Synthesis and Structure-Activity Relationships of Arylsulfonamides as AIMP2-DX2 Inhibitors for the Development of a Novel Anticancer Therapy

pubs.acs.org/jmc

Article

Synthesis and Structure−Activity Relationships of Arylsulfonamides

as AIMP2-DX2 Inhibitors for the Development of a Novel Anticancer

Therapy

Aneesh Sivaraman,^∇Dae Gyu Kim,^∇Deepak Bhattarai, Minkyoung Kim, Hwa Young Lee, Semi Lim,

Jiwon Kong, Ja-il Goo, Seunghwan Shim, Seungbeom Lee, Young-Ger Suh, Yongseok Choi,

Sunghoon Kim,* and Kyeong Lee *

Cite This: https://dx.doi.org/10.1021/acs.jmedchem.9b01961

Read Online

sı

*

Metrics & More

Article Recommendations

Supporting Information

ACCESS

ABSTRACT: AIMP2-DX2, a splicing variant of AIMP2, is up-

regulated in lung cancer, possesses oncogenic activity, and results

in tumorigenesis. Speciﬁcally inhibiting the interaction between

AIMP2-DX2 and HSP70 to suppress AIMP2-DX2-dependent

cancers with small molecules is considered a promising avenue for

cancer therapeutics. Optimization of hit BC-DXI-04 (IC₅₀= 40.1

μM) provided new potent sulfonamide based AIMP2-DX2

inhibitors. Among these, BC-DXI-843 showed improved inhib-

ition against AIMP2-DX2 (IC₅₀= 0.92 μM) with more than 100-

fold selectivity over AIMP2 in a luciferase assay. Several binding assays indicated that this compound eﬀectively induces cancer cell

apoptosis by speciﬁcally interrupting the interaction between DX2 and HSP70, which leads to the degradation of DX2 via Siah1-

mediated ubiquitination. More importantly, BC-DXI-843 demonstrated in vivo eﬃcacy in a tumor xenograft mouse model (H460

cells) at a dosage of 50 mg/kg, suggesting it as a promising lead for development of novel therapeutics targeting AIMP2-DX2 in lung

cancer.

cancer cell lines and tissues. Although this variant has lost the

ability to associate with the MSC, it can still inhibit the tumor-

suppressive function of the native AIMP2 through competitive

interactions with p53, FBP, and TRAF2. Furthermore, the

speciﬁc interaction of DX2 with p14 and the subsequent

inactivation of p14 are critical for tumor growth in KRAS-driven

lung cancers. An increased ratio of DX2 versus AIMP2 shows a

positive correlation with poor clinical outcome of lung cancer as

well as chemotherapy resistance in ovarian cancer. siRNA or

chemical inhibition of DX2 expression reduces tumor growth,

indicating its potential as a therapeutic target.¹⁰⁻¹⁴

More recently, we reported that the 70 kDa heat shock

proteins (HSP70s) are critical determinants of DX2 levels in

cells. A positive correlation between HSP70 and DX2 levels has

been shown in various lung cancer cell lines and patient tissues.

The binding of the substrate-binding domain (SBD) of HSP70

to the ﬂexible N-terminal region (NFR) and the GST-N-

terminal domain (GST-N) of DX2 protect it from Siah1-

INTRODUCTION

■

Aminoacyl-tRNA synthetases (ARSs) are a family of 20 essential

enzymes (one for each amino acid) that play an important role in

conjugating amino acids to their cognate tRNAs during protein

synthesis. In higher eukaryotic systems, nine diﬀerent ARSs

form a multisynthetase complex (MSC) with three auxiliary

factor ARS-interacting multifunctional proteins (AIMPs).

Although AIMP1−3 provide scaﬀolding for the assembly and

integrity of the MSC, they also dissociate from the MSC to

perform diverse regulatory functions that are not directly related

to protein synthesis.¹⁻⁴Among them, AIMP2/p38 helps control

the fate of a cell and performs various functions in response to

stress signals. It displays antiproliferative activity by enhancing

the growth-arresting signal of TGF-β, and it also promotes cell

death by activating p53 and the apoptotic signal of TNF-α. The

antiproliferative and proapoptotic roles of AIMP2 have been

supported by in vivo mouse models. Aimp2-heterozygous mice,

when compared with wild-type mice, are more vulnerable to

tumorigenesis in lung, colon, and skin carcinogenesis models,

suggesting that AIMP2 is a haploinsuﬃcient tumor suppressor

with a unique mechanism.⁵⁻⁹

Received: December 4, 2019

The gene encoding AIMP2 consists of four exons and is

subject to alternative splicing. A variant of AIMP2, known as

AIMP2-DX2 (DX2 from here onward), is created by deleting

exon 2 via alternative splicing and has been detected in various

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

A

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

mediated ubiquitination. Moreover, preventing HSP70 from

binding to DX2 with mutational and chemical inhibition

destabilizes DX2, suggesting HSP70 is functionally signiﬁcant

in maintaining DX2 levels in cells. Thus, inhibiting the protein−

protein interaction (PPI) between AIMP2-DX2 and HSP70

may lead to a therapeutic strategy against cancer (Figure 1).^15,16

compound and its morpholine derivative were synthesized

following the procedure shown in Scheme 1. ^L-Leucine was

coupled with p-toluenesulfonyl chloride in basic medium to

generate the sulfonamide 4a, which yielded derivatives 1a (BC-

DXI-04) and 5a under standard amide coupling conditions.

