-1,4-
mannanase activities are found in families GH5, GH26, and
GH113. The three families belong to clan GH-A; they share the
same (␤/␣)8-barrel protein fold, catalytic machinery, and
retaining double displacement mechanism (3–5). Because of
this retaining double displacement mechanism, some of these
enzymes are able to perform transglycosylation in which a car-
bohydrate hydroxyl group can act as an acceptor molecule
rather than water as is the case in hydrolysis. Transglycosyla-
tion thus leads to the synthesis of new glycosides or oligosac-
charides longer than the original substrate. GH5 and GH113
mannanases have been described as able to catalyze transglyco-
sylation reactions (6–9), whereas to date no evidence of
transglycosylation has been reported for GH26 mannanases
(10). ␤-Mannanases are frequently encountered as modular
enzymes. Indeed, some harbor carbohydrate binding modules
(CBMs) from families CBM1, CBM6, CBM10, CBM31, and
CBM35 (11, 12). It is generally observed that the linker regions
Endo-␤-1,4-mannanases (␤-mannanases, E.C. 3.2.1.78) cat-
alyze the random hydrolysis of manno-glycosidic bonds in
mannans and heteromannans. These polysaccharides are the
main components of hemicellulose in softwoods and are found
* This work was funded by the FUTUROL project and OSEO Innovation. This
work was also supported by FORMAS and VINNOVA (to H. S.).
This article contains supplemental Table S1 and Figs. S1 and S2.
2 The abbreviations used are: GH, glycoside hydrolase; CBM, carbohydrate bind-
ing module; CD, catalytic domain; HPAEC-PAD, high performance anion
exchange chromatography-pulsed amperometric detection; M1, mannose;
M2, mannobiose; M3, mannotriose; M4, mannotetraose; M5, mannopentaose;
M6, mannohexaose; PaCBM35, P. anserina CBM35; PaMan5A, P. anserina GH5
mannanase A; PaMan26A, P. anserina GH26 mannanase A; Bistris propane,
1,3-bis[tris(hydroxymethyl)methylamino]propane; BCMan, B. subtilis z-2
mannanase.
□S
The atomic coordinates and structure factors (codes 3ZIZ and 3ZM8) have been
deposited in the Protein Data Bank (http://wwpdb.org/).
1 To whom correspondence should be addressed: Jean-Guy Berrin, INRA,
Laboratoire de Biotechnologie des Champignons Filamenteux, Marseille,
France. Tel.: 33-4-91-82-86-04; Fax: 33-4-91-82-86-01; E-mail: jean-guy.
berrin@univ-amu.fr.
14624 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 288•NUMBER 20•MAY 17, 2013

Structural and Biochemical Characterization of Two Mannanases
TABLE 1
between catalytic module and CBM display a great deal of
Mutagenesis primers used in the study
Modified codons are underlined.
structural flexibility to maximize substrate accessibility, as has
been confirmed by the few crystal structures of bacterial mod-
ular enzymes (13, 14).
Primer
Nucleotide sequence 5ꢀ to 3ꢀ
E177Aforward GGGAACTTGCCAACGCGCCCAGGTGCAAGGG
E177AReverse CCCTTGCACCTGGGCGCGTTGGCAAGTTCCC
E283AForward CCGTGTTTGTTGGAGGCGTATGGGTATGAGAGTGATAGG
E283AReverse CCTATCACTCTCATACCCATACGCCTCCAACAAACACGG
E320AForward GGAGACCTCTTCACGCCGCGGAGGGTGGTTGG
E320AReverse CCAACCACCCTCCGCGGCGTGAAGAGGTCTCC
E410AForward GATGATTGCTGCTGCAGCCGTTGGCGCTGCC
E410AReverse GGCAGCGCCAACGGCTGCAGCAGCAATCATC
GH5 endo-␤-1,4-mannanases, which are found in bacteria,
fungi, animals, and plants are the most largely characterized
family. To date only three eukaryotic endo-mannanase three-
dimensional structures from family GH5 are available: one
from Trichoderma reesei (PDB code 1QNO; Ref. 15), one from
the blue mussel Mytilus edulis (PDB code 2C0H; Ref. 7), and
one from the tomato fruit Solanum lycopersicum (PDB code
1RH9; Ref. 16). Although several family GH26 endo-␤-1,4-
mannanases have also been characterized from different organ-
isms (e.g. Cellulomonas fimi (17), Cellvibrio japonicus (18),
Piromyces equi (19)), only sparse studies have focused on GH26
endo-␤-1,4-mannanases of fungal origin, and the five three-
dimensional structures available (B. subtilis, PDB code 2WHK
(20); B. subtilis PDB code 2QHA, (21); C. fimi PDB code 2BVT
(17); C. japonicus PDB code 1GVY (22); PDB code 2VX4 (23))
are all from bacteria and represent only catalytic domains
(CDs).
centrated using a Vivaspin with 10-kDa cut-off polyethersul-
fone membrane (Sartorius, Palaiseau, France) and dialyzed
against the buffer used for the size exclusion chromatography
(20 mM Hepes, pH 7.5, 150 mM NaCl). The concentrated frac-
tion was subsequently loaded onto a Superdex S200 HiLoad
16/60 column (Amersham Biosciences). The fractions contain-
ing PaMan5A or PaMan26A were pooled and concentrated as
described above.
Construction of Site-specific Variants—Site-directed muta-
genesis was performed using the QuikChange kit (Stratagene),
with primers listed in Table 1, according to the instructions of
manufacturer. Using the wild-type PaMan5A and PaMan26A
plasmids described in Couturier et al. 28), active-site variants
were designed for each enzyme. Two single-site mutants were
constructed for each enzyme: E177A and E283A for PaMan5A
and E300A and E390A for PaMan26A. Transformation was
performed in P. pastoris, and production and purification of
enzyme variants were carried out as described above.
The characterization of endo-␤-1,4-mannanases biochemi-
cal properties and substrate specificities revealed that many
release essentially mannobiose and mannotriose as end prod-
ucts (9, 17, 24, 25) and that their active site displays generally
5–6 subsites able to accommodate the substrate (10, 15).
Although GH5 and GH26 mannanases share some characteris-
tics, several studies revealed different modes of action. In par-
ticular, biochemical studies pointed to divergence in specificity
between GH5 and GH26 bacterial mannanases, a suggesting
different biological role (20, 26).
Deglycosylation Assay—N-Glycosylation sites were predicted
using the NetNGlyc 1.0 Server. To remove N-linked glycans,
purified enzymes were treated with peptide N-glycosidase F
New England Biolabs, Ipswich, MA) under denaturing condi-
tions according to the manufacturer’s instructions. Briefly, 10
␮g of protein were incubated in 0.5% SDS and 40 mM DTT and
boiled for 10 min for complete denaturation. Denaturated sam-
ples were subsequently incubated with 1500 units of peptide
N-glycosidase F in appropriate buffer for 1 h at 37 °C. Deglyco-
sylated and control samples were analyzed by SDS-PAGE
(Bio-Rad).
The coprophilic fungus Podospora anserina has one of the
largest fungal sets of candidate enzymes for cellulose and hemi-
cellulose degradation described to date and one of the highest
numbers of CBMs of all the fungal genomes available (27). In a
previous study comparative genomics were used that identified
two mannanases from families GH5 (PaMan5A) and GH26
(PaMan26A) in the P. anserina genome (28). Investigation of
the contribution made by each P. anserina mannanase to the
saccharification of spruce demonstrated that they individually
supplemented the secretome of the industrial T. reesei CL847
strain. The most striking effect was obtained with PaMan5A
that improved the release of total sugars by 28% and of glucose
by 18% (28). In the present study P. anserina GH5 and GH26
mannanases were subjected to detailed comparative analysis of
their substrate specificities, active site organization, and trans-
glycosylation capacity. The three-dimensional structures of
PaMan5A and PaMan26A linked to a CBM35 module were
solved in their native form at 1.4 and 2.85 Å resolution,
respectively.
Analysis of End Products Release from Polysaccharides—The
activity of PaMan5A and PaMan26A was assayed toward glu-
comannan, galactomannan, and linear mannan. Briefly, a 1%
w/v solution was prepared in 50 mM sodium acetate buffer, pH
5.2. The assay was performed by incubating 75 ␮g of enzyme
with 90 ␮l of 1% w/v substrate solution or suspension at 40 °C
for 30 min. After hydrolysis, mono- and oligo-saccharides were
analyzed using high performance anion exchange chromatog-
raphy (HPAEC) coupled with pulsed amperometric detection
(PAD) (ICS 3000; Dionex, Sunnyvale, CA) equipped with a car-
bo-PacPA-1 analytical column (250 ϫ 4 mm). 10-␮l samples of
enzymatic reactions were stopped by the addition of 90 ␮l of
100 mM NaOH before injection (5 ␮l) into the HPAEC system.
