Design, synthesis, and biological evaluation of structurally modified isoindolinone and quinazolinone derivatives as hedgehog pathway inhibitors

Article abstract of DOI:10.1016/j.ejmech.2016.10.040

The Hedgehog (Hh) signaling pathway is associated with diverse aspects of cellular events, such as cell migration, proliferation, and differentiation throughout embryonic development and tissue patterning. An abnormal Hh signaling pathway is linked to numerous human cancers, including basal cell carcinoma (BCC), medulloblastoma (MB), lung cancer, prostate cancer, and ovarian cancer, and it is therefore a promising target in cancer therapy. Using a structure-hopping approach, we designed new Hh signaling pathway inhibitors with isoindolinone or quinazolinone moieties, which were synthesized and biologically evaluated using an 8xGli-luciferase (Gli-Luc) reporter assay in NIH3T3 cells. Compounds 9–11 and 14 with isoindolinone scaffolds demonstrated moderate Hh inhibitory activity; whereas quinazolinone derivatives 24, 29, 32, 34, and 35 exhibited good potency with submicromolar IC₅₀values and the analog 28 showed nanomolar IC₅₀value. Although sonidegib shows a decrease in inhibitory effect on vismodegib resistance-conferring Smo mutants, the structurally modified new compounds not only possess the pharmacophoric properties of Hh pathway inhibition but also preserve the suppressive potency in drug-resistant Smo mutants. Mechanistically, quinazolinone derivatives 28 and 34 suppress Hh signaling by blocking Smo and Gli translocation into the cilia, similar to vismodegib and sonidegib. Additionally, the human microsomal stability of the representative analogs 28 and 34 were determined to be comparable to that of the reference compound sonidegib. Thus, these new scaffolds can serve as a platform for the development of novel cancer therapeutics targeting the Hh pathway.

Full text of DOI:10.1016/j.ejmech.2016.10.040

Accepted Manuscript
Design, synthesis, and biological evaluation of structurally modified isoindolinone and
quinazolinone derivatives as hedgehog pathway inhibitors
Deepak Bhattarai, Joo Hyun Jung, Seunghyeon Han, Hankyu Lee, Soo Jin Oh, Hyuk
Wan Ko, Kyeong Lee
PII:
S0223-5234(16)30902-3
10.1016/j.ejmech.2016.10.040
EJMECH 9005
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 31 March 2016
Revised Date: 13 September 2016
Accepted Date: 17 October 2016
Please cite this article as: D. Bhattarai, J.H. Jung, S. Han, H. Lee, S.J. Oh, H.W. Ko, K. Lee, Design,
synthesis, and biological evaluation of structurally modified isoindolinone and quinazolinone derivatives
as hedgehog pathway inhibitors, European Journal of Medicinal Chemistry (2016), doi: 10.1016/
j.ejmech.2016.10.040.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Design, Synthesis, and Biological Evaluation of Structurally Modified
Isoindolinone and Quinazolinone Derivatives as Hedgehog Pathway Inhibitors
Deepak Bhattaraia#, Joo Hyun Jungb#, Seunghyeon Hana, Hankyu Leeb, Soo Jin Ohc, Hyuk Wan
Kob *, and Kyeong Leea *
aBK21Plus R-FIND Team, College of Pharmacy, Dongguk University-Seoul, 32, Dongguk-ro,
Ilsandong-gu, Goyang, 410-820, Republic of Korea
bCollege of Pharmacy, Dongguk University, 32 Dongguk-ro, Ilsandong-gu, Goyang-si,
Gyeonggi-do, 410-820, Republic of Korea
cBio-Evaluation Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB),
Chungbuk 363-883, Republic of Korea
#These authors contributed equally to this work
Corresponding authors:
Hyuk Wan Ko
Tel: +82-31-961-5224. Fax: 82-31-961-5206. E-mail: kohw@dongguk.edu
College of Pharmacy, Dongguk University-Seoul, 32 Dongguk-ro, Ilsandong-gu, Goyang, 410-
820, Republic of Korea
Kyeong Lee
Tel: +82-31-961-5214. Fax: +82-31-961-5206. E-mail: Kaylee@dongguk.edu
BK21Plus R-FIND Team, College of Pharmacy, Dongguk University-Seoul, 32, Dongguk-ro,
Ilsandong-gu, Goyang, 410-820, Republic of Korea
ABSTRACT
The Hedgehog (Hh) signaling pathway is associated with diverse aspects of cellular events,
such as cell migration, proliferation, and differentiation throughout embryonic development and
tissue patterning. An abnormal Hh signaling pathway is linked to numerous human cancers,
including basal cell carcinoma (BCC), medulloblastoma (MB), lung cancer, prostate cancer, and
ovarian cancer, and it is therefore a promising target in cancer therapy. Using a structure-
hopping approach, we designed new Hh signaling pathway inhibitors with isoindolinone or
1

ACCEPTED MANUSCRIPT
quinazolinone moieties, which were synthesized and biologically evaluated using an 8xGli-
luciferase (Gli-Luc) reporter assay in NIH3T3 cells. Compounds 9–11 and 14 with
isoindolinone scaffolds demonstrated moderate Hh inhibitory activity; whereas quinazolinone
derivatives 24, 29, 32, 34, and 35 exhibited good potency with submicromolar IC50 values and
the analog 28 showed nanomolar IC50 value. Although sonidegib shows a decrease in inhibitory
effect on vismodegib resistance-conferring Smo mutants, the structurally modified new
compounds not only possess the pharmacophoric properties of Hh pathway inhibition but also
preserve the suppressive potency in drug-resistant Smo mutants. Mechanistically, quinazolinone
derivatives 28 and 34 suppress Hh signaling by blocking Smo and Gli translocation into the cilia,
similar to vismodegib and sonidegib. Additionally, the human microsomal stability of the
representative analogs 28 and 34 were determined to be comparable to that of the reference
compound sonidegib. Thus, these new scaffolds can serve as a platform for the development of
novel cancer therapeutics targeting the Hh pathway.
Keywords
Quinazolinone
Isoindolinone
Hedgehog pathway
Structure hopping
Smoothened
Gli
1. Introduction
The Hedgehog (Hh) signaling pathway plays an important role in many vital cellular processes,
such as cell proliferation and differentiation in embryonic development. It is also postnatally
involved in the maintenance and repair of tissues [1]. The Hh pathway is initiated by the binding
of the Hh protein ligand to the 12-pass transmembrane protein Patched (Ptch), which otherwise
suppresses smoothened (Smo), a 7-pass transmembrane G-protein coupled receptor (GPCR)-
like protein. Smo is a key component in the Hh signaling cascade. Hh binds to Ptch, and due to
this, active Smo moves to the primary cilia that is microtubule-based cellular organelles recently
revealed to function as signaling centers for Hh signal transduction. The activation of Smo leads
to the accumulation of Gli transcription factors in the primary cilia and the transformation of Gli
2

ACCEPTED MANUSCRIPT
from inactive to active form. Activated Gli proteins translocate to the nucleus to turn on the Hh
target gene expression, including Gli1 and Ptch [2–6]. Abnormal upregulation of the Hh
pathway has been associated with a variety of cancers, such as basal cell carcinoma (BCC),
medulloblastoma (MB), as well as pancreatic, prostate, lung, colorectal, and ovarian cancers.
Due to the accumulating evidence showing a direct link between Hh pathway activation and the
development of multiple types of cancers, it is considered one of the attractive molecular targets
in cancer research [7–9].
Many small molecule Hh pathway inhibitors have been reported to date. Vismodegib is the first
Hh pathway inhibitor that was approved by the FDA in 2012 for the treatment of BCC.
Sonidegib (LDE225), also known as erismodegib, is a recently approved Hh pathway inhibitor
and marketed as Odomzo® for the treatment of BCC. Many other compounds such as LY-
2940680, BMS-833923, saridegib, PF-04449913, TAK-441, and NVP-LEQ506 are in different
stages of clinical development (Fig. 1) [10–13]. Most of the reported synthetic small molecules
till date are Smo antagonists. Such Smo antagonists inhibit the Hh pathway by interacting with
Smo and suppress tumor growth in several cancer types, including BCC, MB, lung cancer,
prostate cancer, and ovarian cancer. Of note, a recent clinical evaluation of metastatic MB
patients treated with vismodegib raised the concern of the relapse of resistant cancers.
Resistance is mainly associated with human Smo missense mutation D473H, which diminishes
the binding affinity of vismodegib to Smo. A comparable murine Smo mutation, SmoD477G in the
mouse MB model (Ptch+/-; p53-/-), was also identified as conferring drug resistance of MB
treated with vismodegib [14–16].
<Figure 1>
During our investigation of a novel promising Hh antagonist, we envisioned that the structural
modification of sonidegib, which was then in an active stage of clinical development, might
lead to a new scaffold with better potency and physiochemical properties [17]. For that purpose,
we anticipated structure-hopping technique that is a common method in medicinal chemistry to
design a new scaffold from a well-known drug candidate or a drug. We applied the ring-closing
structure-hopping approach and designed the cyclized version of sonidegib from its
comparatively flexible amide linkage without or with a heteroatom and prepared isoindolinone
(I) and quinazolinone (II) derivatives (Fig. 2). The rigid cyclized structure (new scaffold)
derived from comparatively flexible amide linkage may lead to better binding affinity and
3

ACCEPTED MANUSCRIPT
pharmacokinetics of the parent drug candidate [18, 19].
Quinazolinones are fused heterocyclic molecules that constitute more than 100 natural product
alkaloids, and they are reported to exhibit broad biological activity, including anticancer, anti-
inflammatory, antiviral, and antimicrobial properties [20]. Isoindolinones, found in many natural
products, also exhibit various biological activities, such as antihypertensive, antipsychotic,
anesthetic, anxiolytic, antiviral, and antileukemic activities [21].
<Figure 2>
As part of our drug development program targeting the Hh pathway, herein, we report a
structure activity relationship (SAR) investigation, mechanism of action study, and metabolic
stability analysis of structurally modified isoindolinone and quinazolinone derivatives as
potential Hh pathway inhibitors.
2. Results and Discussion
2.1. Synthesis
The target compounds were synthesized as shown in Schemes 1–4. Required aromatic amines
3a-3e, which is for both type I and II compounds, were prepared by aromatic nucleophilic
substitution followed by the reduction of nitro compounds 2a-2e, as described in Scheme 1.
Amines 5a and 5b were synthesized in one-step by aromatic nucleophilic substitution reaction
in good yields. For the synthesis of isoindolinone derivatives 9-11 and 14, 3-bromo-2-
methylbenzoic acid was esterified to 6 and then brominated to furnish benzyl bromo-compound
7, as shown in Scheme 2. The thermal condensation of bromo-compound 7 with amines in the
presence of Hünig’s base (DIPEA) furnished isoindolinone 8. Suzuki coupling of 8 with
required boronic acid yielded final compounds 9–11. Compound 14 was synthesized from ester
compound 6 through a series of Suzuki coupling reactions followed by bromination and
condensation reactions.
<Scheme 1>
<Scheme 2>
As shown in Scheme 3, the thermal condensation of amine, trimethyl orthoformate, and
substituted anthranilic acid provided the required quinazolinone 16-20. Our effort to introduce a
substituent through Suzuki coupling at the quinazolinone ring was futile. 7-Bromoisatin 21 was
subjected to the Suzuki coupling conditions to give the intermediates 22a–22h (Scheme 4) [22,
4