Using similar conditions, the enantiomers, 1b and 5b, were

synthesized from ^D-leucine (Scheme 1).

Anilines 8a−e were prepared from 4-ﬂuoronitrobenzene (6)

by using nucleophilic aromatic substitution followed by

reduction with Pd/C and H₂as previously described.^21,22

Subsequent condensation with intermediate 4a under the

standard conditions yielded amide derivatives 9a−e (Scheme

2). ^L-Leucine benzyl ester was initially coupled with p-toluic acid

to generate intermediate 11, which was subsequently depro-

tected under hydrogenation and further coupled with 4-

morpholinoaniline using the aforementioned conditions to

yield the diamide derivative 12 (Scheme 3).

The arylsulfonamide derivatives 14a−f were prepared

following the procedures shown in Scheme 4. Various

arylsulfonyl chlorides were coupled with ^L-leucine under basic

conditions yielding the intermediates 13a−f. Under the

standard amide coupling conditions, these acids yielded

compounds 14a−f. p-Toluene sulfonamides, 16a−k, of various

L-amino acids were prepared as shown in Scheme 5. Compounds

17a−f, 17i, and 2 (BC-DXI-495) were obtained from their

respective acids under the aforementioned conditions. The

tyrosine derivative 17j was prepared by the deprotection of the

O-sulfonated compound under basic conditions, and derivatives

17g and 17h were prepared through the deprotection of the

benzyl groups from their respective benzyl ester by hydro-

genation.

As shown in Scheme 6, various ^L-tryptophan sulfonamides

(16k, 18a−c) were prepared using the established conditions.

Subsequent condensation with various amines under the

standard conditions generated derivatives 19a,b, 20a−d, and

21a−f. The thiazole amines (d, e, and f) were prepared in one-

step with the corresponding phenacyl bromides and thiourea

using previously described conditions.^23,24

Structure−Activity Relationship Exploration. High-

throughput screening (HTS) involving our in-house chemical

library identiﬁed a substituted sulfonamide, BC-DXI-04 (1a),

that suppresses intracellular levels of DX2 and inhibits the

proliferation of cancer cells with moderate activity and good

selectivity. It demonstrated 55.80% inhibition at 40 μM in a

DX2-luciferase assay, which is an assay for determining the level

of luciferase-tagged DX2 via detection of luminescence signal.

The IC₅₀and EC₅₀values measured by DX2-luciferase and cell

Figure 1. Schematic model for DX2-dependent cancer progression.

DX2 is degraded by Siah1-mediated ubiquitination (upper). But in the

presence of HSP70, DX2 binds with HSP70 and is protected from

Siah1, stabilizing DX2 protein levels. Stabilized DX2 reduces p53 and

p14 protein levels upon UV exposure and oncogenic signals,

respectively. Stabilized DX2 also increases FBP and TRAF2 upon

TGFβ and TNF-α transduction, respectively, resulting in enhanced

cancer progression (bottom). Ub = ubiquitin.

Among the previously identiﬁed small molecules targeting

DX2,¹⁵⁻²⁰BC-DXI-01 suppresses DX2 cellular levels through

selective degradation of DX2 mRNA transcripts, leading to

inhibition of DX2 activity and tumor suppression.¹⁷SLCB050

speciﬁcally inhibits the interaction between DX2 and p14ARF,

suppressing proliferation of p14ARF-positive lung cancer

cells.^18,19The sulfonamide BC-DXI-04 (1a) was identiﬁed as

a screening hit of DX2 that decreases the proliferation of lung

cancer cells in a concentration-dependent manner.²⁰Using one

of its synthetic derivatives (BC-DXI-495, 2) as a chemical

probe, the mode of action was elucidated. These compounds

destabilize DX2 by inhibiting its interaction with HSP70.^15,16

Herein, we report the synthesis and structure−activity relation-

ships of a series of arylsulfonamides (Figure 2), which led to the

novel compound BC-DXI-843 (20d). It modulates the HSP70-

DX2 interaction with greater eﬃcacy than the starting

compound. We also demonstrate the tumor-suppressive

function of BC-DXI-843 in a DX2-dependent manner via the

inhibition of two protein interactions.

RESULTS AND DISCUSSION

Chemistry. The synthetic approaches used to generate the

arylsulfonamides are described in Schemes 1−6. The hit

■

Figure 2. Chemical structures of known sulfonamide based small molecule inhibitors and strategy for SAR exploration.