Elution was carried out in 130 mM NaOH using a 25-min linear
gradient program from 100% A (130 mM NaOH) to 60% A and
EXPERIMENTAL PROCEDURES
Production and Purification of PaMan5A and PaMan26A—
PaMan5A and PaMan26A were produced in P. pastoris 2-liter
cultures and purified as described previously in (28). Enzyme
purification was completed by an additional size exclusion
chromatographic step. After the nickel chelate purification 40% B (NaOAc, 500 mM; NaOH, 130 mM). All the assays were
step, the eluate containing PaMan5A or PaMan26A was con- carried out in triplicate.
MAY 17, 2013•VOLUME 288•NUMBER 20
JOURNAL OF BIOLOGICAL CHEMISTRY 14625

Structural and Biochemical Characterization of Two Mannanases
Hydrolysis Product Formation from Oligosaccharides and for M5) of the light (16O) species that overlaps with the heavy
Determination of Kinetic Parameters—Products generated (18O) peak followed by another correction for the 7% H216O
after hydrolysis of manno-oligosaccharides were analyzed contamination in the hydrolysis assays. M1 was not detectable
using HPAEC-PAD as described above. 20 ␮l of suitably diluted because of matrix suppression of low masses.
enzyme were incubated at 40 °C for various time lengths with
Transglycosylation Analysis—Reactions were set up to aim
180 ␮l of 100 ␮M substrate in 50 mM acetate buffer, pH 5.2. for detection of transglycosylation products with MALDI-
Calibration curves were plotted using ␤-1,4-manno-oligosac- TOF-MS, similarly to what was done in Rosengren et al. (32).
charides as standards from which response factors were calcu- Five mM M5 was incubated with 0.5 ␮M PaMan5A at 40 °C in 10
lated (Chromeleon program, Dionex) and used to determine mM sodium acetate buffer pH 5 for 0–15 min. Samples (0.5 ␮l)
the amount of products released at different time points. All the were withdrawn at different time points and spotted directly
Ϫ1
assays were carried out in duplicate. The data were fitted to the onto a stainless steel MALDI plate. Matrix solution (10 mgꢁml
equation of Matsui (29, 30), k ϭ ln[S0]/[St], where k ϭ (kcat
/
2,5-dihydroxybenzoic acid in water) was applied (0.5 ␮l), and
Km)[enzyme] ϫ time, and [S0] and [St] represent substrate con- the samples were dried under warm air. Data acquisition and
centration before the start of the reaction and at a specified time analysis was performed as described above.
during the reaction, respectively.
Protein Crystallization, Data Collection, and Processing—All
Hydrolysis of M5 and M6 in H218O—To determine and com- crystallization trials were carried out by the vapor diffusion
pare the hydrolytic cleavage patterns of M5 and M6 by method at 20 °C. PaMan5A was concentrated to 8 mgꢁmlϪ1 in
PaMan5A and PaMan26A, HPAEC-PAD data on the hydroly- 20 mM Hepes, pH 7.5, 150 mM NaCl buffer. Initial crystalliza-
sis products (as described above) was combined with the anal- tion trials were performed using Wizard and MDL screens
ysis of hydrolysis performed in H218O as described previously (Qiagen) on a cartesian robot. For each condition, three drops
(31, 32). Each productive binding of M5 or M6 gives rise to two (100 nl of screen buffer ϩ 100, 200, and 300 nl of protein) were
products (e.g. M6 cleaved to either two molecules of M3 or to M5 formed. Optimization was then carried out by varying the pH
and M1 or to M4 and M2). Quantitative HPAEC-PAD analysis and the concentration of precipitant. The final crystallization
of one product per cleavage (M3, M4, and M5, respectively) was conditions were Tris 0.1 M pH 8.5, 0.2 M sodium acetate, 30%
used to calculate the relative frequency of the productive bind- PEG 4000. Glycerol was used at a concentration of 25–30% as
ing modes of M5 and M6 that give rise to these products. Each of the cryoprotectant in the subsequent data collection stage.
these products can further be produced by either of two binding PaMan5A crystals belonged to the P212121 space group with
modes, and to distinguish between these two modes, the ratio of the cell dimensions a ϭ 56.9 Å, b ϭ 58.0 Å, and c ϭ 98.2 Å and
non-labeled (16O) and labeled (18O) product (M3, M4, and M5) diffracted to 1.4 Å resolution. X-ray diffraction data of a
was used. Reactions were performed at 8 °C (low temperature PaMan5A crystal were collected at 100K at the European Syn-
was used to avoid spontaneous incorporation of 18O (31)) in chrotron Research Facilities (ESRF, Grenoble, France) beam
H218O (93%, with a total of 7% H216O contamination (3% in the line ID29.
original H218O and 4% from the enzyme and substrate stock
PaMan26A was concentrated to ϳ26 mgꢁml in 20 mM
Ϫ1
solutions) containing 1 mM sodium acetate buffer, pH 5, 0.8 mM Hepes, pH 7.5, 150 mM NaCl buffer. Small PaMan26A crystals
substrate, and 0.1 ␮M enzyme. Samples (0.5 ␮l) were withdrawn were obtained in the conditions (i) 0.1 M Tris pH 7, 0.2 M Li2SO4,
at different time points (0–60 min) and spotted directly on a 1 M potassium sodium tartrate and (ii) 0.1 M imidazole, pH 8, 0.1
stainless steel plate for matrix-assisted laser desorption ioniza- M potassium sodium tartrate, 0.2 M NaCl, both conditions of the
tion-time-of-flight mass spectrometry (MALDI-TOF MS) Wizard screen. The best crystals were obtained after optimiza-
Ϫ1
analysis. Matrix (10 mgꢁml
2,5-dihydroxybenzoic acid in tion in a solution containing 0.1 M Tris, pH 7, 0.2 M NaCl, 0.8 M
H2O) was applied immediately to the sample, and it was dried potassium sodium tartrate, 1 mM HgCl2. For cryoprotection,
under warm air. Samples from 40 and 60 min had sufficient crystals were transferred in a solution containing 25% (v/v)
product build-up, and the determined ratios were in good glycerol, 1.5 M Li2SO4, 100 mM Bistris propane, pH 7.4. The
agreement (2–8% variation between the 40- and the 60-min crystals belonged to the P6522 space group with the following
samples from each incubation). The data from 40 min samples cell dimensions: a ϭ b ϭ 97.5 Å, c ϭ 268.7 Å. Several x-ray
were used.
diffraction data sets were collected on beam line Proxima1 at
MALDI-TOF MS Data Acquisition and Analysis—MALDI- the French synchrotron SOLEIL (Saint-Aubin, France) and on
TOF MS spectra were recorded in positive reflector mode using beam lines ID14-4 and ID29 at the European Synchrotron
a 4700 Proteomics Analyzer (Applied Biosystems, Framing- Research Facilities. The best x-ray diffraction data were col-
ham, MA). The laser intensity was set at 5500, and 50 subspec- lected to 2.85 Å resolution at the European Synchrotron
tra with 20 shots on each were accumulated from each sample Research Facilities beam line ID14-4.
spot. The program Data Explorer version 4.5 was used for anal-
All the data sets were processed with the programs XDS (33)
ysis of the data. The relative frequencies of the different pro- and SCALA (34). The data collection statistics are summarized
ductive binding modes resulting in the same products were in Table 2.
calculated from the relative areas of the monoisotopic peaks of
Structure Determination and Refinement—The structure of
16O- and 18O-labeled products as previously described (31). PaMan5A was determined with the molecular replacement
Two corrections were made; one for the [M ϩ 2] natural iso- method using the AMoRe program (35) and the T. reesei GH5
tope peak (5.3% of the monoisotopic peak for M3, 8% of the mannanase coordinates (PDB code 1QNO). The rotation func-
monoisotopic peak for M4, and 11% of the monoisotopic peak tion yielded one solution, and the translation function yielded a
14626 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 288•NUMBER 20•MAY 17, 2013

Structural and Biochemical Characterization of Two Mannanases
TABLE 2
RESULTS AND DISCUSSION
Data collection and model refinement statistics of PaMan5A and
PaMan26A
Hydrolytic Activity of PaMan5A and PaMan26A toward
Polysaccharides—In a recent study we showed that PaMan5A
and PaMan26A displayed similar kinetic parameters toward
a range of mannan substrates. To further compare the
P. anserina mannanases, we measured the release of manno-
oligosaccharides after hydrolysis of ivory nut mannan and
carob galactomannan. Toward the end of the reaction,
PaMan5A yielded mainly M2 and M3 and smaller amount of M1
(data not shown), consistent with other GH5 mannanases such
as T. reesei (40). PaMan26A produced mainly M4 and smaller
amounts of M1, M2, and M3 (data not shown). In other GH26
mannanases, different profiles have been observed; C. fimi
CfMan26A and C. japonicus CjMan26B released M2 and M1
(17, 26); and B. subtilis BCMan released M2 and M4 (21). The
nature of oligosaccharide products released upon mannan
hydrolysis confirms (i) the endo-mode of action of the two
enzymes and (ii) differences between the two enzymes in sub-
strate binding.