ACCEPTED MANUSCRIPT
23]. Substituted 7-bromoisatin compounds were then converted to the corresponding substituted
anthranilic acids 23a–23h by an oxidative ring-opening reaction. Final compounds 24–40 were
prepared through a similar thermal condensation reaction of substituted anthranilic acid, amine,
and trimethyl orthoformate.
<Scheme 3>
<Scheme 4>
2.2. Biological activity
The in vitro activity of synthetic isoindolinone (9–11 and 14) and quinazolinone (16–20 and
24-40) derivatives was evaluated by using an 8xGli-luciferase (Gli-Luc) reporter assay in
NIH3T3 cells carrying a stably transfected eight tandem repeats of Gli-binding sites reporter
construct and the IC50 values are listed in Table 1 and 2. Cell viability was measured by the
sulforhodamine B assay, which showed that most of the compounds had no significant
cytotoxicity at concentrations at which they effectively inhibited Gli activation (> 20 µM).
Sonidegib was used as a positive control.
We examined the inhibitory activity of the first structure-hopping designed series of
isoindolinone compounds. Most of the isoindolinone derivatives (9–11 and 14) showed
moderate potencies in the micromolar range of IC50 values. Among them, the 4-
trifluoromethoxyphenyl (9) and 2,4-difuluorophenyl (11) substituted isoindolinone with
dimethyl morpholinopyridine at Region A (Fig. 2) exhibited a potency similar to the IC50 value
of 1.70 µM. The 3-pyridine substitution at the same position (10) reduced the potency (IC50 =
7.69 µM), while replacement of the linker between isoindolinone and the morpholine ring by
the pyrimidine ring (14) instead of pyridine slightly increased the potency with an IC50 value of
1.14 µM.
<Table 1>
Since the biological activities of isoindolinones are not very promising, we evaluated another
structure-hopping compound, quinazolinone. The structure activity relationship (SAR) study of
quinazolinone derivatives started with simple 8-chloro-3-(4-fluorophenyl)quinazolin-4(3H)-one
(16), exhibiting an IC50 value of 0.269 µM. The introduction of morpholine in the phenyl ring
instead of fluorine resulted in a complete loss of activity (> 20). On the other hand, the
introduction of morpholino-pyridine (18), dimethyl morpholino-pyridine (19), and dimethyl
morpholino-pyrimidine (20) resulted in a substantial loss of activity. Quinazolinone derivative
5

ACCEPTED MANUSCRIPT
24 that has substitution at the Region B with the phenyl group and the morpholinophenyl group
at Region A increased the biological activity about two-fold compared to 16 (IC50 = 0.269 and
0.132 µM respectively), but 3-methoxyphenyl and 4-trifluoromethoxyphenyl substitution at
Region B could not improve the activity (25 and 26, IC50 = 0.433 and 4.52 µM, respectively).
The combination of 4- trifluoromethoxyphenyl at Region B and the morpholinopyridine group
at Region A (27) also had the same problem with minimal biological activity where substitution
with phenyl at the Region B and the dimethyl morpholinopyridine group at Region A (28)
enhanced the inhibitory activity with an IC50 value of 0.038 µM. The biological activity of the
structurally hopped compound 29 (IC50 = 0.159 µM), which has the same substituents as
sonidegib, showed good potency comparable with that of compound 24. Next, we fixed Region
A and changed the substituents at the quinazolinone ring (Region B) to find a suitable
substituent. Among those compounds, all of them maintained the biological activity in the
submicromolar range, and 4-fluorophenyl at the Region B (34) exhibited better Hh inhibition
activity than the other analogs (30–33) with an IC50 value of 0.118 µM. More analogs with
different substitution pattern (35-40) were evaluated as shown in Table 2. Isomeric dimethyl
morpholino-pyridine at Region A of the molecule showed comparable activity (29 and 35, IC50
= 0.159 and 0.196 µM, respectively), but the replacement of dimethylmorpholine with 4-
methylpiperidine diminished the potency (36, IC50 = 0.847 µM). Replacement of the pyridine
linker between dimethylmorpholine and the quinazolinone ring with pyrimidine (37 and 38) led
to a dramatic loss of activity. The aliphatic linker between morpholine or imidazole and the
quinazolinone ring was undesirable (39 and 40).
<Table 2>
Among the newly synthesized structure-hopping compounds, isoidolinones derivatives showed
moderated Hh signaling inhibitory activities where as quinazolinone derivatives significantly
inhibited the pathway with IC50 value up to nano mole. Quinazolinone derivatives 28 and 34
exhibited 0.038 µM and 0.118 µM IC50 values respectively. Moreover, we further examined the
inhibitory effect of quinazolinone derivatives 28 and 34 on Hh pathway activity in Patched
(Ptch) mutant mouse fibroblast cell lines, Ptch-/- MEFs which are constitutively activated by
removing Hh pathway repressor without Hh ligand treatment. They suppress the Hh pathway
activation by downregulating Gli1 gene expression as shown in Figure 3. These results indicate
that quinazolinone derivatives 28 and 34 specifically act on Hh pathway at the level of Ptch
6

ACCEPTED MANUSCRIPT
downstream.
<Figure 3>
In the drug discovery process, the metabolic stability of the lead compound is one of the
important pharmacokinetic properties. Drug metabolism is generally a process of conversion of
a lipophilic compound to more hydrophilic metabolites that are excreted more easily than the
parent compound. It plays a critical role in determinants of its pharmacokinetic disposition.
Therefore, the assessment of metabolic properties of a lead compound is one of the most
important steps during drug discovery process. Typically, liver microsomes were used to
evaluate the metabolic instability resulting from phase I oxidation and Phase II glucuronidation.
In this study, the metabolic stability of the representative analogs 28 and 34 were evaluated in
human liver microsomes, as described in Table 3. The results show that the metabolic stability
of the analogs 28 and 34 are comparable to that of the reference compound, sonidegib in both
Phase I and Phase II metabolism. Interestingly, the cyclization of sonidegib from its amide
linkage to quinazolinone compounds did not affect the metabolic stability significantly to that of
the parent compound, which merit further development of 28 as a new lead.
<Table 3>
The primary cilia have been implicated as a nexus for various intracellular signaling pathways,
such as Hh, Wnt, and PDGF. Among them, Hh is the most closely related to the primary cilia to
transduce extracellular signaling into the nucleus. To dissect the mechanistic basis of the
representative compounds 28 and 34 as Hh signaling pathway inhibitors, we examined their
effect on Smo ciliary translocation. We established the NIH3T3 cell lines that stably express
heterologous Smo-EGFP, as shown in Fig. 4A. The treatment of Hh-conditioned media
increased Smo-EGFP protein localization in the primary cilia up to ~ 80% (Fig. 4B). The
quinazolinone compounds (28 and 34) significantly blocked Hh-induced Smo-EGFP ciliary
translocation, similar to vismodegib and sonidegib, which have been known to block Hh
signaling at the step of Smo activation (Fig. 4A). Disrupting Smo translocation into the cilia
subsequently prevented the accumulation of Gli transcription factor into the cilia to be
processed for activation. Consistently, the treatment of compounds 28 and 34 with Hh-
conditioned media completely blocked Gli2 accumulation at the tip of the primary cilia where
the crucial step of the conversion of Gli2 from inactive into active form occurs (Fig. 4C). These
results indicate that the quinazolinone derivatives suppress Hh signaling through blocking Smo
7

ACCEPTED MANUSCRIPT
and Gli translocation into the cilia, similar to vismodegib and sonidegib.
<Figure 4>
It has been reported that drug-resistant mutation in human Smo (SmoD473H) significantly abolish
the Hh pathway inhibitory effects of vismodegib. To further examine the potency of
quinazolinone compounds on drug-resistant Smo mutations, we overexpressed wild-type or
mutant versions of Smo by substituting the Smo 477th amino acid residue of Asp into His
(SmoD477H), which is comparable to the murine Smo mutation, as shown in MB patients
(SmoD473H). We then evaluated the Hh signaling activity by measuring Gli1 mRNA expression
levels using quantitative real-time RT-PCR. Consistent with the previous reports, vismodegib
effectively inhibited the Hh signaling in wild-type Smo-overexpressing NIH3T3 cells, but
mutant Smo was refractory to vismodegib. Moreover, the drug-resistant form of Smo mitigated
the Hh pathway inhibitory activity of sonidegib but to a lesser extent than vismodegib (Fig. 5
and Table 4). Intriguingly, the Hh inhibitory effects of quinazolinone compounds 28 and 34
were retained or slightly decreased in mutant Smo, respectively as shown in Fig. 5 and Table 4.
The relative loss of activity toward the mutant Smo was minimal in quinazolinone compounds
compared to vismodegib and sonidegib.
<Figure 5>
<Table 4>
3. Conclusion
We developed novel series of isoindolinone and quinazolinone derivatives that were designed
using the structure-hopping approach. The newly synthesized analogs were evaluated as
potential Hh pathway inhibitors and among which, several isoindolinone derivatives exhibited
moderate Hh inhibitory activity. Of note, some of the quinazolinone compounds showed a
submicromolar range of IC50 values, and compounds 24, 29, 32, 34, and 35 were the better
among them. Compound 28 with phenyl at the Region B and the dimethyl morpholinopyridine
group at Region A was the most potent among the quinazolinone derivatives with nanomolar-
range IC50 values. The novel scaffold effectively suppressed Gli transcription binding activity in
Gli-Luc reporter cells and the Ptch1-/- mouse embryonic fibroblast cell line. The molecular basis
of its inhibition is attributed to the blocking of Smo and Gli2 localization into the primary cilia,
which leads to downregulation of Hh target genes expression. Moreover, the mechanism study
8