B

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

a

Scheme 1

a

Reagents and condition: (a) p-toluenesulfonyl chloride, NaOH, H₂O, rt, 12 h, 52% and 58%; (b) amine, EDCI·HCl, HOBt, TEA, DCM, rt, 18 h,

21−91%.

a

Scheme 2

a

Reagents and condition: (a) amine, K₂CO₃, DMF, 70°C, 5−6 h, 83−93%; (b) H₂, Pd/C, MeOH, rt, 2−3 h, 94−99%; (c) amine, EDCI·HCl,

HOBt, TEA, DCM, rt, 18 h, 21−91%.

a

Scheme 3

a

Reagents and condition: (a) p-toluic acid, EDCI·HCl, HOBt, TEA, DCM, rt, 12 h, 18−94%; (b) H₂, Pd/C, MeOH, 2 h; (c) 4-morpholinoaniline,

EDCI·HCl, HOBt, TEA, DCM, rt, 18 h, 24%.

viability assay were 40.1 μM and 40.8 μM, respectively. On the

basis of this hit, a series of arylsulfonamides were screened using

a nanoluciferase assay at 40 μM. To deﬁne the key structural

requirements for the biological activity of BC-DXI-04, our

optimization strategy was focused on four discrete areas: (A) the

eﬀect of the chiral center and the requirement of a sulfonamide

linker, (B) the 1,4,7-trioxa-10-azacyclododecane moiety, which

could be replaced by an arylamine containing various

substituents, (C) substitution eﬀects on the phenyl ring of the

sulfonamide part, and (D) variations in the amino acid chain

(Figure 2).

Initial replacement of the 1,4,7-trioxa-10-azacyclododecane

moiety with morpholine yielded a simpliﬁed derivative, 5a, with

a comparable inhibition of 57.30% in the DX2-luciferase assay

(part B). In parallel, we also synthesized enantiomers (^D-isomer)

of these compounds, 1b and 5b, to understand the eﬀect of the

chiral center on their activity (part A). As shown in Table 1, the

inhibition values of these isomers dramatically decreased,

suggesting that the presence of an ^L-conﬁguration is essential

for their activity. Furthermore, we replaced the morpholine

group of 5a with 4-morpholinoaniline, resulting in an equipotent

molecule 9a, (Table 2) with 56.90% inhibition. Considering that

the aryl linker could be a useful handle for optimizing the

properties of the molecule, a detailed SAR study of this molecule

(9a) was designed.

We explored the eﬀects of various substitutions on the phenyl

ring of the amide chain and the sulfonamide moiety on

inhibitory activity as shown in Table 2. Continuing the SAR

study in Table 2, replacing morpholine with pyrrolidine and

piperidine moieties resulted in the less potent derivatives 9b−d.

Substituting with thiomorpholine 1,1-dioxide also decreased the

inhibitory activity as in 9e. Further modiﬁcations to the amide

C

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

a

Scheme 4

a

Reagents and condition: (a) arylsulfonyl chloride, NaOH, H₂O, rt, 12 h, 14−59%; (b) 4-morpholinoaniline, EDCI·HCl, HOBt, TEA, DCM, rt, 18

h, 31−80%.

a

Scheme 5

a

Reagents and condition: (a) p-toluenesulfonyl chloride, NaOH, H₂O, rt, 12 h, 13−92%; (b) 4-morpholinoaniline, EDCI·HCl, HOBt, TEA, DCM,

rt, 18 h, and then (c) 5 M NaOH, EtOH, reﬂux, 4 h for 17j and H₂, Pd/C, MeOH, rt, 3 h for 17g and 17h, 31−68%.

chain were planned in the later stages. The diamide analog, 12,

of compound 9a exhibited signiﬁcantly diminished inhibitory

eﬀects (30.20% inhibition), suggesting that the sulfonamide

moiety is essential for the activity. We further explored the

eﬀects of substituents on the phenyl ring of the sulfonamide part

on the inhibitory activity. When the methyl group was removed,

the resulting compound 14a exhibited a loss of potency (14.46%

inhibition). The eﬀects of electron withdrawing and donating

groups were also examined (14b−f). However, except for 4-

bromo, all other substitutions resulted in a signiﬁcant loss in

activity and the 4-bromobenzenesulfonamide derivative 14c

demonstrated a potency similar to 9a with 54.55% inhibition in

the DX2-luciferase assay.

The impact of the amino acid chain on the inhibitory eﬀects

was then evaluated as shown in Table 3. A series of ^L-amino acid

derivatives (17a−j, 2) were synthesized and tested. Compounds

17a−j showed signiﬁcantly diminished inhibitory eﬀects when

compared with 9a. However, the tryptophan derivative 2 (BC-

DXI-495) showed signiﬁcantly increased activity (67.10%

inhibition) and is the most potent DX2 inhibitor synthesized

in this series so far. BC-DXI-495, a representative compound in

this series, was also used to understand their mode of action. It

D

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

a

Scheme 6

a

Reagents and condition: (a) arylsulfonyl chloride, NaOH, H₂O, rt, 12 h, 40−54%; (b) amine, EDCI·HCl, HOBt, TEA, DCM, rt, 3−4 h, 31−92%;