PaMan5A
PaMan26A
Data collection
Wavelength (Å)
Space group
0.97914
P212121
1.00648
P6522
a, b, c (Å)
56.87, 57.90, 97.86 97.49, 97.49, 268.72
Resolution (Å)a
Unique reflectionsa
Multiplicitya
30-1.4 (1.48-1.4)
62,519 (8,848)
8.4 (8.3)
50-2.85 (3.0-2.85)
18,575 (2,627)
11.8 (11.8)
Completeness (%)a
97.3 (95.7)
18.7 (3.4)
99.9 (100.0)
25.6 (4.6)
a
I/␴
R
merge (%)a,b
8.6 (67.8)
7.6 (65.2)
Refinement and model quality
Resolution (Å)
30-1.4
59,254
15.0/17.2
3,193
30-2.85
18,483
Reflections
R
cryst/Rfree (%)c
20.6/25.7
3,676
Number of atoms
Protein/carbohydrate moiety 2,745/0
3,493/28
143/12/2
Water/solvent/ion
434/14/0
Average B-factors (Å2)
Protein/carbohydrate moiety 10.6
68.2/888
Water/solvent/ion
28.5/10.6
63.3/85.1/92.1
r.m.s.d.d
Bond (Å)
0.010
1.02
0.008
1.04
Angle (°)
Hydrolytic Activity of PaMan5A and PaMan26A toward
Oligosaccharides—The capacity of PaMan5A and PaMan26A
to hydrolyze a range of manno-oligosaccharides was evaluated
by ionic chromatography to get further insights into their active
site architecture (Fig. 1). PaMan5A had very low activity on M3,
higher activity on M4, and cleaved M5 and M6 rapidly (Table 3).
A decrease of kcat/Km was observed with decreasing degree of
polymerization. The relative kcat/Km values of PaMan5A on
M3, M4, M5, and M6 were 1:358:1127:1782. The increase of the
degree of polymerization from 4 to 5 (M4 and M5) resulted in a
3.1-fold increase in kcat/Km, suggesting that at least four sub-
sites are required to achieve efficient hydrolysis. In contrast,
PaMan26A had no detectable activity on M3, very low activity
on M4, and cleaved M5 and M6 rapidly. For PaMan26A the
relative kcat/Km values on M4, M5, and M6 were 1:195:365 with
an increase of kcat/Km of 1.9-fold between M5 and M6 hydroly-
sis. These data suggest that PaMan26A requires at least five
subsites to achieve maximum manno-oligosaccharide hydroly-
sis efficiency.
Ramachandran plot (%)
Most favored regions
98.0
95.5
4.3
Additionally allowed regions 2.0
Outlier regions
0
0.2
PDB accession code
3ZIZ
3ZM8
a Values in parentheses are for the highest resolution shell.
b
R
merge ϭ ⌺hkl(⌺i͉IhklϪ͗Ihkl͉͘)/⌺hkl͉͗Ihkl͉͘.
c Rcryst ϭ ⌺hklʈFo͉ Ϫ ͉Fcʈ/⌺hkl͉Fo͉; Rfree was calculated for 5% of randomly selected
reflections excluded from refinement.
d Root mean square deviation from ideal values.
unique solution, with a correlation coefficient and an Rfactor of
38.1 and 44.5%, respectively, for data between 10 and 4 Å. After
rigid body refinement, the correlation coefficient was 59.2% for
an Rfactor of 35.9%. After refinement using the programs Refmac
(36) and Buster (37), the final crystallographic Rfactor and Rfree
were 15.0 and 17.2%.
The structure of PaMan26A was also determined with the
molecular replacement method using the AMoRe program
(35). The superposition of four structures of GH26 CDs (PDB
codes 2QHA, 2BVT, 2VX4, and 2WHK) plus the homology
model given by the Phyre server (38) has been used as an ensem-
ble search model for molecular replacement. The rotation func-
tion yielded one solution, and the translation function yielded a
unique solution, with a correlation coefficient and an Rfactor of
32.4 and 49.2%, respectively, for data between 10 and 4 Å. After
rigid body refinement, the correlation coefficient was 42.7% for
The nature of the hydrolysis products yielded from manno-
oligosaccharides (summarized in Table 4) also revealed striking
differences between the P. anserina mannanases. M6 hydrolysis
by PaMan5A produced mainly M3 with smaller amounts of M2
and M4, whereas M6 hydrolysis by PaMan26A produced mainly
M
4 and M2, with smaller amounts of M5 and M1 and without
an Rfactor of 43.7%. A modified structure of the CBM35 from any M3. M5 hydrolysis by PaMan5A yielded mainly M2 and M3,
Clostridium thermocellum (PDB code 2W47) with most of the with small amounts of M4 and M1, whereas hydrolysis by
loops deleted was located manually in the difference Fourier PaMan26A yielded only M4 and M1. M4 hydrolysis by
electron density map and was used as a starting point to build PaMan5A yielded mainly M2 with small amounts of M1 and
the CBM domain of PaMan26A. After performing several M3, whereas PaMan26A had low activity on M4 and produced
cycles of refinement using Refmac (36) and Buster (37) pro- M1, M2, and M3. PaMan5A poorly hydrolyzed M3, yielding M1
grams and manual replacement and building on the graphic and M2, and PaMan26A had no detectable activity on M3. Nei-
display with the Turbo-Frodo program (39), the Rfactor has ther mannanase had detectable activity on M2 and 4-nitrophe-
decreased to 20.7% (Rfree 25.8%). All representations of the nyl-mannose even at high enzyme loading (data not shown).
structure in the figures were prepared with the program Again, PaMan26A showed an atypical hydrolytic profile for a
PyMOL. Coordinates for the structure PaMan5A and GH26 endo-mannanase compared with CfMan26A and
PaMan26A have been deposited in the Protein Data Bank CjMan26A. CjMan26A hydrolyzes M4 rapidly and requires
under the accession number 3ZIZ and 3ZM8, respectively.
occupation of four subsites to achieve efficient hydrolysis (18),
MAY 17, 2013•VOLUME 288•NUMBER 20
JOURNAL OF BIOLOGICAL CHEMISTRY 14627

Structural and Biochemical Characterization of Two Mannanases
FIGURE 1. Progress curve of the manno-oligosaccharides generated by PaMan5A and PaMan26A after the hydrolysis of manno-oligosaccharides. The
recombinant enzymes were incubated with 100 ␮M manno-oligosaccharides in acetate buffer, pH 5.2, at 40 °C. The quantity of mannose (open diamonds), M2
(open squares), M3 (full circles), M4 (full triangles), M5 (full diamonds), and M6 (full squares) produced during the course of the reaction was quantified using
HPAEC-PAD. The concentrations of enzymes used were PaMan5A, 18.2 nM with M6 (A), 18.2 nM with M5 (B), and 60 nM with M4 (C), and PaMan26A (D), 15 nM with
M6 and 30 nM with M5 (E).
TABLE 3
site and in the latter case from the Ϫ2 to the ϩ1 subsite, follow-
Catalytic efficiencies of PaMan5A and PaMan26A on manno-
oligosaccharides
ing the established subsite nomenclature (41). As another
example, from M5, each of the products M3 and M4, respec-
K
cat/Km
tively, can be produced by either of two binding modes (see the
scheme in Fig. 2A). Binding of M5 from subsite Ϫ2 to ϩ3 or
from subsite Ϫ3 to ϩ2, both, generates M3, and binding from
subsite Ϫ4 to ϩ1 and from subsite Ϫ1 to ϩ4, both, generates
M4. Thus, product analysis using HPAEC-PAD data alone can-
not distinguish between binding modes giving the same prod-
ucts. However, this can be achieved when the HPAEC-PAD
product analysis (as in previous paragraph) is combined with in
situ product isotope labeling using 18O-labeled water followed
by mass spectrometric analysis as shown previously (31, 32).