ACCEPTED MANUSCRIPT
of sonidegib and its new quinazolinone analogs indicated that the open amide linkage of
sonidegib is an important moiety for determining the binding affinity into the vismodegib-
resistant D477H-mutated form of Smo. The quinazolinone moiety with cyclic amide
significantly retained the potency of Hh pathway inhibition in D477H mutant as well as wild-
type Smo-overexpressing cells. Further studies of the X-ray structure of Smo with
quinazolinone derivatives may provide insights into the molecular basis of drug resistance in
Hh-related cancer. The novel quinazolinone scaffold may provide a platform in the development
of improved Hh pathway inhibitors to overcome drug resistance in cancer.
4. Experimental
General: All chemical reagents were commercially available. Melting points were determined
on an “Electrothermal Thermo Scientific IA9200” apparatus and were uncorrected. Silica gel
column chromatography was performed on silica gel 60, 230–400 mesh, Merck. Proton NMR
spectra were recorded on a Varian at 400 MHz. Chemical shifts were reported in ppm units with
Me4Si as a reference standard. Mass spectra were recorded on a Waters Xevo G2 Q-TOF
(Waters Corp., Milford, USA). The purity of the products was checked by reversed-phase high-
pressure liquid chromatography (RP-HPLC), which was performed either on a Dionex Corp.
HPLC system or on a Waters Corp. HPLC system equipped with a UV detector set at 254 nm.
The mobile phases used were A: H2O containing 0.05% TFA and B: CH3CN. The HPLC
employed a YMC Hydrosphere C18 (HS-302) column (5 µ particle size, 12 nM pore size), 4.6
mm dia. x 150 mm with a flow rate of 1.0 mL/min. Compound purity was assessed using the
following method: CH3CN / 0.05% TFA – H2O from 25:75 to 100:0 over 40 minutes, then 100:0
over 10 minutes.
Synthesis
General procedure for synthesis of compounds 2a–2e
To the solution of halo-nitrobenzene (1 equiv) in DMF, potassium carbonate (2 equiv) and
amine (1 equiv) were added at room temperature, and the reaction mixture was stirred at 70°C
overnight. Ethyl acetate was added to the reaction mixture, and the organic layer was washed
with water. It was dried over magnesium sulfate, filtered, concentrated, and purified through
flash column chromatography.
9

ACCEPTED MANUSCRIPT
2a) 4-(4-Nitrophenyl)morpholine
Yellow solid (yield 93%); 1H-NMR (400Mz, CDCl3) δ 8.15 (dd, J = 3.6, 13.2 Hz, 2H), 6.84 (dd,
J = 3.4, 12.6 Hz, 2H), 3.87 (d, J = 4.8 Hz, 3H), 3.38 (d, J = 5.0 Hz, 3H).
2b) 4-(5-Nitropyridin-2-yl)morpholine
Yellow solid (68%); 1H-NMR (400Mz, CDCl3) δ 9.05 (d, J = 2.8 Hz, 1H), 8.23 (dd, J = 3.0, 9.8
Hz, 1H), 6.57 (d, J = 9.2 Hz, 2H), 3.83–3.80 (m, 4H), 3.76–3.73 (m, 4H).
2c) (2S,6R)-2,6-Dimethyl-4-(5-nitropyridin-2-yl)morpholine
1
Yellow solid (yield 90%); H-NMR (400Mz, CDCl3) δ 9.04 (d, J = 2.8 Hz, 1H), 8.22 (dd, J =
2.8, 9.2 Hz, 1H), 6.56 (d, J = 9.2 Hz, 1H), 4.31–4.28 (m, 2H), 3.83–2.49 (m, 2H), 2.74–2.68 (m,
2H), 1.29 (d, J = 6.4 Hz, 6H).
2d) 2-(4-Methylpiperidin-1-yl)-5-nitropyridine
Yellow solid (81%); 1H-NMR (400Mz, CDCl3) δ 9.03 (d, J = 2.8 Hz, 1H), 8.17 (dd, J = 2.8, 9.2
Hz, 1H), 6.56 (d, J = 9.2 Hz, 2H), 4.51–4.48 (m, 2H), 3.03–2.96 (m, 2H), 1.80–1.70 (m, 3H),
1.25–1.15 (m, 2H), 0.99 (d, J = 6.0 Hz, 3H).
2e) (2S,6R)-2,6-Dimethyl-4-(6-nitropyridin-3-yl)morpholine
1
Yellow solid (31%). H-NMR (400Mz, CDCl3) δ 8.18 (d, J = 8.8 Hz, 1H), 8.13 (d, J = 2.8 Hz,
1H), 7.21 (dd, J = 3.0, 9.8 Hz, 1H), 3.81–3.76 (m, 2H), 3.68–3.64 (m, 2H), 2.76–2.64 (m, 2H),
1.25 (d, J = 2.4 Hz, 6H).
General procedure for the synthesis of compounds 3a–3e
Nitro-compound (2a–2e) was dissolved in methanol and stirred at room temperature with
palladium/charcoal (5 mol%) in a hydrogen gas environment for 2 h. The resulting solution was
filtered through celite, concentrated, and used in the next step without further purification.
General procedure for the synthesis of compounds 5a and 5b
Cyclic amine (2 equiv) and 4-amino-6-chloropyrimidine (1 equiv) were taken in a round-bottom
flask and dissolved in toluene. The reaction mixture was refluxed overnight. The reaction mass
was cooled down to room temperature, the solvent was evaporated under reduced pressure, and
the residue was purified through flash column chromatography to yield pure product.
5a) 6-(4-Methylpiperidin-1-yl)pyrimidin-4-amine
White solid (64%). 1H-NMR (400Mz, CDCl3) δ 8.17 (s, 1H), 5.58 (s, 1H), 4.44 (br s, 2H), 4.26
(d, J = 13.6 Hz, 2H), 2.84–2.77 (m, 2H), 1.71–1.63 (m, 2H), 1.20–1.10 (m, 2H), 0.96 (d, J = 6.8
Hz, 3H).
10

ACCEPTED MANUSCRIPT
5b) 6-((2S,6R)-2,6-Dimethylmorpholino)pyrimidin-4-amine
White solid (74%). 1H-NMR (400Mz, CDCl3) δ 8.19 (s, 1H), 5.56 (s, 1H), 4.53 (br s, 2H), 4.05
(d, J = 12.4 Hz, 2H), 3.67–3.62 (m, 2H), 2.56–2.50 (m, 2H), 1.25 (d, J = 6.4 Hz, 6H).
6) Ethyl 3-bromo-2-methylbenzoate
A mixture of 3-bromo-2-methylbenzoic acid (2 g, 9.3 mmol), concentrated sulfuric acid (0.2
mL), and ethanol (3 mL) in benzene (10 mL) was refluxed as an azeotropic solution for 18 h.
The reaction mixture was cooled down to room temperature and washed with saturated sodium
bicarbonate solution and water. The organic phase was collected, dried, and concentrated. The
crude product was purified through flash column chromatography (Hex:EA 5:1) to yield 1.99 g
(88%) pure compound as colorless liquid. 1H-NMR (400Mz, CDCl3) δ 7.72–7.66 (s, 2H), 7.09 (t,
J = 7.8 Hz, 1H), 4.39–4.33 (m, 2H), 2.62 (s, 3H), 1.39 (t, J = 7.0 Hz, 3H).
7) Ethyl 3-bromo-2-(bromomethyl)benzoate
NBS (1.75 g, 9.82 mmol) and AIBN (0.14 g, 0.81 mmol) were added to the solution of ethyl 3-
bromo-2-methylbenzoate (1.99 g, 8.18 mmol) in benzene. The reaction solution was refluxed
for 5 h. The solution was cooled down to room temperature, and the precipitate was filtered. The
filtrate was washed with a saturated solution of Na2S2O3 and water. The organic layer was dried,
concentrated, and purified through flash column chromatography (Hex:EA, 5:1) to yield pure
compound as colorless oil (2.54 g, 96%). 1H-NMR (400Mz, CDCl3) δ 7.87 (d, J = 8.0 Hz, 1H),
7.75 (d, J = 7.6 Hz, 1H), 7.25–7.20 (m, 1H), 5.12 (s, 2H), 4.44–4.39 (m, 2H), 1.42 (t, J = 7.0 Hz,
3H).
8) 4-Bromo-2-(6-((2S,6R)-2,6-dimethylmorpholino)pyridin-3-yl)isoindolin-1-one
A mixture of ethyl 3-bromo-2-(bromomethyl)benzoate (0.5 g, 1.55 mmol), 6-((2S,6R)-2,6-
dimethylmorpholino)pyridin-3-amine (0.39 g, 1.89 mmol), and DIPEA (0.18 mL, 1.89 mmol)
was taken in a sealed tube with ethanol. The reaction mixture was heated at 100°C overnight.
The reaction solution was cooled down to room temperature, the ethanol was removed under
reduced pressure, and the residue was dissolved in ethyl acetate and washed with saturated
sodium bicarbonate solution. The combined organic layer was dried, filtered, and concentrated.
The crude product was purified through flash column chromatography (MC:EA:Hex 1:1:2) to
yield pure product as cream white solid (0.48 g, 77%). 1H-NMR (400Mz, CDCl3) δ 8.47 (d, J =
2.4 Hz, 1H), 8.13 (dd, J = 2.8, 9.2 Hz, 1H), 7.87 (d, J = 7.6 Hz, 1H), 7.72 (dd, J = 0.8, 7.6 Hz,
1H), 7.42 (d, J = 7.8 Hz, 1H), 6.72 (d, J = 9.6 Hz, 1H), 4.72 (s, 2H), 4.05–3.99 (m, 2H), 3.77–
11