(c) amine, EDCI·HCl, HOBt, DIPEA, DMF, 60 °C, 16 h, for 20d−21f, 31−75%.

exerts tumor-suppressive activity by speciﬁcally inhibiting the

tumor-promoting interaction between DX2 and HSP70.¹⁶

Further structural modiﬁcations of BC-DXI-495 were

explored (Table 4). The orientation eﬀect of the methyl group

on the phenyl ring was initially investigated. The ortho and meta

derivatives 19a and 19b resulted in reduced potency with

59.23% and 40.78% inhibition, respectively, which suggests the

importance of a para-methyl group. Further optimization

focused on amide derivatives (part B) with 4-methyl (from 2)

and 4-bromo (from 14c) sulfonamide moieties. Decreased

potency was observed for the 20a and 21a derivatives without

morpholine substitution on the phenyl ring. The introduction of

thiophen-2-ylmethanamine resulted in decreased potency for

the 4-methylbenzenesulfonamide derivative 20b, while a

moderate eﬀect (42.99% inhibition) was observed with the 4-

bromobenzenesulfonamide derivative 21b. Similar results were

obtained for the ﬁve-membered heteroarylamine derivatives 20c

and 21c. Better potencies observed with the heterocycles

compared to phenyl ring suggested an opportunity to introduce

heteroarylamines. In addition, loss of potency with removal of

the morpholine group (20a and 21a) indicated the requirement

of bulky amino groups. Introduction of 4-(4-methoxyphenyl)-

thiazol-2-amine provided the 4-methylbenzenesulfonamide

derivative 20d, which exhibited the best inhibitory results

(72.56% inhibition), and the 4-bromobenzenesulfonamide

analog 21d, showing moderately good results (45.43%

inhibition). We also examined the orientation eﬀects of methoxy

substitution on the benzene ring for the 4-bromobenzene-

sulfonamide derivative. The inhibitory eﬀects were abolished for

the synthesized molecules 21e and 21f, which suggests that the

p-toluenesulfonamide and 4-(4-methoxyphenyl)thiazol-2-

amine moieties are essential for inhibiting DX2 as exempliﬁed

by 20d (BC-DXI-843).

BC-DXI-843 Speciﬁcally Inhibits AIMP2-DX2. Driven by

the improved inhibitory eﬀect of BC-DXI-843, we assessed the

selectivity proﬁle of candidates to identify lead compounds. Six

novel derivatives (BC-DXI-04, 5a, 9a, 14c, BC-DXI-495, and

BC-DXI-843) showing over 50% inhibition were subjected to

secondary screening using nanoluciferase-DX2 and -AIMP2.

Among the screened compounds, BC-DXI-843 demonstrated

an improved DX2 inhibition with better AIMP2 vs DX2

selectivity (Figure 3A). Therefore, this compound was selected

for further evaluation. To generate IC₅₀values, A549 cells

expressing nanoluciferase-DX2 or nanoluciferase-AIMP2 were

treated with BC-DXI-843 in a dose-dependent manner for 4 h,

and the luminescence was measured. The IC₅₀for inhibition of

DX2 and AIMP2 shows more than 100-fold selectivity (DX2

IC₅₀= 0.92 μM and AIMP2 IC₅₀> 100 μM, Figure 3B). BC-

DXI-495 was previously reported to be a DX2 inhibitor, and its

IC₅₀for DX2 degradation was 4.20 μM.^15,16To observe any

improvement of BC-DXI-843 over the previously reported

compounds BC-DXI-04 and BC-DXI-495, we compared their

IC₅₀values regarding inhibition of AIMP2 and DX2 expression

and their EC₅₀values in lung cancer and normal cells (Table 5).

E

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

Table 1. DX2-Inhibitory Activity of the Sulfonamide Derivatives 1a,b and 5a,b Using a DX2-Nanoluciferase Assay

a

The change of the nanoluciferase-tagged DX2 level upon treating chemicals was determined by detecting the luminescence signal.

The IC₅₀of the compounds with respect to DX2 gradually

decreased according to the modiﬁcation of the compound but

did not aﬀect AIMP2 levels. The EC₅₀measurements trended

similarly to the IC₅₀measurements; they gradually decreased.

But the EC₅₀values generated by normal lung cells were all 100-

fold higher than those generated by cancer cells (Table 5, right).

To determine the mode of action of BC-DXI-843, we ﬁrst

examined the interaction between BC-DXI-843 and DX2 using

a ﬂuorescence-based equilibrium binding assay. The binding

aﬃnity (K_d) was approximately 3.07 μM (Figure 4A). Previously

it was found that the analog BC-DXI-495 was bound to the

hydrophobic pocket of DX2, which comprises L80, T82, F116,

T117, and K129 residues. This hydrophobic pocket is proximal

to the binding surface of HSP70, suggesting that when BC-DXI-

495 binds to DX2, it may interfere with DX2/HSP70 binding.¹⁶

To characterize this relationship further, a docking study was

performed with BC-DXI-843 that focused on the hydrophobic

pocket identiﬁed in the previous study. This study used our in-

house homology model of DX2 (Figure 4B). In addition, BC-

DXI-843 docking was analyzed through the binding conﬁg-

uration of ﬁve important residues in the hydrophobic pocket.