Relative quantities of the produced M3, M4, and M5 from the
HPAEC-PAD data of M5 and M6 hydrolysis (Table 4) were used
to calculate the relative molar distribution of these products
(Table 4, values in parentheses), and thus the frequencies of
productive binding modes that give rise to these products could
be estimated (Fig. 2A, far left and far right column). MALDI-
TOF-MS analysis was conducted to determine the ratio of non-
labeled (16O) and labeled (18O) species of each product (light
Substrate
PaMan5A
PaMan26A
Ϫ1
M
Ϫ1 min
M6
M5
M4
M3
2.9 ϫ 106
1.9 ϫ 106
5.9 ϫ 105
1.6 ϫ 103
2.4 ϫ 106
1.3 ϫ 106
6.4 ϫ 103
NDa
a Not determined due to low activity.
whereas CfMan26A is less efficient toward M4 and requires
substrate binding at five subsites to achieve efficient hydrolysis
(17). For PaMan26A, the occupation by substrate of at least five
subsites to achieve efficient hydrolytic activity is even more
pronounced, with a dramatic increase in kcat/Km between M4
and M5.
Productive Binding Mode of M5 and M6 by PaMan5A and
PaMan26A—␤-Mannanases usually bind oligomeric sub-
strates in multiple productive binding modes that can generate
identical products. The simplest example of this is M3 hydro-
lysis to M2 and M1, where mannose would be released from
either the reducing end or the non-reducing end. In the former versus heavy M3, M4, or M5), which was then used to estimate
case M3 binds productively from the Ϫ1 subsite to the ϩ2 sub- the relative frequency of the productive binding modes of M5
14628 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 288•NUMBER 20•MAY 17, 2013

Structural and Biochemical Characterization of Two Mannanases
TABLE 4
Hydrolysis products released by PaMan5A and PaMan26A from manno-oligosaccharides
Products were quantified using HPAEC-PAD and are expressed as ␮M. Incubation was carried out for 30 min at 40 °C; ND, not detected.
Products
M3
Enzyme
Enzyme loading
Substrate
M1
M2
M4
M5
nM
␮M
PaMan5A
60
M4
M5
M6
M5
M6
11
2
49
32
12
ND
28
21
18.2
18.2
30
20 (80a)
34 (55a)
ND
5 (20a)
ND
34
13
14 (45a)
43 (100a)
33 (75a)
ND
11 (25a)
PaMan26A
15
ND
a The values in parentheses represent the relative molar distribution (%) between the products M3, M4, and M5 from each of the M5 and M6 incubations, which were used to
estimate the relative frequency of productive binding modes yielding these products (presented in Fig. 2A). One product (M3, M4, or M5) per productive binding was used
for calculations; thus, only half of the produced M3 (bold) from M6 incubations was accounted for (two molecules of M3 are produced from each molecule of M6).
FIGURE2. Relativefrequencyoftheproductivemodesofbindingofmanno-oligosaccharidestoPaMan5AandPaMan26A. A, thenumbersrepresentthe
percentages of binding in each binding mode. These were calculated from the quantitative product analysis using HPAEC-PAD (numbers to the far left and far
right, obtained from Table 4) followed by a detailed analysis of the hydrolytic cleavage patterns of M5 and M6 using MALDI-TOF-MS analysis of 18O-labeled
products, allowing to distinguish further between binding modes. The arrow indicates the mannosidic bond to be cleaved. *, reducing end of oligosaccharide.
The Ϫ4 and ϩ3 dashed subsites are only present in PaMan26A and PaMan5A, respectively. ND, not detected. B, MALDI-TOF-MS spectra of M5 hydrolysis by
PaMan5A and PaMan26A show enlarged parts of the spectra with the M3 product formed by PaMan5A at a ratio of 1:2.9 of M3/M3O18 (left) and the M4 product
formed by PaMan26A at a ratio of 1:5.0 of M4/M4O18 (right). The peaks in the spectra correspond to the monoisotopic masses of sodium adducts [M ϩ Na]ϩ of
the manno-oligosaccharides.
and M6 that give rise to these same products. The combined erated M3. MALDI-TOF analysis then determined the ratio
results of the HPAEC-PAD and MALDI-TOF-MS data are between the two binding modes that give M3. The analysis gave
O18
summarized in Fig. 2A, showing the relative frequencies (%) of a ratio of M3/M3
of 1:2.9 (Fig. 2B), which shows that the
productive binding modes of M5 and M6. The calculation pro- enzyme binds M5 preferably from subsite Ϫ3 to ϩ2 to produce
cedure is explained in supplemental Table S1. To exemplify, M3, giving a 59% frequency of this binding mode (Fig. 2A). Small
determined from HPAEC-PAD data (Table 4), 80% of the pro- amounts of M1 and M4 were also produced, and the ratio of
ductive binding during the hydrolysis of M5 by PaMan5A gen- M4/M4O18 was 1:0.7. Hydrolysis of M6 by PaMan5A produced
MAY 17, 2013•VOLUME 288•NUMBER 20
JOURNAL OF BIOLOGICAL CHEMISTRY 14629

Structural and Biochemical Characterization of Two Mannanases
mainly M3 (55% binding frequency) but also smaller amounts of
M2 and M4. The ratio of M4/M4O18 was 1:3.2, which shows that
PaMan5A binds M6 preferably from subsite Ϫ4 to ϩ2 to pro-
duce M4 (34% binding frequency). Hydrolysis of M5 by
PaMan26A yielded M1 and M4 with a M4/M4O18 ratio of 1:5.0
(Fig. 2B), which shows that the enzyme binds M5 preferentially
from subsite Ϫ4 to ϩ1 (83% binding frequency, see Fig. 2A). For
hydrolysis of M6, major product ratio analysis showed that the
O18
ratio of M4/M4
was 1:10.8, which shows that PaMan26A
prefers to bind M6 from subsite Ϫ4 to ϩ2 (69% binding fre-
quency). The ratio of the minor product M5/M5O18 was 1:4.2,
showing that M1 and M5 are mainly produced without binding
at the ϩ2 subsite. Thus, these data reveal clear differences in the
binding mode of the two P. anserina mannanases; the predom-
inant modes of binding of M5 and M6 were significantly differ-
ent (Fig. 2A). PaMan5A showed a classical pattern of hydrolysis
products (M3 and M2 mainly were released from M5) as
described in several studies (B. subtilis, C. japonicus, M. edulis),
whereas PaMan26A showed release of M4 and M1 from M5,
which is unusual when compared with other GH26 endo-man-
nanases (B. subtilis BCMan, C. fimi CfMan26A, C. japonicus
CjMan26A), suggesting an unusual arrangement of subsites in
the catalytic center.
Transglycosylation Ability—To detect potential transglyco-
sylation ability of the two enzymes, they were incubated with
M5 as substrate. The resulting short time course study of the
product formation clearly showed that PaMan5A, in addition
to hydrolysis products, also produces transglycosylation prod-
ucts with higher degree of polymerization than the original sub-
strate (Fig. 3). PaMan5A was able to transglycosylate yielding to
oligosaccharide structures of up to a degree of polymerization
of 8 (n ϩ 1 to n ϩ 3), in good agreement with GH5 mannanases
described before, T. reesei (n ϩ 1 to n ϩ 3) (31), and Aspergillus
nidulans ManA (n ϩ 1 to n ϩ 3) and ManC (n ϩ 1 and n ϩ 2)
(6). No transglycosylation products could be detected with
PaMan26A incubated with M5 in the same experimental con-
ditions, which is consistent with some other family GH26 man-
nanases that have been described as non transglycosylating
enzymes (10).
Structure of PaMan5A—The crystal structure of PaMan5A
was solved in its free form. The crystal contained one monomer
in the asymmetric unit, and light-scattering experiments indi-
cated that the protein is a monomer in solution (data not
shown). The overall structure of PaMan5A (Fig. 4A) revealed a
(␤/␣)8-barrel fold as expected for enzymes belonging to clan
GH-A. When superimposed with TrMan5A (PDB code 1QNR)
and Thermomonospora fusca mannanase (PDB code 3MAN)
structures (supplemental Fig. S1), the overall fold of PaMan5A
FIGURE 3. MALDI-TOF-MS analysis of the transglycosylation product for-
mation from M5 during 1–10 min by PaMan5A. Peaks in the spectra corre-
spond to monoisotopic masses of sodium adducts [M ϩ Na]ϩ of manno-
oligosaccharides: M2, m/z 365.1; M3, m/z 527.1; M4, m/z 689.2; M5, m/z 851.2;
M6, m/z 1013.3, M7, m/z 1175.3; M8, m/z 1337.3. The enlarged part in each
spectrum corresponds to ϳ3% of the relative intensity.
is very similar to that of TrMan5A, with structural differences peptide N-glycosidase F, no shift in the apparent molecular
being confined mainly in the loop regions (Fig. 4A) that have mass (46 kDa) was observed on SDS-PAGE compared with
been defined as eight loops: loop 1 (residues 35–42), loop 2 untreated sample (data not shown). This observation was in
(66–95), loop 3 (120–144), loop 4 (177–184), loop 5 (213–232), good agreement with NetGlyc predictions from the PaMan5A
loop 6 (252–258), loop 7 (287–289), and loop 8 (316–336). primary sequence (no predicted N-glycosylation site) and anal-
Compared with TrMan5A, which contains four disulfide ysis of the PaMan5A crystallographic data that confirmed
bonds, Cys-26–Cys-29, Cys-172—Cys-175, Cys-265—Cys- absence of glycosylation units.