ACCEPTED MANUSCRIPT
3.72 (m, 2H), 2.58–2.52 (m, 2H), 1.29 (d, J = 6.4 Hz, 6H).
General procedure for the synthesis of compounds 9–11
A mixture of 4-bromo-2-(6-((2S,6R)-2,6-dimethylmorpholino)pyridin-3-yl)isoindolin-1-
one (8), aryl boronic acid (1.5 equiv), and 2M aqueous solution of sodium carbonate
was taken in a sealed tube together with DME. The solution was bubbled in argon for 15
min, and a palladium catalyst (15 mg, 5 mol%) was added. The reaction solution was further
bubbled for 5 min in argon, and the sealed tube was heated at 130°C overnight. The reaction
solution was cooled down to room temperature, the solvent was removed under reduced
pressure, and the residue was dissolved in ethyl acetate and washed with water. The combined
organic layer was dried, filtered, and concentrated. The crude product was purified through flash
column chromatography to yield pure product.
9)
2-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-4-(4-(trifluoromethoxy)phenyl)
isoindolin-1-one
1
Cream white solid (93%); mp 191.4–192.6°C; H-NMR (400Mz, CDCl3) δ 8.44 (d, J = 2.4 Hz,
1H), 8.10 (dd, J = 3.0, 9.4 Hz, 1H), 7.91 (dd, J = 2.2, 6.6 Hz, 1H), 7.61–7.56 (m, 2H), 7.53–7.51
(m, 2H), 7.36(d, J = 8.4 Hz, 2H), 6.67 (d, J = 9.2 Hz, 1H), 4.81 (s, 2H), 4.03–3.99 (m, 2H),
3.74–3.69 (m, 2H), 2.54–2.48 (m, 2H), 1.27 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz)
δ 167.08, 156.55, 149.06, 139.73, 137.81, 137.14, 135.77, 133.51, 132.06, 130.68,
129.53, 129.22, 127.00, 123.36, 121.46, 106.89, 71.52, 51.00, 50.65, 18.98; HRMS (EI)
m/z calcd for C26H25F3N3O3 [M+] 484.1848, found: 484.1883.
10) 2-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-4-(pyridin-3-yl)isoindolin-
1-one
1
Cream white solid (92%); mp 219.9–203.0°C; H-NMR (400Mz, CDCl3) δ 8.79 (d, J = 1.6 Hz,
1H), 8.69 (dd, J = 1.6, 4.8 Hz, 1H), 8.45 (d, J = 2.4 Hz, 1H), 8.08 (dd, J = 4.8, 7.2 Hz, 1H), 7.96
(dd, J = 1.6, 7.2 Hz, 1H), 7.84–7.81 (m, 1H), 7.66–7.51 (m, 2H), 7.47–7.44 (m, 1H), 6.69 (d, J =
9.2 Hz, 1H), 4.85 (s, 2H), 4.04–4.00 (m, 2H), 3.75–3.70 (m, 2H), 2.55–2.49 (m, 2H), 1.27 (d, J
= 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz) δ 166.95, 156.60, 149.41, 148.86, 139.84,
138.10, 135.40, 134.25, 133.69, 133.57, 132.17, 130.76, 129.42, 126.88, 123.83, 123.80,
106.91, 71.53, 50.99, 50.61, 18.99; HRMS (EI) m/z calcd for C24H25N4O2 [M+] 401.1978,
found: 401.2008.
12

ACCEPTED MANUSCRIPT
11) 4-(2,4-Difluorophenyl)-2-(6-((2S,6R)-2,6-dimethylmorpholino)pyridin-3-yl)isoindolin-
1-one
1
Cream white solid (75%); mp 176.0–177.2°C; H-NMR (400Mz, CDCl3) δ 8.42 (d, J = 2.8 Hz,
1H), 8.12 (dd, J = 3.0, 9.0 Hz, 1H), 7.95 (dd, J = 1.0, 7.4 Hz, 1H), 7.60 (d, J = 7.6 Hz, 1H),
7.53(d, J = 6.8 Hz, 1H), 7.40–7.34 (m, 1H), 7.05–6.96 (m, 2H), 6.68 (d, J = 9.6 Hz, 1H), 4.71 (s,
2H), 4.03–4.00 (m, 2H), 3.75–3.70 (m, 2H), 2.55–2.49 (m, 2H), 1.27 (d, J = 6.4 Hz, 6H). 13C
NMR (CDCl3, 100 MHz) δ 167.07, 156.55, 139.72, 139.25, 133.27, 133.18, 131.95,
131.90, 131.85, 131.80, 130.73, 130.48, 128.91, 127.10, 123.79, 112.20, 112.16, 111.99,
111.95, 106.92, 104.85, 104.58, 104.33, 71.53, 51.03, 50.54, 50.47, 18.99; HRMS (EI)
m/z calcd for C25H24F2N3O2 [M+] 436.1837, found: 436.1849.
12) Ethyl 2-methyl-4'-(trifluoromethoxy)biphenyl-3-carboxylate
The compound was prepared from ethyl 3-bromo-2-methylbenzoate (6) using the same
general procedure that was used for the synthesis of compounds 9–11.
1
Colorless oil (86%). H-NMR (400Mz, CDCl3) δ 7.81 (dd, J = 1.8, 7.4 Hz, 1H), 7.33–7.25 (m,
6H), 4.39 (q, J = 7.2 Hz, 2H), 2.39(s, 3H), 1.31 (t, J = 7.0 Hz, 3H).
13) Ethyl 2-(bromomethyl)-4'-(trifluoromethoxy)biphenyl-3-carboxylate
The compound was prepared from ethyl 2-methyl-4'-(trifluoromethoxy)biphenyl-3-carboxylate
(12) using the same general procedure that was used for the synthesis of compound 7.
1
Colorless viscous oil (97%). H-NMR (400Mz, CDCl3) δ 7.93 (dd, J = 1.8, 8.2 Hz, 1H), 7.47–
7.29 (m, 6H), 4.84 (s, 2H), 4.44 (q, J = 7.2 Hz, 2H), 1.44 (t, J = 7.2 Hz, 3H).
14) 2-(6-((2S,6R)-2,6-Dimethylmorpholino)pyrimidin-4-yl)-4-(4-(trifluoromethoxy)phenyl)
isoindolin-1-one
The compound was prepared from ethyl 2-(bromomethyl)-4'-(trifluoromethoxy)biphenyl-3-
carboxylate (13) using the same general procedure that was used for the synthesis of
compound 8.
White solid (15%); mp 249.0–250.1°C; 1H-NMR (400Mz, CDCl3) δ 8.43 (s, 1H), 7.94–7.92 (m,
2H), 7.64–7.60 (m, 2H), 7.55–7.51 (m, 2H), 7.36 (d, J = 8.0 Hz, 2H), 5.10 (s, 2H), 4.24 (br s,
13
2H), 3.71–3.63 (m, 2H), 2.67–2.61 (m, 2H), 1.28 (d, J = 6.4 Hz, 6H). C NMR (CDCl3, 100
MHz) δ 168.48, 162.91, 157.43, 157.14, 138.66, 136.90, 136.41, 133.24, 133.21, 129.62,
129.24, 123.54, 121.55, 90.07, 76.69, 71.54, 49.48, 49.40, 18.87. ; HRMS (EI) m/z calcd
for C25H24F3N4O3 [M+] 485.1801, found: 485.1837.
13

ACCEPTED MANUSCRIPT
General procedure for the synthesis of compounds 16–20
3-Chloroanthranilic acid was taken in a sealed tube together with trimethyl orthoformate (1.2
equiv), aromatic amine (1.2 equiv), and THF, and the resulting reaction mixture was heated at
110°C for 18 h. It was cooled down to room temperature, saturated sodium bicarbonate solution
was added, and the crude product was extracted with ethyl acetate. The combined organic layer
was dried with magnesium sulfate, filtered, concentrated under reduced pressure, and purified
through flash column chromatography.
16) 8-Chloro-3-(4-fluorophenyl)quinazolin-4(3H)-one
1
White solid (22%); mp 232.5–233.2°C; H-NMR (400Mz, CDCl3) δ 8.29 (d, J = 8.4 Hz, 1H),
8.20 (s, 1H), 7.90 (d, J = 7.6 Hz, 1H), 7.49 (t, J = 7.8 Hz, 1H), 7.42–7.39 (m, 2H), 7.28–7.23 (m,
2H). 13C NMR (CDCl3, 100 MHz) δ 164.02, 161.54, 160.22, 146.51, 144.56, 135.04,
133.02, 132.98, 132.06, 128.87, 128.78, 127.94, 126.06, 123.89, 116.99, 116.75; HRMS
(EI) m/z calcd for C14H9ClFN2O [M+] 275.0387, found: 275.0382.
17) 8-Chloro-3-(4-morpholinophenyl)quinazolin-4(3H)-one
1
White solid (33%); mp 275.0–275.8°C; H-NMR (400Mz, CDCl3) δ 8.28 (dd, J = 1.4, 8.2 Hz,
1H), 8.22 (s, 1H), 7.88 (dd, J = 1.4, 7.8 Hz, 1H), 7.46 (t, J = 7.8 Hz, 1H), 7.30 (d, J = 12.0 Hz,
2H), 7.03 (d, J = 12.0 Hz, 2H), 3.89 (t, J = 4.8 Hz, 3H), 3.25 (t, J = 5.0 Hz, 3H); HRMS (EI)
m/z calcd for C18H17ClN3O2 [M+] 342.1009, found: 342.0997.
18) 8-Chloro-3-(6-morpholinopyridin-3-yl)quinazolin-4(3H)-one
1
White solid (14%); mp 264.9–266.2°C; H-NMR (400Mz, CDCl3) δ 8.28 (d, J = 8.0 Hz, 1H),
8.19 (s, 2H), 7.89 (d, J = 7.2 Hz, 1H), 7.59 (dd, J = 2.8, 9.2 Hz, 1H), 7.48 (t, J = 7.8 Hz, 1H),
13
6.76 (d, J = 9.2 Hz, 2H), 3.84 (t, J = 4.8 Hz, 4H), 3.61 (t, J = 5.0 Hz, 4H). C NMR (CDCl3,
100 MHz) δ 160.51, 159.14, 146.75, 145.37, 144.66, 136.17, 134.94, 132.01, 127.82,
126.04, 124.19, 123.85, 106.59, 66.63, 45.33); HRMS (EI) m/z calcd for C17H16ClN4O2
[M+] 343.0962, found: 343.0984.
19) 8-Chloro-3-(6-((2S,6R)-2,6-dimethylmorpholino)pyridin-3-yl)quinazolin-4(3H)-
one
1
White solid (30%); mp 200.0–200.8°C; H-NMR (400Mz, CDCl3) δ 8.26 (dd, J = 1.4, 7.8 Hz,
1H), 8.18 (s, 1H), 8.17 (d, J = 2.8 Hz, 1H), 7.88 (dd, J = 1.6, 8.0 Hz, 1H), 7.58 (dd, J = 2.6, 9.0
Hz, 1H), 7.46 (t, J = 7.8 Hz, 1H), 6.75 (d, J = 9.2 Hz, 1H), 4.15–4.11 (m, 2H), 3.74–3.70 (m,
2H), 2.65–2.59 (m, 2H), 1.29 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz) δ 160.47,
14