According to the results, BC-DXI-843 was positioned very close

to L80, T82, F116, T117, and K129. Interestingly, BC-DXI-843

forms two hydrogen bonds with the hydrophobic pocket via T82

and D52 (Figure 4C). To validate the signiﬁcance of T82 and

D52 to the interaction between BC-DXI-843 and DX2, we

substituted several residues surrounding the hydrophobic

pocket, including these two residues, to alanine and conducted

the functional assay. When either D52 or T82 was mutated, BC-

DXI-843 could not interfere with the binding of DX2 to HSP70

(Figure S1A) and induce the degradation of DX2 protein

(Figure S1B). This conﬁrmed the signiﬁcance of the hydrogen

bonds formed between BC-DXI-843 and the D52 and T82

amino acid residues of DX2. Therefore, the improved biological

activity of BC-DXI-843 may be explained by the formation of

these hydrogen bonds.

BC-DXI-843 Speciﬁcally Induces the Degradation of

DX2 via Ubiquitination. To conﬁrm that BC-DXI-843 is a

DX2-speciﬁc inhibitor, we compared the inhibition of

endogenous DX2 protein expression in H460 cells using

immunoblotting after treating the cells with BC-DXI-843 or

BC-DXI-495. Both compounds exhibited dose-dependent

inhibition of DX2 protein levels, and BC-DXI-843 eﬃciently

induced degradation of DX2 at a much lower concentration

(1.20 μM) when compared to BC-DXI-495 (Figure S1C). This

implies that BC-DXI-843 is a more potent regulator of DX2, and

it regulates DX2 levels by speciﬁcally inducing its degradation.

However, AIMP2 was not aﬀected in any of the test conditions

by BC-DXI-843 or BC-DXI-495 (Figure S1C). We also

conﬁrmed that BC-DXI-843 has no eﬀect on the level of DX2

mRNA (Figure S1C), suggesting the speciﬁc inhibitory eﬀect on

protein level of DX2. Since the degradation of DX2 is mediated

by ubiquitination,^15,16we evaluated the amount of ubiquitinated

DX2 after treatment with BC-DXI-843 in a dose-dependent

manner. BC-DXI-843 induced the ubiquitination of endoge-

nous DX2, and the amount of ubiquitinated DX2 was saturated

at 1.20 μM (Figure S1D). These results are similar to the upper

results in Figure S1C, suggesting that BC-DXI-843 leads to the

degradation of DX2 via ubiquitination.

BC-DXI-843 Inhibits DX2 from Binding to HSP70. It has

been reported that DX2 is stabilized when bound to HSP70.¹⁶

Therefore, we tested whether BC-DXI-843 interferes with the

F

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

Table 2. DX2-Inhibitory Activity of the Sulfonamide Derivatives 9a−e, 12, and 14a−f Using a Nanoluciferase Assay

a

The change of the nanoluciferase-tagged DX2 level upon treating chemicals was determined by detecting the luminescence signal.

interaction between DX2 and HSP70. First, we conﬁrmed that

BC-DXI-843 interferes with DX2 and HSP70 binding by

performing an in vitro pull-down assay using puriﬁed DX2 and

HSP70 proteins in the presence of BC-DXI-843. BC-DXI-843

interfered with DX2 and HSP70 binding at a dose similar to that

which caused degradation of DX2 (Figure S2A). Next, we

G

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

Table 3. DX2-Inhibitory Activity of the Sulfonamide Derivatives 17a−j and 2 Using a Nanoluciferase Assay

a

The change of the nanoluciferase-tagged DX2 level upon treating chemicals was determined by detecting the luminescence signal.

H

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

Table 4. DX2-Inhibitory Activity of the Sulfonamide Derivatives 19a,b, 20a−d, and 21a−f Using a Nanoluciferase Assay

a

The change of the nanoluciferase-tagged DX2 level upon treating chemicals was determined by detecting the luminescence signal.

I

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

inhibition of DX2 (Figure 3B). However, no inhibition of WI-26

cells was observed (Figure 5A, blue), suggesting that BC-DXI-

843 speciﬁcally reduces the viability of cancer cells. Since DX2

levels in A549 cells were higher than in WI-26 cells, the above

results suggest a relationship between BC-DXI-843 and DX2

levels. Next, we demonstrated that the mechanism of action for

BC-DXI-843 is dependent on DX2 by using a DX2-inducible

cell line. The DX2-induced cell line showed lower cell viability

than control cells after treatment with BC-DXI-843 (Figure

5B), demonstrating that the level of DX2 is critical to the activity

of BC-DXI-843. We further characterized the eﬀect of BC-DXI-

843 on cell viability using a 3D cell culture system. Spheroids

formed with H460 cells decreased in size after treatment with

BC-DXI-843 in a dose-dependent manner, although the

functional concentration was higher than in the 2D cell culture

condition (Figure 5C).²⁵To further test the in vivo eﬃcacy of

BC-DXI-843, we xenografted H460 cells into the backs of mice,

and BC-DXI-843 (50 mg/kg) was intraperitoneally injected

every other day for 15 days. The embedded tumor volume

gradually declined (Figure 6A,B) after BC-DXI-843 admin-

istration, but no changes in body weight were observed (Figure

6D). The weight of the excised tumors after sacriﬁce had

decreased in mice treated with BC-DXI-843 (Figure 6C). These

data suggest that BC-DXI-843 decreases DX2-dependent

cancer cell viability.