272, and Cys-284—Cys-334, PaMan5A contained only three
The active site of PaMan5A was clearly identified in the
disulfide bonds, i.e. Cys-180—Cys-184, Cys-272—Cys-279, and groove, with the two conserved catalytic glutamate residues
Cys-291–Cys-342. After N-deglycosylation of PaMan5A using (acid-base and nucleophile) positioned near the C-terminal
14630 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 288•NUMBER 20•MAY 17, 2013

Structural and Biochemical Characterization of Two Mannanases
FIGURE 4. Crystal structure of PaMan5A. A, superposition of PaMan5A
(green) and TrMan5A (yellow) structures is shown. The two views are related
by a rotation of ϳ90° about the vertical axis. B, shown is a surface view of the
catalytic cleft of PaMan5A with mannotriose modeled in the Ϫ2 and Ϫ3 sub-
sites and mannobiose modeled in the ϩ1 and ϩ2 subsites. The structures of
GH5 from T. reesei and T. fusca in complex with mannobiose and mannotri-
ose, respectively, were superimposed on the top of the structure of PaMan5A
to map the substrate binding subsites.
ends of ␤-strands four and seven of the (␤/␣)8 barrel (41), Glu-
177 and Glu-283, respectively. Mutant E283A showed no cata-
lytic activity for glucomannan, thus indicating that Glu-283
should be the nucleophile. E177A had a specific activity of 0.47
Ϫ1
unitsꢁmg toward glucomannan, which is roughly 100-fold
lower than the wild-type enzyme (45 unitsꢁmgϪ1), thus indicat-
ing that Glu-177 should be the acid-base catalytic residue.
These results are in agreement with other homologous GH5
enzymes where catalytic residues have been determined (42,
43). Despite several attempts, no structure of PaMan5A inac-
tive mutants alone or in complex with its substrate has been
obtained. Consequently, we performed comparative structural
analysis of PaMan5A with other GH5 mannanases complexes
(T. reesei PDB code 1QNO, Thermotoga petrophila PDB code
3PZ9, and S. lycopersicum PDB code 1RH9) to map the sub-
FIGURE 5. Crystal structure of PaMan26A. A, superposition of PaMan26A
catalytic module (green) and BCMan (orange) structures. The two views are
related by a rotation of ϳ90° about the vertical axis. B, shown is a surface view
of the catalytic cleft of PaMan26A with mannotriose modeled in the Ϫ2 to Ϫ4
subsites. The structure of GH26 from C. fimi in complex with mannotriose was
superimposed on the top of the structure of PaMan26A to map the substrate-
bindingsubsites. C, shownistheorganizationoftheglyconebindingsubsites
in PaMan26A (yellow) compared with C. fimi (cyan).
strate binding subsites (Fig. 4B). In the Ϫ1 and ϩ1 subsites of PaMan26A CD revealed a (␤/␣)8-barrel fold (Fig. 5A) as
where the catalytic cleavage occurs, 7 of 8 residues highly con- expected for enzymes belonging to clan-GHA. The active site
served in GH5 mannanases (44) are found in PaMan5A, among was clearly identified in the groove, with the two conserved
which are the catalytic residues Glu-177 and Glu-283 and Arg- catalytic glutamate residues (Glu-300 and Glu-390) positioned
62, Asn-176, His-248, Tyr-250, Trp-315 (Fig. 4B). PaMan5A at the end of the (␤/␣)8 barrel and several aromatic residues
also has an arginine equivalent to Arg-171 in the ϩ2 subsite of forming the subsites of catalytic cleft. Mutant E390A showed
TrMan5A (15), which is semi-conserved among GH5 man- no catalytic activity for glucomannan, indicating that Glu-390
nanases and which was shown to play a significant role in the should be the nucleophile. E300A had a specific activity of 0.33
transglycosylation ability of TrMan5A (32).
unitsꢁmgϪ1, which is roughly 200-fold lower than the wild-type
Structure of PaMan26A Catalytic Module—The structure of enzyme (65 unitsꢁmgϪ1), thus indicating that Glu-300 should
PaMan26A was successfully solved using molecular replace- be the acid-base catalytic residue. These results are in agree-
ment. The search model was composed of the superimposition ment with other homologous GH26 enzymes where catalytic
of four structures of bacterial mannanases (PDB codes 2QHA, residues have been determined (45).
2BVT, 2VX4, and 2WHK). The final structure comprising 443
Electron density was observed for two carbohydrate sugar
residues was refined at 2.85 Å resolution. The overall structure residues at one glycosylation site, Asn-268, which is located in
MAY 17, 2013•VOLUME 288•NUMBER 20 JOURNAL OF BIOLOGICAL CHEMISTRY 14631

Structural and Biochemical Characterization of Two Mannanases
the CD on the external side of the barrel. As modeled from there is no equivalent to the Phe-42, Phe-325, and Gln-329
electron density, 2 ␤-1,4-linked N-acetylglucosamine (GlcNAc)
units are attached to this N-glycosylation site. N-Deglycosyla-
tion of PaMan26A using peptide N-glycosidase F was associ-
ated with a 2–3-kDa shift in the apparent molecular mass on
SDS-PAGE compared with untreated sample (data not shown).
These results confirm that PaMan26A is N-glycosylated and
are in agreement with the NetNGlyc prediction (one predicted
N-glycosylation site at position Asn-268).
CfMan26A Ϫ3 subsite residues. The lack of a strong Ϫ3 subsite
and the presence of a strong Ϫ4 subsite in the structure is in
agreement with our experimental results that suggest a pre-
dominant substrate binding mode involving the Ϫ4 subsite.
Lacking a strong Ϫ4 subsite, CfMan26A produces M2 and M3
as major products from M5 with only minor amounts of M1 and
M4 (31).
PaMan26A Modular Organization—PaMan26A harbors a
family 35 CBM at its N-terminal end, and the closest character-
ized enzyme is Humicola insolens ␤-mannanase (GenBankTM
AAQ31840 (46)) with 78% amino acid identity. After a BlastP
search using the PaMan26A amino acid sequence, it is interest-
ing to note that all related bacterial and fungal sequences har-
bor a CBM35 module at their N terminus. In fungi, in addition
to PaMan26A CBM35, only one CBM35 module binding to
galactan has been characterized to date in a Phanerochaete
chrysosporium exo-␤-1,3-galactanase (47). We previously sug-
gested that the N-terminal CBM35 module of PaMan26A dis-
played dual binding specificity toward xylan and mannan (28),
and the phylogenetic analysis was performed by Correia et al.
(48) clustered PaCBM35 in the subfamily II that is proposed to
target ␤-1,4 mannan.
Several regions are highly conserved between PaMan26A
and other GH26 mannanases from B. subtilis z-2 (PDB code
2QHA), B. subtilis subsp. bacillus (PDB code 2WHK),
C. japonicus (PDB codes 1GW1 and 2VX6), and C. fimi (PDB
code 2BVT; supplemental Fig. S2) as shown in the superimpo-
sition of PaMan26A and B. subtilis z-2 (PDB code 2QHA)
structures (Fig. 5A). The central ␤-barrel and most of the sur-
rounding ␣-helices are superimposable between PaMan26A
and B. subtilis z-2, whereas loop regions are dramatically differ-
ent. Indeed, B. subtilis enzyme exhibits a flat surface with a
shallow dish-shaped active center, whereas PaMan26A displays
large loops that form a deep cleft. According to the three-di-
mensional structure of PaMan26A, 8 loops are involved in the
binding of the substrate to the active site: loop 1 (171–174), loop
2 (195–208), loop 3 (230–266), loop 4 (301–314), loop 5 (342–
346), loop 6 (362–368), loop 7 (392–396), and loop 8 (413–425).