ACCEPTED MANUSCRIPT
158.71, 146.76, 145.29, 144.61, 136.13, 134.89, 131.96, 127.76, 125.99, 123.86, 123.80,
106.61, 71.52, 50.45, 18.94; HRMS (EI) m/z calcd for C19H20ClN4O2 [M+] 371.1275, found:
371.1284.
20) 8-Chloro-3-(6-((2S,6R)-2,6-dimethylmorpholino)pyrimidin-4-yl)quinazolin-4(3H)-one
1
White solid (5%); mp 212.8–214.1°C; H-NMR (400Mz, CDCl3) δ 8.91 (s, 1H), 8.61 (s, 1H),
8.28 (dd, J = 1.4, 8.2 Hz, 1H), 7.89 (dd, J = 1.2, 7.6 Hz, 1H), 7.48 (t, J = 7.8 Hz, 1H), 7.25 (s,
1H), 4.25–4.11 (m, 2H), 3.72–3.64 (m, 2H), 2.69 (t, J = 11.6 Hz, 2H), 1.28 (d, J = 6.0 Hz, 6H).
13C NMR (CDCl3, 100 MHz) δ 162.61, 159.96, 158.36, 155.53, 144.64, 143.98, 135.33,
132.24, 127.89, 126.04, 123.63, 97.99, 71.46, 49.45, 18.81; HRMS (EI) m/z calcd for
C18H19ClN5O2 [M+] 372.1227, found: 372.1247.
General procedure for the synthesis of compounds 22a–22h
To the solution of 7-bromoisatin in DME and water, sodium bicarbonate (2 equiv) and boronic
acid (1.1 equiv) were added. The reaction mixture was degassed with argon for 30 min, and then
Pd(PPh3)4 (5 mol%) was added and the solution was refluxed for 3 h. The reaction solution was
cooled down to room temperature, and the organic solvent was removed under reduced pressure.
The aqueous layer was extracted with methylene chloride, and the combined organic layer was
dried under magnesium sulfate, filtered, and concentrated. The crude product was purified
through flash column chromatography (MC:MeOH 50:1).
22a) 7-Phenylindoline-2,3-dione
1
Red solid (60%). H-NMR (400Mz, CDCl3) δ 7.76 (br s, 1H), 7.63 (dd, J = 0.8, 7.2 Hz, 1H),
7.58–7.51 (m, 3H), 7.48–7.46 (m, 1H), 7.44–7.40 (m, 2H), 7.21 (t, J = 7.6 Hz, 1H).
22b) 7-(3-Methoxyphenyl)indoline-2,3-dione
Red solid (52%). 1H-NMR (400Mz, CDCl3) δ 7.79 (br s, 1H), 7.63 (d, J = 7.2 Hz, 1H), 7.58 (d,
J = 7.6 Hz, 1H), 7.52 (t, J = 7.8 Hz, 1H), 7.20 (t, J = 7.6 Hz, 1H), 7.00–6.91 (m, 3H), 3.87 (s,
3H).
22c) 7-(4-(Trifluoromethoxy)phenyl)indoline-2,3-dione
Brown solid (52%). 1H-NMR (400Mz, CDCl3) δ 7.86 (br s, 1H), 7.65 (d, J = 7.6 Hz, 1H), 7.56
(d, J = 8.0 Hz, 1H), 7.47 (d, J = 8.8 Hz, 2H), 7.39 (d, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H).
22d) 7-(Naphthalen-1-yl)indoline-2,3-dione
Orange solid (56%). 1H-NMR (400Mz, CDCl3) δ 7.99 (d, J = 9.9 Hz, 2H), 7.73 (d, J = 7.6 Hz,
1H), 7.65–7.53 (m, 5H), 7.45 (d, J = 6.4 Hz, 2H), 7.29 (t, J = 7.6 Hz, 1H), 7.16 (br s, 1H).
15

ACCEPTED MANUSCRIPT
22e) 7-p-Tolylindoline-2,3-dione
Red solid (43%). 1H-NMR (400Mz, CDCl3) δ 7.72 (br s, 1H), 7.61 (d, J = 7.6 Hz, 1H), 7.56 (d,
J = 8.2 Hz, 1H), 7.35–7.28 (m, 4H), 7.20 (t, J = 7.6 Hz, 1H), 2.43 (s, 3H).
22f) 7-(4-Methoxyphenyl)indoline-2,3-dione
Brown solid (47%). 1H-NMR (400Mz, CDCl3) δ 7.72 (br s, 1H), 7.61–7.58 (m, 1H), 7.55–7.52
(m, 1H), 7.35–7.31 (m, 2H), 7.18 (t, J = 7.8 Hz, 1H), 7.08–7.03 (m, 2H), 3.89 (s, 3H).
22g) 7-(4-(Methylsulfonyl)phenyl)indoline-2,3-dione
1
Orange solid (44%). H-NMR (400Mz, CDCl3) δ 7.91 (dd, J = 1.8, 8.2 Hz, 1H), 7.34 (m, 2H),
7.23 (dd, J = 1.6, 7.6 Hz, 1H), 7.01–6.99 (m, 2H), 6.70 (t, J = 7.8 Hz, 1H), 3.49 (s, 3H).
22h) 7-(4-Fluorophenyl)indoline-2,3-dione
Reddish solid (43%). 1H-NMR (400Mz, CDCl3) δ 7.64 (d, J = 8.0 Hz, 1H), 7.54 (dd, J = 1.0, 7.8
Hz, 1H), 7.41–7.37 (m, 2H), 7.25–7.19 (m, 3H).
General procedure for the synthesis of compounds 24–40
Arylisatin (1 mmol) was dissolved in 5% NaOH (5 mL), and hydrogen peroxide (30% aqueous
solution) (5 mL) was added drop-wise with stirring at room temperature. After stirring for 30
min at 50 °C, the solution was cooled to room temperature and acidified up to pH 2 with a 2N
HCl solution. The resulting white precipitate was collected and used directly in the next step.
The prepared acid was taken in a sealed tube together with trimethyl orthoformate (1.2 mmol),
aromatic amine (1.2 mmol), and THF, and the resulting reaction mixture was heated at 110 °C
for 18 h. It was cooled down to room temperature, saturated sodium bicarbonate solution was
added, and the crude product was extracted with ethyl acetate. The combined organic layer was
dried with magnesium sulfate, filtered, concentrated under reduced pressure, and purified
through flash column chromatography (MC: MeOH 40:1).
24) 3-(4-Morpholinophenyl)-8-phenylquinazolin-4(3H)-one
1
White solid (12%); mp 143.9–144.5°C; H-NMR (400Mz, CDCl3) δ 8.40 (dd, J = 0.4, 9.6 Hz,
1H), 8.11 (s, 1H), 7.81 (dd, J = 1.6, 7.2 Hz, 1H), 7.62–7.57 (m, 3H), 7.49 (t, J = 7.6 Hz, 2H),
7.43–7.25 (m, 3H), 7.02 (d, J = 8.8 Hz, 2H), 3.88 (t, J = 5.0 Hz, 4H), 3.23 (t, J = 4.6 Hz, 4H).
13C NMR (CDCl3, 100 MHz) δ 161.26, 151.47, 145.87, 145.18, 139.73, 138.38, 135.40,
130.29, 129.04, 128.09, 127.65, 127.59, 127.23, 126.62, 122.97, 115.83, 66.75, 48.76;
HRMS (EI) m/z calcd for C24H22N3O2 [M+] 384.1712, found: 384.1681.
25) 8-(3-Methoxyphenyl)-3-(4-morpholinophenyl)quinazolin-4(3H)-one
16

ACCEPTED MANUSCRIPT
1
White solid (12%); mp 184.2–185.5°C; H-NMR (400Mz, CDCl3) δ 8.40 (dd, J = 1.4, 7.8 Hz,
1H), 8.11 (s, 1H), 7.80 (dd, J = 1.6, 7.2 Hz, 1H), 7.58 (t, J = 7.6 Hz, 1H), 7.40 (t, J = 8.0 Hz,
1H), 7.32–7.28 (m, 2H), 7.19–7.16 (m, 2H), 7.02 (d, J = 8.8 Hz, 2H), 6.96 (dd, J = 2.4, 8.4 Hz,
1H), 3.88 (t, J = 5.8 Hz, 4H), 3.86 (s, 3H), 3.24 (t, J = 4.8 Hz, 4H). 13C NMR (CDCl3, 100
MHz) δ 161.25, 159.22, 151.49, 145.91, 145.20, 139.75, 139.60, 135.35, 129.07, 129.04,
127.59, 127.18, 126.70, 122.96, 122.75, 116.16, 115.85, 113.11, 66.75, 55.30, 48.77;
HRMS (EI) m/z calcd for C25H24N3O3 [M+] 414.1818, found: 414.1789.
26) 3-(4-morpholinophenyl)-8-(4-(trifluoromethoxy)phenyl)quinazolin-4(3H)-one
1
White solid (7%); mp 164.8–166.0°C; H-NMR (400Mz, CDCl3) δ 8.43 (d, J = 8.4 Hz, 1H),
8.12 (s, 1H), 7.79 (d, J = 7.6 Hz, 1H), 7.66 (d, J = 8.4 Hz, 2H), 7.60 (t, J = 7.6 Hz, 1H), 7.32 (t,
J = 9.2 Hz, 4H), 7.02 (d, J = 8.4 Hz, 2H), 3.89 (t, J = 4.8 Hz, 4H), 3.24 (t, J = 4.8 Hz, 4H). 13C
NMR (CDCl3, 100 MHz) δ 161.13, 151.55, 148.81, 146.10, 145.09, 138.18, 136.94,
135.32, 131.73, 128.90, 127.56, 127.31, 127.11, 123.10, 120.52, 119.25, 115.85, 66.75,
48.74; HRMS (EI) m/z calcd for C25H21F3N3O3 [M+] 468.1535, found: 468.1510.
27)
3-(6-Morpholinopyridin-3-yl)-8-(4-(trifluoromethoxy)phenyl)quinazolin-4(3H)-one
1
White solid (19 mg, 12%); mp 135.7–137.1°C; H-NMR (400Mz, CDCl3) δ 8.42 (dd, J = 1.6,
8.0 Hz, 1H), 8.19 (d, J = 2.8 Hz, 1H), 8.08 (s, 1H), 7.81 (dd, J = 1.6, 7.2 Hz, 1H), 7.76–7.59 (m,
4H), 7.34 (dd, J = 1.0, 8.6 Hz, 2H), 6.76 (d, J = 8.8 Hz, 1H), 3.84 (t, J = 5.0 Hz, 4H), 3.60 (t, J =
4.8 Hz, 4H). 13C NMR (CDCl3, 100 MHz) δ 161.13, 159.06, 148.82, 145.61, 145.31,
145.08, 138.32, 136.81, 136.23, 135.52, 131.72, 127.49, 127.08, 124.50, 122.90, 120.54,
106.60, 66.64, 45.34; HRMS (EI) m/z calcd for C24H20F3N4O3 [M+] 469.1488, found: 468.
469.1497.
28) 3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-phenylquinazolin-4(3H)-one
White solid (21%); mp 95.4–96.1°C; 1H-NMR (400Mz, CDCl3) δ 8.39 (dd, J = 1.4, 7.8 Hz, 1H),
8.17 (d, J = 2.4 Hz, 2H), 8.07 (s, 1H), 7.82 (dd, J = 1.4, 7.4 Hz, 1H), 7.61–7.58 (m, 4H), 7.49 (t,
J = 7.4 Hz, 2H), 7.42 (t, J = 7.6 Hz, 1H), 6.74 (d, J = 8.8 Hz, 1H), 4.14–4.09 (m, 2H), 3.76–3.68
(m, 2H), 2.64–2.58 (m, 2H), 1.29 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz) δ
161.26, 158.62, 145.40, 145.25, 145.16, 139.84, 138.24, 136.25, 135.56, 130.25, 128.10,
127.70, 127.39, 126.56, 124.32, 122.76, 106.63, 71.53, 50.49, 18.95; HRMS (EI) m/z
calcd for C25H25N4O2 [M+] 413.1978, found: 413.1950.
17