Figure 3. BC-DXI-843 is a speciﬁc inhibitor of DX2. (A) DX2 and

AIMP2 levels were measured using nanoluciferase-DX2 and AIMP2,

respectively, after treatment with each of the six compounds (40 μM, 4

h). The experiment was independently repeated three times with error

bars denoting SD. The presented value was the inhibited luciferase

activity upon treatment with each chemicals compared to DMSO as a

control. (B) A549 cells expressing nanoluciferase-DX2 or AIMP2 were

treated with BC-DXI-843 in a dose-dependent manner for 4 h, and the

resulting luminescence was measured. IC₅₀values for the inhibition of

DX2 and AIMP2 were calculated as shown. The experiment was

independently repeated three times with error bars denoting SD.

Table 5. Comparison of the Inhibition Eﬃcacy on DX2 and

AIMP2 Protein Levels and Cell Proliferation with BC-DXI-

a

04, -495, and -843

CONCLUSIONS

■

b

IC₅₀(μM)

EC₅₀(μM)

DX2, a splicing variant of AIMP2, is highly expressed in various

cancers, including histologically small cell lung cancer. There-

fore, inhibiting DX2 with small molecules is a promising

therapeutic treatment for cancers expressing DX2. In this study,

a series of arylsulfonamides was synthesized and evaluated as

potent PPI inhibitors that speciﬁcally interrupt the interaction

between DX2 and HSP70. Structure−activity relationship

studies revealed that the ^L-conﬁguration at the chiral center

and the arylsulfonamide moiety are essential for anticancer

activity. The replacement of ^L-leucine by L-tryptophan and the

incorporation of a substituted arylamine group are critical in

improving antiproliferation eﬃcacy in cancer cells.

compd

DX2

AIMP2

A549

WI-26

BC-DXI-04

BC-DXI-495

BC-DXI-843

40.1

4.20

0.92

>100

40.8

14.2

1.20

>100

a

IC₅₀and EC₅₀indicate 50% inhibition concentration for protein

b

expression and cell viability, respectively. IC₅₀and EC₅₀were

determined by DX2- or AIMP2-nanoluciferase and cell viability assay,

respectively

determined whether BC-DXI-843-mediated inhibition is

speciﬁc to DX2 and HSP70 binding using a nanoluciferase-

based complementation assay. Luminescence generated via

DX2 and HSP70 binding was detected in the absence of BC-

DXI-843, but the signal decreased in a dose-dependent manner

in the presence of BC-DXI-843 (Figure S2B, red). However, a

dose-dependent decline was not observed in another binding

pair, PRKACA and PRKAR2A (Figure S2B, gray), suggesting

that BC-DXI-843 speciﬁcally inhibits DX2 and HSP70 binding.

HSP70 is reported to block Siah1 from interacting with DX2,

resulting in the inhibition of Siah1-mediated ubiquitination.^15,16

Therefore, we evaluated whether BC-DXI-843 could aﬀect the

relationship between HSP70, Siah1, and DX2. Immunoprecipi-

tation of DX2 in the presence of BC-DXI-843 revealed

diminished and enhanced binding of HSP70 and Siah1 to

DX2, respectively (Figure S2C). These results demonstrate that

BC-DXI-843 speciﬁcally inhibits HSP70 and DX2 binding,

which causes ubiquitin-dependent degradation of DX2 by Siah1.

BC-DXI-843 Inhibits DX2-Dependent Cancer Cell

Proliferation. Since DX2 is a signiﬁcant oncogenic pro-

tein,^11,12,17we examined whether BC-DXI-843-mediated

degradation of DX2 could inhibit cancer cell progression.

A549 lung cancer cells and WI-26 normal cell lines were treated

with BC-DXI-843 in a dose-dependent manner, and EC₅₀values

for cell viability were determined. The EC₅₀in A549 cells was

1.20 μM (Figure 5A, red), which was similar to the IC₅₀for

Thus, we identiﬁed a series of potent anticancer compounds.

The most potent compound, BC-DXI-843, exhibited an IC₅₀of

0.92 μM on DX2 with more than 100-fold selectivity over

AIMP2. BC-DXI-843 also showed an EC₅₀value of 1.20 μM on

cancer cell viability but had no eﬀect on normal cells. A docking

study revealed that BC-DXI-843 exhibits favorable binding

characteristics with key residues in a hydrophobic pocket of

AIMP2-DX2, which may interfere with the interaction between

DX2 and HSP70.