The most striking difference stands in loop 2 that contains four
aromatic residues (Trp-244, Trp-245, Phe-248, and Tyr-249)
and is nine amino acids longer than B. subtilis z-2 (PDB code
2QHA), B. subtilis subsp. bacillus (PDB code 2WHK),
C. japonicus (PDB code 2VX6), and C. fimi (PDB code 2BVT)
mannanases. A shorter loop 2 does not allow interaction with
the substrate at the glycone binding subsites in the case of
B. subtilis z-2 (PDB code 2QHA). The Ϫ1 and ϩ1 subsites of
PaMan26A are quite similar to homologous enzymes with the
conserved residues His-299, Trp-305, Phe-306, Tyr-362, Trp-
413 (Fig. 5, B and C). As described for CfMan26A and
CjMan26A, PaMan26A Tyr-362 is probably involved in a
hydrogen bond with the catalytic nucleophile Glu-390, whereas
PaMan26A Trp-305 and Trp-413 could play a role as aromatic
platforms to stabilize mannopyrannose rings at the ϩ1 and Ϫ1
subsites, respectively (Fig. 5C). In the Ϫ2 subsite of BCMan,
binding is not favorable because of steric hindrance due to the
position of Tyr-40 (21). In the case of CfMan26A, the two aro-
matic Phe-123 and Tyr-124 residues that are superimposed
with PaMan26A F248 and Tyr-249 stabilize the interaction
with a mannose unit at the Ϫ2 subsite (Fig. 5C).
Although the structures of fungal GH bearing a CBM are
generally determined separately, this is the first intact structure
that allows visualization of the juxtaposition of the CBM35
module relative to the GH26 CD. The linker region of
PaMan26A is short without any glycosylation sites, whereas
modular fungal GHs usually display long and highly glycosy-
lated linkers. The PaMan26A linker sequence was rich in pro-
line residues, i.e. it contains 4 prolines (Pro-132, -134, -135, and
-140) of 12 residues that may confer rigidity to the modular
enzyme (Fig. 6A). The linker starts on residue Ser-130 at the
end of the last ␤-strand of the N-terminal CBM domain. Only
two residues (Ala-131 and Pro-132) have no interaction with
the rest of the molecule. The region from residue R133 to resi-
due N141, which may be considered as the end of the linker, is
tightly bound to the CD. Arg-133 and His-136 side chains make
hydrogen bond with Asp-382, Asn-374, and Gln-404, whereas
the side chain of Ile-138 fits into a hydrophobic cavity made of
Arg-159 (aliphatic part of the side chain), Tyr-162, and Mer-
385. The CBM and the catalytic module are thus in close asso-
ciation thanks to the embedded linker (Fig. 6B), and it may
explain why attempts to express the catalytic module alone
were unsuccessful (data not shown). Alignment of PaMan26A-
CBM35 with 60 microbial GH26 mannanases sequences bear-
ing a CBM35 module revealed that they all display a short linker
region (12–14 residues) rich in proline residues (data not
shown).
Our experimental data indicate that PaMan26A displays
strong interactions at the Ϫ4 subsite. Indeed, PaMan26A was
poorly active toward M4 probably due to the formation of an
unproductive complex between Ϫ4 and Ϫ1 subsites. We fur-
ther analyzed the Ϫ4 subsite in the PaMan26A structure and
identified two aromatic residues, Tro-244 and Trp-245, located
in loop 2 that could stabilize mannopyrannose rings in the Ϫ4
subsite (Fig. 5, B and C). As PaMan26A, CfMan26A active site
also contains four glycone binding subsites, but experimental
results provided evidence for the existence of a strong Ϫ3 sub-
site, and residues involved in the Ϫ4 subsite were described as
The CBM35 domain comes into contact with the CD
through hydrophobic interactions. Indeed a hydrophobic patch
comprising Leu-58 and Leu-103 on the surface of the CBM35
domain stands in front of a cluster of hydrophobic residues
(Ala-402, Tyr-403, and Leu-399) of the CD. The rationale of the
tight modular association of bacterial and fungal GH26-
CBM35 mannanases will need further work to gain insights into
making a minor contribution to binding (17). In PaMan26A, their function.
14632 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 288•NUMBER 20•MAY 17, 2013

Structural and Biochemical Characterization of Two Mannanases
FIGURE6. ViewsofModulararchitectureofPaMan26A. A, shownisaribbondiagramof PaMan26Acatalytic(blue)andCBM(green)domains. Theproline-rich
linker is shown in stick format. B, shown is a molecular surface representation of PaMan26A structure with the catalytic domain in blue, the PaCBM35 domain
in green, and the linker in purple. The three aromatic residues present at the surface of the PaCBM35 domain are shown in yellow. C, shown is superposition of
the PaCBM35 domain (green) and C. thermocellum CBM35 (orange). The calcium ion is represented by a blue sphere.
PaCBM35 Domain—The CBM35 domain overall structure that has been modeled as calcium based on its coordination
consists of 2 antiparallel sheets consisting of 4 and 5 antiparallel geometry exclusively with oxygen atoms. A calcium ion is also
␤-strands, respectively. The two sheets are packed in a ␤-sand- present at a similar location in the structure of the CBM35
wich conformation enclosing a highly hydrophobic core. The domain from C. thermocellum (50). However, the second cal-
closest structural homologue found using the DALI server (49) cium evidenced in all of the other CBM35s and involved in
is a CBM35 from C. thermocellum (PDB code 2W1W (50)), carbohydrate recognition (50) is not conserved in PaCBM35.
with a Z-score of 18.6. Its superimposition with PaCBM35 A platform of three aromatic residues (Phe-87, Trp-117, and
shows that 57 C␣ of 125 C␣ (45%) have equivalent positions in Trp-119) was observed at the surface of the PaCBM35 (Fig.
both molecules, with the distance between the superimposed 6B). These residues are aligned with the PaMan26A catalytic
C␣ atoms Ͻ1 Å. The main differences occur in the loops con- cleft, suggesting that they could play a role in substrate
necting the ␤-strands as shown in Fig. 6C. A metal ion is present binding.
MAY 17, 2013•VOLUME 288•NUMBER 20
JOURNAL OF BIOLOGICAL CHEMISTRY 14633

Structural and Biochemical Characterization of Two Mannanases
drolase I, Cel7A, and the ␤-mannanase, Man5A. FEBS Lett. 443, 149–153
Conclusions—The P. anserina CAZome (the genome-wide
inventory of CAZymes) includes three genes encoding ␤-(1,4)-
mannanases: two GH5 mannanases without CBM (including
PaMan5A) that both belong to the GH5 subfamily 7 (51) and
one GH26 mannanase bearing a CBM35 (i.e. PaMan26A)
9. Zhang, Y., Ju, J., Peng, H., Gao, F., Zhou, C., Zeng, Y., Xue, Y., Li, Y.,
Henrissat, B., Gao, G. F., and Ma, Y. (2008) Biochemical and structural
characterization of the intracellular mannanase AaManA of Alicycloba-
cillus acidocaldarius reveals a novel glycoside hydrolase family belonging
to clan GH-A. J. Biol. Chem. 283, 31551–31558
with affinity for hemicellulosic polysaccharides (28). Based 10. Anderson, L., Hägglund, P., Stoll, D., Lo Leggio, L., Drakenberg, T., and
Stålbrand, H. (2008) Kinetics and stereochemistry of the Cellulomonas
on our kinetic analysis, we can conclude that PaMan5A and
fimi ␤-mannanase studied using 1H NMR. Biocatal. Biotransformation
PaMan26A are complementary in terms of hydrolysis profile
26, 86–95
and could act in synergy to deconstruct mannan polysaccha-
11. Stoll, D., Boraston, A., Stålbrand, H., McLean, B. W., Kilburn, D. G., and
rides. Indeed, PaMan26A produces larger manno-oligosaccha-
rides that could be processed by PaMan5A. In C. japonicus, a
bacterium also producing both GH5 and GH26 ␤-mannanases,
the catalytic modules of GH5 mannanases were linked to vari-
ous CBMs, whereas GH26 mannanases were found as single CD
(25). Therefore, it has been suggested that GH26 mannanases
were involved in degradation of storage tissues, whereas GH5
mannanases harboring cellulose-specific CBMs were involved
in degradation of plant cell wall (20, 26). It is interesting to note
that the P. anserina mannanase system does not seem to fit with
this model, suggesting a difference in the strategies to degrade
mannan between these two microbes.