ACCEPTED MANUSCRIPT
29)
3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-(4-(trifluoromethoxy)phenyl)
quinazolin-4(3H)-one
1
White solid (14%); mp 188.4–189.6°C; H-NMR (400Mz, CDCl3) δ 8.42 (dd, J = 1.6, 8.4 Hz,
1H), 8.17 (d, J = 2.0 Hz, 2H), 8.08 (s, 1H), 7.80 (dd, J = 1.6, 7.2 Hz, 1H), 7.66–7.58 (m, 4H),
7.32 (d, J = 8.0 Hz, 2H), 6.75 (d, J = 9.2 Hz, 1H), 4.14–4.11 (m, 2H), 3.75–3.70 (m, 2H),
2.65–2.59 (m, 2H), 1.29 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz) δ 161.15,
158.69, 148.83, 145.65, 145.27, 145.10, 138.32, 136.83, 136.23, 135.51, 131.73, 127.49,
127.08, 124.20, 122.92, 120.54, 106.66, 71.56, 50.50, 18.97; HRMS (EI) m/z calcd for
C26H24F3N4O3 [M+] 497.1801, found: 497.1776.
30) 3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-(naphthalen-1-yl)quinazolin-4
(3H)-one
1
White solid (16%); mp 122.5–123.7°C; H-NMR (400Mz, CDCl3) δ 8.48 (dd, J = 1.4, 8.2 Hz,
1H), 8.16 (d, J = 2.2 Hz, 1), 7.92–8.06 (m, 1H), 7.82 (dd, J = 1.2, 7.2 Hz, 1H), 7.68–7.58 (m,
3H), 7.52–7.43 (m, 3H), 7.39–7.35 (m, 1H), 6.72 (d, J = 8.2 Hz, 1H), 4.11–4.09 (m, 2H),
3.72–3.69 (m, 2H), 2.63–2.56 (m, 2H), 1.28 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100
MHz) δ 161.29, 158.61, 146.51, 145.70, 145.26, 138.87, 136.73, 136.57, 136.25, 133.49,
132.37, 128.38, 128.36, 127.68, 127.23, 127.01, 126.19, 126.05, 125.79, 125.23, 124.33,
122.53, 106.62, 71.54, 50.49, 18.95; HRMS (EI) m/z calcd for C29H27N4O2 [M+] 463.2134,
found: 463.2112.
31)
3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-p-tolylquinazolin-4(3H)-one
1
White solid (14%); mp 158.7–160.1°C; H-NMR (400Mz, CDCl3) δ 8.37 (dd, J = 1.4, 8.2 Hz,
1H), 8.17 (d, J = 2.8 Hz, 1H), 8.06 (s, 1H), 7.80 (dd, J = 1.4, 7.0 Hz, 1H), 7.61–7.56 (m, 2H),
7.51–7.49 (m, 2H), 7.30 (d, J = 8.0 Hz, 2H), 6.74 (d, J = 9.2 Hz, 1H), 4.14–4.10 (m, 2H),
3.76–3.69 (m, 2H), 2.64–2.58 (m, 2H), 1.29 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100
MHz) δ 161.33, 158.63, 145.31, 145.25, 139.91, 137.50, 136.28, 135.44, 135.32, 130.12,
128.88, 127.38, 126.33, 124.38, 122.75, 106.64, 71.55, 50.51, 29.69, 22.69, 18.96;
HRMS (EI) m/z calcd for C26H27N4O2 [M+] 427.2134, found: 427.2114.
32) 3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-(4-methoxyphenyl)quinazolin-
4(3H)-one
1
White solid (18%); mp 188.3–189.5°C; H-NMR (400Mz, CDCl3) δ 8.36 (dd, J = 1.4, 7.8 Hz,
1H), 8.17 (d, J = 2.4 Hz, 1H), 8.07 (s, 1H), 7.80 (dd, J = 1.6, 7.2 Hz, 1H), 7.61–7.54 (m, 4H),
18

ACCEPTED MANUSCRIPT
7.06–7.02 (m, 2H), 6.74 (d, J = 9.2 Hz, 1H), 4.14–4.11 (m, 2H), 3.87 (s, 3H), 3.75–3.70 (m,
13
2H), 2.64–2.58 (m, 2H), 1.29 (d, J = 6.4 Hz, 6H). C NMR (CDCl3, 100 MHz) δ 161.33,
159.26, 158.63, 145.25, 145.24, 145.18, 139.50, 136.28, 135.35, 131.43, 130.56, 127.40,
126.13, 124.38, 122.80, 113.66, 106.64, 71.54, 55.32, 50.51, 29.69, 18.96; HRMS (EI)
m/z calcd for C26H27N4O3 [M+] 443.2083, found: 443.2061.
33)
3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-(4-(methylsulfonyl)phenyl)
quinazolin-4(3H)-one
1
White solid (15%); mp 113.5–115.0°C; H-NMR (400Mz, CDCl3) δ 8.47 (dd, J = 1.6, 8.0 Hz,
1H), 8.17 (d, J = 2.4 Hz, 1H), 8.09–8.05 (m, 3H), 7.85–7.81 (m, 3H), 7.66–7.58 (m, 2H), 6.74
(d, J = 8.8 Hz, 1H), 4.14–4.11 (m, 2H), 3.75–3.71 (m, 2H), 3.19 (s, 3H), 2.65–2.59 (m, 2H),
1.29 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz) δ 160.96, 158.71, 146.02, 145.25,
145.05, 143.95, 139.47, 137.63, 136.18, 135.55, 131.29, 127.90, 127.59, 127.21, 124.04,
123.02, 110.64, 106.66, 71.54, 50.48, 44.61, 29.70, 18.96; HRMS (EI) m/z calcd for
C26H27N4O4S [M+] 491.1753, found: 491.1731.
34)
3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyridin-3-yl)-8-(4-fluorophenyl)quinazolin-
4(3H)-one
1
White solid (17%); mp 138.9–140.0°C; H-NMR (400Mz, CDCl3) δ 8.40 (dd, J = 1.6, 8.0 Hz,
1H), 8.17 (d, J = 2.0 Hz, 1H), 8.07 (s, 1H), 7.79 (dd, J = 1.6, 7.6 Hz, 1H), 7.61–7.56(m, 4H),
7.20–7.15 (m, 2H), 6.74 (d, J = 9.2 Hz, 1H), 4.14–4.11 (m, 2H), 3.76–3.68 (m, 2H), 2.64–2.58
(m, 2H), 1.29 (d, J = 6.4 Hz, 6H). 13C NMR (CDCl3, 100 MHz) δ 163.74, 161.29, 161.22,
158.66, 145.51, 145.27, 145.14, 138.77, 136.25, 135.46, 134.16, 134.13, 131.98, 131.90,
127.44, 126.74, 124.25, 122.86, 115.23, 115.01, 106.65, 71.56, 50.50, 29.70, 18.96;
HRMS (EI) m/z calcd for C25H24FN4O2 [M+] 431.1883, found: 431.1874.
35)
3-(5-((2S,6R)-2,6-Dimethylmorpholino)pyridin-2-yl)-8-(4-(trifluoromethoxy)phenyl)
quinazolin-4(3H)-one
1
White solid (12 mg, 6%); mp 146.5–147.6°C; H-NMR (400Mz, CDCl3) δ 8.53 (s, 1H), 8.43
(dd, J = 1.4, 8.2 Hz, 1H), 8.20 (d, J = 2.8 Hz, 1H), 7.79 (dd, J = 1.6, 7.6 Hz, 1H), 7.73–7.65 (m,
3H), 7.59 (t, J = 7.8 Hz, 1H), 7.35–7.32 (m, 3H), 3.85–3.80 (m, 2H), 3.54–3.51 (m, 2H), 2.55 (t,
13
J = 11.4 Hz, 2H), 1.30 (d, J = 6.4 Hz, 6H). C NMR (CDCl3, 100 MHz) δ 160.70, 148.78,
146.45, 144.93, 144.88, 140.94, 138.20, 136.93, 136.16, 135.48, 131.78, 127.24, 127.05,
19