The biological activity and mechanism of action of BC-DXI-

843 were analyzed. BC-DXI-843 speciﬁcally decreased

endogenous DX2 protein levels by inducing DX2 degradation

via Siah1, an E3 ligase speciﬁc to DX2. In comparison with BC-

DXI-04 and BC-DXI-495, small molecules previously reported

to decrease DX2 levels, BC-DXI-843 showed approximately 40-

and 5-fold improvements in potency, respectively. BC-DXI-843

speciﬁcally interrupts the interaction between DX2 and HSP70

according to several binding assays. This proves that the binding

of the two proteins is signiﬁcant to DX2 stabilization.

Furthermore, BC-DXI-843 signiﬁcantly suppressed the pro-

gression of cancer cells in vitro and in vivo in a DX2-dependent

manner, which emphasizes the tumor-promoting function of

DX2. The proliferation of normal lung cells and the bodyweight

of mice were not aﬀected after treatment with BC-DXI-843,

J

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

Figure 4. Determining the binding mode of BC-DXI-843 to DX2. (A) Fluorescence-based binding titration measurement of BC-DXI-843 to DX2.

Protein samples were excited at 280 nm, and the decrease in ﬂuorescence emission upon binding was measured at 335 nm. (B) Docking pose with the

binding site of our in-house homology model of DX2 and BC-DXI-843 (red). (C) Close-up view of BC-DXI-843 with the relevant interaction

residues (D52, T82) and distances between them and BC-DXI-843’s closest atoms. BC-DXI-843 was also found to be docked close to the residues in

the hydrophobic pocket. The structure of DX2-GST was obtained from PDB code 5A34.

compound purity was assessed using either a gradient of 25% B to 100%

B in 30 min (method A) or a gradient of 5% B to 100% B in 30 min

(method B). The purity of all biologically evaluated compounds was

≥95% in method A or in method B. Melting points were measured on a

Fisherbrand digital melting point apparatus.

implying that there are no signiﬁcant side eﬀects associated with

BC-DXI-843. Thus, this study identiﬁed BC-DXI-843 as a

potential lead for the development of novel therapeutics that

could target DX2 and combat lung cancer, especially SCLC.

General Procedure for the Preparation of Sulfonamide.

Arylsulfonyl chloride (1 equiv) was added to a stirred solution of amino

acid (1 equiv) in 1 M aqueous sodium hydroxide solution (20

volumes), and the mixture was stirred at rt for 8 h. The reaction mass

was extracted with n-hexane, and the aqueous layer was acidiﬁed with 1

N HCl up to pH 4 at 0 °C. The resulting white precipitate was ﬁltered,

washed with cold water, and collected.

EXPERIMENTAL SECTION

■

Chemistry. General Procedures. All commercial chemicals were

reagent-grade and were used without further puriﬁcation. Solvents were

dried with standard procedures. All reactions were carried out under an

atmosphere of dried argon in ﬂame-dried glassware. The proton nuclear

magnetic resonance (¹H NMR) spectra were determined on a Varian

400 MHz spectrometer (Varian Medical Systems, Inc., Palo Alto, CA,

USA). ¹³C NMR spectra were recorded on a Varian 100 MHz

spectrometer. The chemical shifts are provided in parts per million

(ppm) downﬁeld with coupling constants in hertz (Hz). The mass

spectra were recorded using high-resolution mass spectrometry

(HRMS) (electron ionization MS) on a JMS-700 mass spectrometer

(Jeol, Japan) or by HRMS (electrospray ionization MS) on a G2 QTOF

mass spectrometer. The products from all reactions were puriﬁed by

ﬂash column chromatography using silica gel 60 (230−400 mesh

Kieselgel 60). Additionally, thin-layer chromatography on 0.25 mm

silica plates (E. Merck; silica gel 60 F254) was used to monitor

reactions. Final product purity was determined by reversed phase high-

pressure liquid chromatography (RP-HPLC) using a Waters Corp.

HPLC system equipped with an ultraviolet (UV) detector set at 254

nm. The mobile phases used were (A) H₂O containing 0.05% TFA and

(B) CH₃CN. HPLC employed a YMC Hydrosphere C18 (HS-302)

column (5 μm particle size, 12 nm pore size) that was 4.6 mm in

diameter ×150 mm in size with a ﬂow rate of 1.0 mL/min. The

(S)-4-Methyl-2-(4-methylphenylsulfonamido)pentanoic

Acid (4a). The title compound was prepared from 3a and p-

toluenesulfonyl chloride according to the general procedure as a

colorless solid (1.12 g, 52%). ¹H NMR (400 MHz, DMSO-d₆) δ 12.72

(brs, 1H), 8.03 (d, J = 8.4 Hz, 1H), 7.64 (d, J = 8.0 Hz, 2H), 7.35 (d, J =

8.0 Hz, 2H), 3.64−3.40 (m, 1H), 2.36 (s, 3H), 1.55−1.45 (m, 1H),

1.40−1.25 (m, 2H), 0.79 (d, J = 6.4 Hz, 3H), 0.68 (d, J = 6.4 Hz, 3H).