Warren, R. A. (2000) Mannanase Man26A from Cellulomonas fimi has a
mannan binding module. FEMS Microbiol. Lett. 183, 265–269
12. Hägglund, P., Eriksson, T., Collén, A., Nerinckx, W., Claeyssens, M., and
Stålbrand, H. (2003) A cellulose binding module of the Trichoderma reesei
␤-mannanase Man5A increases the mannan-hydrolysis of complex sub-
strates. J. Biotechnol. 101, 37–48
13. Fujimoto, Z., Kuno, A., Kaneko, S., Kobayashi, H., Kusakabe, I., and
Mizuno, H. (2002) Crystal structures of the sugar complexes of Strepto-
myces olivaceoviridis E-86 xylanase. Sugar binding structure of the family
13 carbohydrate binding module. J. Mol. Biol. 316, 65–78
14. Pell, G., Szabo, L., Charnock, S. J., Xie, H., Gloster, T. M., Davies, G. J., and
Gilbert, H. J. (2004) Structural and biochemical analysis of Cellvibrio ja-
ponicus xylanase 10C. How variation in substrate binding cleft influences
the catalytic profile of family GH-10 xylanases. J. Biol. Chem. 279,
11777–11788
Together with our previous studies on P. anserina CAZymes
(28, 52, 53), the present findings give more insights into the
P. anserina enzymatic machinery for the deconstruction of
plant cell wall polysaccharides. This knowledge is essential to
design tailor-made biocatalysts, which can then be used in the
biofuel and bioprocessing industries.
15. Sabini, E., Schubert, H., Murshudov, G., Wilson, K. S., Siika-Aho, M., and
Penttilä, M. (2000) The three-dimensional structure of a Trichoderma
reesei ␤-mannanase from glycoside hydrolase family 5. Acta Crystallogr.
D. Biol. Crystallogr. 56, 3–13
16. Bourgault, R., Oakley, A. J., Bewley, J. D., and Wilce, M. C. (2005) Three-
dimensional structure of (1,4)-␤-D-mannan mannanohydrolase from to-
mato fruit. Protein Sci. 14, 1233–1241
17. Le Nours, J., Anderson, L., Stoll, D., Stålbrand, H., and Lo Leggio, L. (2005)
The structure and characterization of a modular endo-␤-1,4-mannanase
from Cellulomonas fimi. Biochemistry 44, 12700–12708
Acknowledgments—We thank N. Lopes-Ferreira, P.M. Coutinho and
C. Dumon for helpful discussions, A. Blanchard for Dionex analyses,
and M. Haon for protein purification. We thank the European Syn-
chrotron Radiation Facility at Grenoble (France) in particular the
beamline ID29 staff and French synchrotron (SOLEIL) at Saint-Au-
bin (France) and the beamline Proxima1 staff for assistance.
18. Hogg, D., Woo, E. J., Bolam, D. N., McKie, V. A., Gilbert, H. J., and Pick-
ersgill, R. W. (2001) Crystal structure of mannanase 26A from Pseudomo-
nas cellulosa and analysis of residues involved in substrate binding. J. Biol.
Chem. 276, 31186–31192
19. Fanutti, C., Ponyi, T., Black, G. W., Hazlewood, G. P., and Gilbert, H. J.
(1995) The conserved noncatalytic 40-residue sequence in cellulases and
hemicellulases from anaerobic fungi functions as a protein docking do-
main. J. Biol. Chem. 270, 29314–29322
REFERENCES
1. Timell, T. E. (1967) Recent progress in the chemistry of wood hemicellu-
lose. Wood Sci. Technol. 1, 45–70
20. Tailford, L. E., Ducros, V. M., Flint, J. E., Roberts, S. M., Morland, C.,
Zechel, D. L., Smith, N., Bjørnvad, M. E., Borchert, T. V., Wilson, K. S.,
Davies, G. J., and Gilbert, H. J. (2009) Understanding how diverse ␤-man-
nanases recognize heterogeneous substrates. Biochemistry 48, 7009–7018
21. Yan, X. X., An, X. M., Gui, L. L., and Liang, D. C. (2008) From structure to
function. Insights into the catalytic substrate specificity and thermostabil-
ity displayed by Bacillus subtilis mannanase BCman. J. Mol. Biol. 379,
535–544
2. Cantarel, B. L., Coutinho, P. M., Rancurel, C., Bernard, T., Lombard, V.,
and Henrissat, B. (2009) The carbohydrate-active EnZymes database
(CAZy). An expert resource for glycogenomics. Nucleic Acids Res. 37,
233–238
3. Davies, G., and Henrissat, B. (1995) Structures and mechanisms of glyco-
syl hydrolases. Structure 3, 853–859
4. Vocadlo, D. J., and Davies, G. J. (2008) Mechanistic insights into glycosi-
dase chemistry. Curr. Opin. Chem. Biol. 12, 539–555
22. Ducros, V. M., Zechel, D. L., Murshudov, G. N., Gilbert, H. J., Szabó, L.,
Stoll, D., Withers, S. G., and Davies, G. J. (2002) Substrate distortion by a
␤-mannanase. Snapshots of the Michaelis and covalent-intermediate
complexes suggest a B(2,5) conformation for the transition state. Angew.
Chem. Int. Ed. Engl. 41, 2824–2827
5. Gilbert, H. J., Stålbrand, H., and Brumer, H. (2008) How the walls come
crumbling down. Recent structural biochemistry of plant polysaccharide
degradation. Curr. Opin. Plant. Biol. 11, 338–348
6. Dilokpimol, A., Nakai, H., Gotfredsen, C. H., Baumann, M. J., Nakai, N.,
Abou Hachem, M., and Svensson, B. (2011) Recombinant production and
characterization of two related GH5 endo-␤-1,4-mannanases from Asper-
gillus nidulans FGSC A4 showing distinctly different transglycosylation
capacity. Biochim. Biophys. Acta 1814, 1720–1729
23. Cartmell, A., Topakas, E., Ducros, V. M., Suits, M. D., Davies, G. J., and
Gilbert, H. J. (2008) The Cellvibrio japonicus mannanase CjMan26C dis-
plays a unique exo-mode of action that is conferred by subtle changes to
the distal region of the active site. J. Biol. Chem. 283, 34403–34413
24. Setati, M. E., Ademark, P., van Zyl, W. H., Hahn-Hägerdal, B., and Stål-
brand, H. (2001) Expression of the Aspergillus aculeatus endo-␤-1,4-man-
nanase-encoding gene (man1) in Saccharomyces cerevisiae and character-
ization of the recombinant enzyme. Protein Expr. Purif. 21, 105–114
7. Larsson, A. M., Anderson, L., Xu, B., Muñoz, I. G., Usón, I., Janson, J. C.,
Stålbrand, H., and Ståhlberg, J. (2006) Three-dimensional crystal structure
and enzymic characterization of ␤-mannanase Man5A from blue mussel
Mytilus edulis. J. Mol. Biol. 357, 1500–1510
8. Harjunpää, V., Helin, J., Koivula, A., Siika-aho, M., and Drakenberg, T. 25. Xu, B., Hägglund, P., Stålbrand, H., and Janson, J. C. (2002) Endo-␤-1,4-
(1999) A comparative study of two retaining enzymes of Trichoderma
reesei. Transglycosylation of oligosaccharides catalysed by the cellobiohy-
Mannanases from blue mussel Mytilus edulis. Purification, characteriza-
tion, and mode of action. J. Biotechnol. 92, 267–277
14634 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 288•NUMBER 20•MAY 17, 2013

Structural and Biochemical Characterization of Two Mannanases
26. Hogg, D., Pell, G., Dupree, P., Goubet, F., Martín-Orúe, S. M., Armand, S.,
sugar binding subsites in glycosyl hydrolases. Biochem. J. 321, 557–559
42. Jenkins, J., Lo Leggio, L., Harris, G., and Pickersgill, R. (1995) ␤-Glucosi-
dase, ␤-galactosidase, family A cellulases, family F xylanases, and two bar-
ley glycanases form a superfamily of enzymes with 8-fold ␤/␣ architecture
and with two conserved glutamates near the carboxyl-terminal ends of
␤-strands four and seven. FEBS Lett. 362, 281–285
and Gilbert, H. J. (2003) The modular architecture of Cellvibrio japonicus
mannanases in glycoside hydrolase families 5 and 26 points to differences
in their role in mannan degradation. Biochem. J. 371, 1027–1043
27. Espagne, E., Lespinet, O., Malagnac, F., Da Silva, C., Jaillon, O., Porcel,
B. M., Couloux, A., Aury, J. M., Ségurens, B., Poulain, J., Anthouard, V.,
Grossetete, S., Khalili, H., Coppin, E., Déquard-Chablat, M., Picard, M.,
Contamine, V., Arnaise, S., Bourdais, A., Berteaux-Lecellier, V., Gau-
theret, D., de Vries, R. P., Battaglia, E., Coutinho, P. M., Danchin, E. G.,
Henrissat, B., Khoury, R. E., Sainsard-Chanet, A., Boivin, A., Pinan-Luca-
rré, B., Sellem, C. H., Debuchy, R., Wincker, P., Weissenbach, J., and Silar,
P. (2008) The genome sequence of the model ascomycete fungus Po-
dospora anserina. Genome Biol. 9, R77
43. Henrissat, B., Callebaut, I., Fabrega, S., Lehn, P., Mornon, J. P., and Davies,
G. (1996) Conserved catalytic machinery and the prediction of a common
fold for several families of glycosyl hydrolases. Proc. Natl. Acad. Sci. U.S.A.