ACCEPTED MANUSCRIPT
123.51, 123.00, 121.36, 120.50, 71.39, 53.47, 19.01; HRMS (EI) m/z calcd for
C26H24F3N4O3 [M+] 497.1801, found: 497.1790.
36) 3-(6-(4-Methylpiperidin-1-yl)pyridin-3-yl)-8-(4-(trifluoromethoxy)phenyl)quinazolin-
4(3H)-one
White solid (10 mg, 5%); mp 156.4–157.0°C; 1H-NMR (400Mz, CDCl3) δ 8.42 (dd, J = 1.0, 8.2
Hz, 1H), 8.13 (d, J = 2.8 Hz, 1H), 8.09 (s, 1H), 7.80 (dd, J = 1.2, 7.2 Hz, 1H), 7.67–7.64 (m,
2H), 7.61 (t, J = 7.6 Hz, 1H), 7.54 (dd, J = 2.6, 9.4 Hz, 1H), 7.34 (d, J = 8.4 Hz, 2H), 6.76 (d, J
= 8.8 Hz, 1H), 4.35 (d, J = 13.2 Hz, 2H), 2.95–2.88 (m, 2H), 1.76–1.64 (m, 3H), 1.28–1.18 (m,
3H), 0.99 (d, J = 6.0 Hz, 3H). 13C NMR (CDCl3, 100 MHz) δ 161.20, 158.90, 145.88,
145.20, 145.11, 138.25, 136.86, 135.97, 135.42, 131.72, 127.39, 127.08, 123.15, 122.95,
120.55, 106.65, 45.58, 33.73, 31.16, 21.90; HRMS (EI) m/z calcd for C26H24F3N4O2 [M+]
481.1851, found: 481.1875.
37)
3-(6-((2S,6R)-2,6-Dimethylmorpholino)pyrimidin-4-yl)-8-(4-(trifluoromethoxy)
phenyl)quinazolin-4(3H)-one
White solid (12 mg, 6%); mp 231.9–232.7°C; 1H-NMR (400Mz, CDCl3) δ 8.81 (s, 1H), 8.59 (s,
1H), 8.41 (dd, J = 1.2, 8.4 Hz, 1H), 7.82 (dd, J = 1.2, 7.6 Hz, 1H), 7.66–7.60 (m, 3H), 7.34–7.31
(m, 3H), 4.45–4.19 (m, 2H), 3.71–3.66 (m, 2H), 3.70 (t, J = 11.8 Hz, 2H), 1.29 (d, J = 6.4 Hz,
6H). 13C NMR (CDCl3, 100 MHz) δ 162.60, 160.63, 158.26, 155.72, 148.86, 144.29,
143.41, 138.37, 136.55, 135.92, 131.77, 127.60, 127.07, 122.66, 120.51, 98.04, 71.47,
49.42, 18.82; HRMS (EI) m/z calcd for C25H23F3N5O3 [M+] 498.1753, found: 498.1750.
38)
3-(6-(4-Methylpiperidin-1-yl)pyrimidin-4-yl)-8-(4
(trifluoromethoxy)
phenyl)quinazolin-4(3H)-one
White solid (18 mg, 9%); mp 201.5–202.7°C; 1H-NMR (400Mz, CDCl3) δ 8.77 (s, 1H), 8.56 (s,
1H), 8.41 (dd, J = 1.2, 8.0 Hz, 1H), 7.81 (dd, J = 1.2, 7.2 Hz, 1H), 7.66–7.58 (m, 3H), 7.33 (d, J
= 8.4 Hz, 2H), 7.27 (d, J = 3.6 Hz, 6H), 4.63–4.29 (m, 2H), 2.97 (t, J = 11.8 Hz, 2H), 1.79–1.68
(m, 3H), 1.26–1.16 (m, 2H), 0.99 (d, J = 6.0 Hz, 3H). 13C NMR (CDCl3, 100 MHz) δ 162.45,
160.55, 158.40, 155.57, 144.36, 143.64, 138.30, 136.64, 135.78, 131.78, 127.49, 127.09,
122.77, 120.50, 98.02, 44.78, 33.70, 31.10, 21.71; HRMS (EI) m/z calcd for C25H23F3N5O2
[M+] 482.1804, found: 482.1809.
39) 3-(2-Morpholinoethyl)-8-(4-(trifluoromethoxy)phenyl)quinazolin-4(3H)-one
1
White solid (39%); mp 124.2–125.7°C; H-NMR (400Mz, CDCl3) δ 8.37 (dd, J = 1.6, 8.0 Hz,
20

ACCEPTED MANUSCRIPT
1H), 8.06 (s, 1H), 7.76 (dd, J = 1.6, 7.2 Hz, 1H), 7.64–7.62 (m, 2H), 7.57 (d, J = 7.8 Hz, 1H),
7.33 (d, J = 8.4 Hz, 2H), 4.10 (t, J = 6.0 Hz, 2H), 3.67 (t, J = 4.6 Hz, 4H), 2.73 (t, J = 6.0 Hz,
2H), 2.52 (t, J = 4.8 Hz, 4H). 13C NMR (CDCl3, 100 MHz) δ 161.14, 148.77, 146.58,
145.36, 138.02, 136.98, 135.14, 131.69, 126.95, 126.61, 122.74, 120.50, 66.85, 57.03,
53.73, 43.48; HRMS (EI) m/z calcd for C21H21F3N3O3 [M+] 420.1535, found: 420.1552.
40)
3-(3-(1H-Imidazol-1-yl)propyl)-8-(4-(trifluoromethoxy)phenyl)quinazolin-4(3H)-one
Colorless viscous oil (41 mg, 29%). 1H-NMR (400Mz, CDCl3) δ 8.36 (dd, J = 1.4, 7.8 Hz, 1H),
7.94 (s, 1H), 7.78 (dd, J = 1.6, 7.6 Hz, 1H), 7.62–7.57 (m, 4H), 7.32 (d, J = 8.0 Hz, 2H), 7.10 (s,
1H), 6.99 (s, 1H), 4.09 (t, J = 7.2 Hz, 2H), 4.01 (t, J = 7.0 Hz, 2H), 2.35–2.31 (m, 2H). 13C
NMR (CDCl3, 100 MHz) δ 161.22, 148.83, 145.44, 145.21, 138.25, 137.00, 136.70,
135.35, 131.70, 129.72, 127.41, 126.56, 122.58, 120.47, 118.58, 44.26, 44.19, 30.63;
HRMS (EI) m/z calcd for C21H18F3N4O2 [M+] 415.1382, found: 415.1399.
Biological assay
Cell Culture
NIH 3T3 cell lines were obtained from American Type Culture Collection (Manassas, VA).
Smo-EGFP stable cell lines were generated from NIH3T3 cells using a pUB6-Smo-EGFP
construct. Ptch-/- MEFs were generated from Ptch embryonic day 9.5 embryos and maintained
in Dulbecco’s Modified Eagle’s Medium (DMEM; HyClone, Logan, UT) with 10% fetal bovine
serum. To measure Gli transcription factor binding activity, we generated NIH3T3 cells with a
stable transfected 8xGliBS-luciferase construct (kindly provided by Dr. Sasaki, Center for
Developmental Biology, RIKEN) and an internal control Renilla luciferase construct, GL4.74
(Promega, Madison, WI). Site-directed mutagenesis was performed to generate a pUB6-Smo
(D477H) construct, and stable cell lines overexpressing comparable levels of wild-type Smo or
mutant Smo were established for further experiments.
Luciferase assay
NIH3T3 cells stably expressing 8xGliBS-luciferase with Renilla luciferase were seeded on 24-
well culture plates at 4×10⁴ cells per well and grown in an incubator at 37°C and 5% CO2
overnight. The next day, cell culture media were replaced with a serum-free medium (DMEM)
for 30 h to induce ciliogenesis. Subsequently, cells were treated with various concentrations of
chemicals and DMSO as a control. After 24 h, firefly and Renilla luciferase activities were
21

ACCEPTED MANUSCRIPT
measured with a dual-luciferase reporter assay system according to the manufacturer’s protocol
(Promega). Briefly, cells were lysed in 100 µL of passive lysis buffer (Promega) for 15 min on a
shaker. Sample extracts were transferred to a fresh tube. Extracted samples were transferred into
96-well plates, and 50-µL firefly substrate (GoldBio Technology, St. Louis, MO) was added to
the samples. After measuring firefly luciferase activity, 1 µL Renilla substrate (200 µM;
GoldBio Technology) was diluted with 49 µL Stop & Glo Buffer (1.1 M NaCl, 2.2 mM
Na2EDTA, 0.22 M KxPO4(pH5.1), 0.44mg/mL BSA, 1.3 mM NaN3) and added to cell lysates.
Dual-luciferase activity was measured using a GloMax luminometer following the
manufacturer’s instructions (Promega). Statistical analysis was performed using Student’s t-
tests (two-tailed, equal variance).
Immunoblotting
Ptch-/- MEF cells were lysed in modified RIPA buffer (150 mM NaCl, 50 mM Tris-HCl (pH
7.4), 1 mM EDTA, 1% NP40, 0.25% Na-deoxycholate) with 1 mM PMSF 1× protease inhibitor
(Roche) on ice. Protein extracts were clarified for 15 min at 13,500 rpm at 4°C, and the
supernatant was transferred to a fresh tube. Protein concentration was determined by the BCA
Protein Assay (Pierce, Rockford, IL). Equal amounts of protein (10 µg) were loaded for
electrophoresis. After electrophoresis, proteins were transferred to PVDF membranes (Millipore,
Billerica, MA) using a Trans-Blot SD semi-dry transfer cell (Bio-Rad, Hercules, CA).
Membranes were washed with Tris-buffered saline solution containing 0.2% Tween 20 (TBST)
and blocked for 1 h in TBST containing 5% skim milk. Membranes were then incubated
overnight at 4°C with mouse anti-Gli1 (Cell Signaling, Danvers, MA) or mouse anti-beta
tubulin (Millipore). After washing with washing buffer, membranes were incubated for 2 h at
room temperature with adequate secondary antibodies. Signals were detected with a
chemiluminescent reagent (Millipore) following the manufacturer’s instructions.
Immunofluorescence staining
Cells grown on coverslips were fixed in 4% (w/v) paraformaldehyde (PFA) in phosphate
buffered saline (PBS) for 15 min at room temperature and washed three times with PBS. Fixed
cells were incubated with blocking buffer (1% horse serum, 0.1% Triton X-100 in PBS) for 30
min at 4°C. Cells were incubated with the following primary antibodies overnight at 4°C: mouse
anti-acetylated tubulin (Sigma, St. Louis, MO) and guinea pig anti-Gli2. After washes with
blocking buffer, cells were further incubated with Cy3-conjugated secondary antibodies
22

ACCEPTED MANUSCRIPT
(Jackson ImmunoResearch, West Grove, PA) and DAPI (Sigma) for 2 h at room temperature.
All fluorescent images were acquired on a Nikon C1 confocal microscope (Nikon Instruments,
Melville, NY).
Quantitative real-time RT-PCR
Total RNA was isolated from the wild-type or mutant (D477H) form of Smo-overexpressing
stable cells lines using QIAzol Lysis Reagent (Qiagen, Hilden, Germany), and 1 µg of total
RNA was reverse transcribed with oligo-dT primer using a First-Strand cDNA Synthesis kit
(Takara, Shiga, Japan). Real-time PCR was performed using the Rotor Gene Q instrument
(Qiagen) with SYBR Premix Ex Taq (Takara). The primer sequences used in this study for the
quantitation
GGTGCTGCCTAAGCCAGTGCCT
of
murine
Gli1
were
C-3′;
as
follows:
Gli1
Gli1
forward,
5′-
5′-
reverse,
GTGCCAATCCGGTGGAGTCAGACCG-3′. Beta-actin was used as the internal control, and
the primer sequences used here were as follows: β-actin forward, 5′-
GGCCCAGAGCAAGAGAGGTATCC-3′;
β-actin
reverse,
5′-
ACGCACGATTTCCCTCTCAGC-3. Results were analyzed with Rotor Gene Q series software
to calculate the relative mRNA levels using the 2−∆∆Ct method.
Evaluation of microsomal stability
Microsomal incubations were conducted in triplicate in in 8-well tube strips placed in a 8ｘ12
rack (1.2 ml; VWR, Emeryville, CA). Test compounds were dissolved in DMSO and diluted
such that the final concentration in the incubations was 1µM and below 1% acetonitrile and
0.01% DMSO.
To study NADPH-dependent oxidative metabolism, test compounds were incubated with pooled
human liver microsomes (HLM, final concentration: 0.5 mg/ml) in the presence of NADPH
(final concentration: 1 mM) in a final volume of 160 µl. Buspirone was used as positive control.
Before the addition of 1 mM β-NADPH, the incubation plates were warmed at 37°C for 5 min.
The reaction was terminated at 0 min and 30 min by the addition of 320 µL of ice-cold
acetonitrile containing an internal standard (IS) for sample analysis. The incubation mixtures
were then centrifuged at 910 x g for 10 min. The supernatant was analyzed by a liquid
chromatography electrospray ionization tandem mass spectrometry (LC-ESI/MS/MS) method.
For the glucuronidation reaction, HLM (final concentration: 0.5 mg/ml) and alamethicin (final
concentration: 50 µg/mg of microsomal protein) were mixed in 40 mM Tris buffer (pH 7.4) and
placed on ice for 15 min. 4-Methylumbelliferone (4-MUF) was used as a positive control. Test
compound (final concentration: 1 µM) and saccharic acid 1,4-lactone (final concentration: 5
mM) were added and the mixture was preincubated at 37℃ for 5 min. To initiate the reaction,
UDPGA (final concentration: 5 mM) was added. The final incubation volume was 160 µl. The
23

ACCEPTED MANUSCRIPT
reaction was terminated at 0 min and 30 min by the addition of 320 µL of ice-cold acetonitrile
containing an IS. The samples were centrifuged at 910 xg for 10 min. Aliquots of the
supernatant were subject to the LC-ESI/MS/MS analysis.
Samples were analyzed by an API 2000 LC-ESI/MS/MS system (Applied Biosystems, Foster
City, CA) in positive MRM mode using 50 ng/mL carbamazepine as the IS. LC-ESI/MS/MS
data were analyzed by Analyst 1.4.2.
Acknowledgments
This work was supported by the National Research Foundation (NRF) Korea (NRF2012-
M3A9C1053532, 2014A3A3A01005455, 2015M3A6A4065734 and 2015M3C7A1028398) and
a grant from KRIBB Research Initiative program.
24

ACCEPTED MANUSCRIPT
References and notes
[1] Suzie J. Scales, Frederic J. de Sauvage, Trends. Pharmacol. Sci. 30 (2009) 303-312.
[2] Neeraj Mahindroo, Chandanamali Punchihewa, Naoaki Fujii, J. Med. Chem. 52 (2009)
3829-3845.
[3] Benjamin Z. Stanton, Lee F. Peng, Mol. BioSyst. 6 (2010) 44-54.
[4] Marie Evangelista, Hua Tian, Frederic J. de Sauvage, Clin. Cancer. Res. 12 (2006)
5924-5928.
[5] M. Kyle Hadden, ChemMedChem. 9 (2014) 27-37.
[6] Lee L. Rubin, Frederic J. de Sauvage, Nat. Rev. Drug. Discov. 5 (2006) 1026-1033.
[7] Jessica M. Y. Ng, Tom Curran, Nat. Rev. Cancer. 11 (2013) 493-501.
[8] Yiwei Li, Ma’in Y. Maitah, Aamir Ahmad, Dejuan Kong, Bin Bao, Fazlul H. Sarkar,
Expert. Opin. Ther. Targets. 16 (2012) 49-66.
[9] Stefan Peukert, Karen Miller-Moslin, ChemMedChem 5 (2010) 500-512.
[10] Charles M. Rudin, Clin. Cancer. Res. 18 (2012) 3218-3222.
[11] A. Gould, S. Missailidis, Mini. Rev. Med. Chem. 11 (2011) 200-213.
[12] Andrzej Dlugosz, Sid Agrawal, Peter Kirkpatrick, Nat. Rev. Drug. Discov. 11 (2012)
437-438.
[13] Matthew Kyle Hadden, Expert. Opin. Ther. Pat. 23 (2013) 345-361.
[14] Frank Cirrone, Christy S. Harris, Clin. Ther. 34 (2012) 2039-2050.
[15] Sonia Coni, Paola Infante, Alberto Gulino, BioChem. Pharmacol. 85 (2013) 623-628.
[16] Upasana Banerjee, Matthew Kyle Hadden, Expert. Opin. Drug. Discov. 9 (2014) 751-
771.
25

ACCEPTED MANUSCRIPT
[17] Shifeng Pan, Xu Wu, Jiqing Jiang, Wenqi Gao, Yongqin Wan, Dai Cheng, Dong Han,
Jun Liu, Nathan P. Englund, Yan Wang, Stefan Peukert, Karen Miller-Moslin, Jing
Yuan, Ribo Guo, Melissa Matsumoto, Anthony Vattay, Yun Jiang, Jeffrey Tsao,
Fangxian Sun, AnneMarie C. Pferdekamper, Stephanie Dodd, Tove Tuntland,
Wieslawa Maniara, Joseph F. Kelleher, III, Yung-mae Yao, Markus Warmuth, Juliet
Williams, Marion Dorsch, Med. Chem. Lett. 1 (2010) 130-134.
[18] Bӧhm Hans-Joachim, Flohr Alexander, Stahl Martin, Drug Discovery Today: Tech
nologies. 1 (2004) 217-224.
[19] Hongmao Sun, Gregory Tawa, Anders Wallqvist, Drug. Discov. Today. 17 (2012) 310-
324.
[20] Lin He, Haoquan Li, Jianbin Chen, Xiao-Feng Wu, RSC. Adv. 4 (2014) 12065-12077.
[21] Carmen Petronzi, Selene Collarile, Gianluca Croce, Rosanna Filosa, Paolo De
Caprariis, Antonella Peduto, Laura Palombi, Valentina Intintoli, Antonia Di Mola,
Antonio Massa, Eur. J. Org. Chem. 27 (2012) 5357-5365.
[22] Vincent Lisowski, Max Robba, Sylvain Rault, J. Org. Chem. 65 (2000) 4193-4194.
[23] Margherita Barbero, Stefano Bazzi, Silvano Cadamuro, Lorenzo Di Bari, Stefano
Dughera, Giovanni Ghigo, Daniele Padula, Silvia Tabasso, Tetrahedron 67 (2011)
5789-5797.
26

ACCEPTED MANUSCRIPT
Figure and scheme captions
Figure 1. Structures of Hh signaling pathway inhibitors
Figure 2. Design of new isoindolinone and quinazolinone compounds
Figure 3. Quinazolinone derivatives inhibit Hh pathway activation
Figure 4. Quinazolinone derivatives suppress Hh pathway through regulating Smo and Gli2
ciliary localization
Figure 5. Relative inhibitory effect of sonidegib, compounds 28 and 34, and vismodegib on
wild-type and vismodegib-resistant mutant Smo
Scheme 1. Synthesis of amines: Reagents and condition: a) amine, K2CO3, DMF, 70°C, 5–
6 h, 64–80%; b) H2, Pd/C, MeOH, rt, 2–3 h, 94–99%; c) 2 equiv amine, toluene, reflux, 18 h,
64% and 74%
Scheme 2. Synthesis of isoindolinone compounds: Reagents and condition: a) EtOH,
sulfuric acid, benzene, reflux, overnight, 88%; b) NBS, AIBN, benzene, reflux, 5 h, 96–97%; c)
6-((2S,6R)-2,6-dimethylmorpholino)pyridin-3-amine
or
6-((2S,6R)-2,6-
dimethylmorpholino)pyrimidin-4-amine, DIPEA, ethanol, sealed tube, 100°C, overnight, 77%
and 15%; d) Pd(PPh3)4, 2M aq. solution Na2CO3, DME, sealed tube, 100°C, overnight, 75–
93%
Scheme 3. Synthesis of quinazolinone compounds: Reagents and condition: a) trimethyl
orthoformate, THF, 110°C, 18 h, 5–33%
Scheme 4. Synthesis of quinazolinone compounds: Reagents and condition: a) Pd(PPh3)4,
NaHCO3, DME/H2O, reflux, 2–3 h, 43–60%; b) 5% NaOH, H2O2 (aq. solution), rt to 50°C, 30
min, 56–87%; c) trimethyl orthoformate, THF, 110°C, 18 h, 7–20%
27

ACCEPTED MANUSCRIPT
Table 1. In vitro Hh pathway inhibitory activity and cytotoxicity of isoindolinone derivatives
R1
N R2
O
Cell
Compounds
R1
R2
IC50 (µM)a
viability
(µM)a
N
9
F3CO
N
N
N
O
O
O
1.796
> 20
> 20
> 20
> 20
> 20
N
N
N
10
11
14
7.692
F
1.710
F
N
F3CO
N
N
O
1.142
Vismodegib
Sonidegib
0.005
0.006
aValues are the mean of three experiments
28

ACCEPTED MANUSCRIPT
Table 2. In vitro Hh pathway inhibitory activity and cytotoxicity of quinazolinone derivatives
R1
N
N R2
O
Cell viability
(µM)a
Compounds
R1
R2
IC50 (µM)a
F
Cl
Cl
Cl
0.269
> 20
> 20
> 20
> 20
16
17
18
N
O
O
N
N
15.26
N
N
O
> 20
Cl
Cl
7.489
19
N
N
N
O
1.237
0.132
0.433
> 20
> 20
> 20
20
24
25
N
N
O
O
MeO
F3CO
F3CO
N
N
O
O
> 20
> 20
4.52
5.41
26
27
N
N
N
O
> 20
0.038
28
29