93, 5674
44. Hilge, M., Gloor, S., Winterhalter, K., Zimmermann, W., and Piontek, K.
(1996) Crystallization and preliminary crystallographic analysis of two
␤-mannanase isoforms from Thermomonospora fusca KW3. Acta Crys-
tallogr. D. Biol. Crystallogr. 52, 1224–1225
28. Couturier, M., Haon, M., Coutinho, P. M., Henrissat, B., Lesage-Meessen,
L., and Berrin, J.-G. (2011) Podospora anserina hemicellulases potentiate
the Trichoderma reesei secretome for saccharification of lignocellulosic
biomass. Appl. Environ. Microbiol. 77, 237–246
45. Bolam, D. N., Hughes, N., Virden, R., Lakey, J. H., Hazlewood, G. P., Hen-
rissat, B., Braithwaite, K. L., and Gilbert, H. J. (1996) Mannanase A from
Pseudomonas fluorescens ssp. cellulosa is a retaining glycosyl hydrolase in
which E212 and E320 are the putative catalytic residues. Biochemistry 35,
16195–16204
29. Matsui, I., Ishikawa, K., Matsui, E., Miyairi, S., Fukui, S., and Honda, K.
(1991) Subsite structure of Saccharomycopsis ␣-amylase secreted from
Saccharomyces cerevisiae. J. Biochem. 109, 566–569
46. Kauppinen, M. S., Schulein, M., Schnorr, K., Andersen, L. N., and Mads E.
(May 20, 2003) U. S. Patent 6,566,114
30. Berrin, J.-G., Ajandouz, el H., Georis, J., Arnaut, F., and Juge, N. (2007)
Substrate and product hydrolysis specificity in family 11 glycoside hydro-
lase. An analysis of Penicillium funiculosum and Penicillium griseofulvum
xylanases. Appl. Microbiol. Biotechnol. 74, 1001–1010
47. Ichinose, H., Yoshida, M., Kotake, T., Kuno, A., Igarashi, K., Tsumuraya,
Y., Samejima, M., Hirabayashi, J., Kobayashi, H., and Kaneko, S. (2005) An
exo-␤-1,3-galactanase having a novel ␤-1,3-galactan-binding module
from Phanerochaete chrysosporium. J. Biol. Chem. 280, 25820–25829
48. Correia, M. A., Abbott, D. W., Gloster, T. M., Fernandes, V. O., Prates,
J. A., Montanier, C., Dumon, C., Williamson, M. P., Tunnicliffe, R. B., Liu,
Z., Flint, J. E., Davies, G. J., Henrissat, B., Coutinho, P. M., Fontes, C. M.,
and Gilbert, H. J. (2010) Signature active site architectures illuminate the
molecular basis for ligand specificity in family 35 carbohydrate binding
module. Biochemistry 49, 6193–6205
31. Hekmat, O., Lo Leggio, L., Rosengren, A., Kamarauskaite, J., Kolenova, K.,
and Stålbrand, H. (2010) Rational engineering of mannosyl binding in the
distal glycone subsites of Cellulomonas fimi endo-␤-1,4-mannanase.
Mannosyl binding promoted at subsite Ϫ2 and demoted at subsite Ϫ3.
Biochemistry 49, 4884–4896
32. Rosengren, A., Hägglund, P., Anderson, L., Pavon-Orozco, P., Peterson-
Wulff, R., Nerinckx, W., and Stålbrand, H. (2012) The role of subsite ϩ2 of
the Trichoderma reesei ␤-mannanase TrMan5A in hydrolysis and trans-
glycosylation. Biocatal. Biotransformation 30, 338–352
49. Holm, L., and Rosenström, P. (2010) Dali server. Conservation mapping in
3D. Nucleic Acids Res. 38, W545–W549
33. Kabsch, W. (2010) XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132
34. Evans, P. (2006) Scaling and assessment of data quality. Acta Crystallogr. D
Biol. Crystallogr. 62, 72–82
50. Montanier, C., van Bueren, A. L., Dumon, C., Flint, J. E., Correia, M. A.,
Prates, J. A., Firbank, S. J., Lewis, R. J., Grondin, G. G., Ghinet, M. G.,
Gloster, T. M., Herve, C., Knox, J. P., Talbot, B. G., Turkenburg, J. P.,
Kerovuo, J., Brzezinski, R., Fontes, C. M., Davies, G. J., Boraston, A. B., and
Gilbert, H. J. (2009) Evidence that family 35 carbohydrate binding mod-
ules display conserved specificity but divergent function. Proc. Natl. Acad.
Sci. U.S.A. 106, 3065–3070
35. Navaza, J. (2001) Implementation of molecular replacement in AMoRe.
Acta Crystallogr. D. Biol. Crystallogr. 57, 1367–1372
36. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997) Refinement of
macromolecular structures by the maximum-likelihood method. Acta
Crystallogr. D Biol. Crystallogr. 53, 240–255
51. Aspeborg, H., Coutinho, P. M., Wang, Y., Brumer, H., 3rd, and Henrissat,
B. (2012) Evolution, substrate specificity, and subfamily classification of
glycoside hydrolase family 5 (GH5). BMC Evol. Biol. 12, 186
37. Bricogne, G., Blanc, E., Brandl, M., Flensburg, C., Keller, P., Paciorek, W.,
Roversi, P., Sharff, A., Smart, O. S., Vonrhein, C., and Womack, T. O.
(2011) BUSTER Version 2.11.2, Global Phasing Ltd., Cambridge, UK
38. Kelley, L. A., and Sternberg, M. J. (2009) Protein structure prediction on
the web. A case study using the Phyre server. Nat. Protoc. 4, 363–371
39. Roussel, A., and Cambillau, C. (1991) Turbo-Frodo. in Silicon Graphics
Geometry Partners Directory, p. 86, Mountain View Publications, CA
40. Stålbrand, H., Siika-aho, M., Tenkanen, M., and Viikari, L. (1993) Purifi-
cation and characterization of two ␤-mannanases from Trichoderma re-
esei. J. Biotechnol. 29, 229–242
52. Bey, M., Zhou, S., Poidevin, L., Henrissat, B., Coutinho, P. M., Berrin, J.-G.,
and Sigoillot, J.-C. (2013) Cello-oligosaccharide oxidation reveals differ-
ences between two lytic polysaccharide monooxygenases (family GH61)
from Podospora anserina. Appl. Environ. Microbiol. 79, 488–496
53. Lafond, M., Navarro, D., Haon, M., Couturier, M., and Berrin, J.-G. (2012)
Characterization of a broad-specificity ␤-glucanase acting on ␤-(1,3)-,
␤-(1,4)-, and ␤-(1,6)-glucans that defines a new glycoside hydrolase fam-
ily. Appl. Environ. Microbiol. 78, 8540–8546
41. Davies, G. J., Wilson, K. S., and Henrissat, B. (1997) Nomenclature for
MAY 17, 2013•VOLUME 288•NUMBER 20
JOURNAL OF BIOLOGICAL CHEMISTRY 14635

Enzymology:
Structural and Biochemical Analyses of
Glycoside Hydrolase Families 5 and 26 β
-(1,4)-Mannanases from Podospora
anserina Reveal Differences upon
Manno-oligosaccharide Catalysis
Marie Couturier, Alain Roussel, Anna
Rosengren, Philippe Leone, Henrik Stålbrand
and Jean-Guy Berrin
J. Biol. Chem. 2013, 288:14624-14635.
doi: 10.1074/jbc.M113.459438 originally published online April 4, 2013
Access the most updated version of this article at doi: 10.1074/jbc.M113.459438
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
Supplemental material:
http://www.jbc.org/content/suppl/2013/04/04/M113.459438.DC1.html
This article cites 50 references, 13 of which can be accessed free at
http://www.jbc.org/content/288/20/14624.full.html#ref-list-1