HRMS (ESI): [M + H]⁺C₁₃H₂₀NO₄S calcd 286.1113, found 286.1113.

(R)-4-Methyl-2-(4-methylphenylsulfonamido)pentanoic

Acid (4b). The title compound was prepared from 3b and p-

toluenesulfonyl chloride according to the general procedure as a

colorless solid (1.26 g, 58%). ¹H NMR (400 MHz, DMSO-d₆) δ 12.72

(brs, 1H), 8.03 (d, J = 8.4 Hz, 1H), 7.64 (d, J = 8.0 Hz, 2H), 7.35 (d, J =

8.0 Hz, 2H), 3.64−3.40 (m, 1H), 2.36 (s, 3H), 1.55−1.45 (m, 1H),

1.40−1.25 (m, 2H), 0.79 (d, J = 6.4 Hz, 3H), 0.68 (d, J = 6.4 Hz, 3H).

HRMS (ESI): [M + H]⁺C₁₃H₂₀NO₄S calcd 286.1113, found 286.1107.

(S)-4-Methyl-2-(phenylsulfonamido)pentanoic Acid (13a).

The title compound was prepared from 3a and benzenesulfonyl

K

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

Figure 6. In vivo antitumor eﬀect of BC-DXI-843. (A−D) Mice (n = 4)

subcutaneously injected with H460 cells were intraperitoneally

administered BC-DXI-843 (50 mg/kg) every other day for 15 days.

The sizes of the embedded tumors (B) and body weights (D) were

measured throughout the experiment. After sacriﬁce, the weights of the

harvested tumors were determined (C) and photos of whole-body

bearing the tumor and the excised tumors were taken (A).

Figure 5. BC-DXI-843 suppresses cancer cell proliferation in a DX2-

dependent manner. (A) BC-DXI-843-speciﬁc inhibition of cancer cell

proliferation. A549 cancer cells and WI-26 normal cells were treated

with BC-DXI-843 as indicated for 72 h, and cell viability was

determined with an MTT assay. The EC₅₀, 50% inhibiting

concentration of cell viability, is shown on the right. N.D. = not

determined. (B) Suppression of DX2-mediated cancer cell proliferation

by BC-DXI-843. Empty vector (EV)- or DX2-inducible A549 cells

(Ind-EV and Ind-DX2, respectively) were treated with doxycycline

(Dox) and BC-DXI-843 (843) as indicated, and cell viability was

determined in the same manner as described above. (C) Inhibitory

eﬀect of BC-DXI-843 on cancer cell spheroids formed in a 3D culture

system. Several doses of BC-DXI-843 were added to H460 spheroids

over the course of 72 h. Cell toxicity was determined by a CellTiter-Glo

3D assay, and representative photos of the spheroids are shown. (A−C)

All experiments were independently repeated three times with error

bars denoting SD.

methoxybenzenesulfonyl chloride according to the general procedure

as a colorless solid (1.15 g, 48%). ¹H NMR (400 MHz, DMSO-d₆) δ

12.22 (brs, 1H), 7.97 (d, J = 5.6 Hz, 1H), 7.74 (d, J = 8.0 Hz, 2H), 6.96

(d, J = 8.0 Hz, 2H), 3.82 (s, 3H), 3.63−3.59 (m, 1H), 1.58−1.53 (m,

1H), 1.39−1.34 (m, 2H), 0.80 (d, J = 6.4 Hz, 3H), 0.69 (d, J = 6.4 Hz,

3H). HRMS (ESI): [M + H]⁺C₁₃H₂₀NO₅S calcd 302.1062, found

302.1055.

(S)-2-(Biphenyl-4-ylsulfonamido)-4-methylpentanoic Acid

(13e). The title compound was prepared from 3a and 4-phenyl-

benzenesulfonyl chloride according to the general procedure as a pink

solid (0.37 g, 14%). ¹H NMR (400 MHz, CDCl₃) δ 7.88 (d, J = 8.2 Hz,

2H), 7.71−7.65 (m, 2H), 7.63−7.57 (m, 2H), 7.53−7.40 (m, 3H), 4.97

(d, J = 9.3 Hz, 1H), 4.02−3.96 (m, 1H), 1.85−1.73 (m, 1H), 1.56−1.40

(m, 2H), 0.89 (d, J = 6.6 Hz, 3H), 0.85 (d, J = 6.6 Hz, 3H). HRMS

(ESI): [M + H]⁺C₁₈H₂₂NO₄S calcd 348.1270, found 348.1270.

(S)-4-Methyl-2-(4-nitrophenylsulfonamido)pentanoic Acid

(13f). The title compound was prepared from 3a and 4-nitro-

benzenesulfonyl chloride according to the general procedure as a

chloride according to the general procedure as a colorless solid (0.68 g,

33%). ¹H NMR (400 MHz, CDCl₃) δ 7.86 (d, J = 8.0 Hz, 2H), 7.58 (t, J

= 7.2 Hz, 1H), 7.50 (t, J = 7.6 Hz, 2H), 5.10 (d, J = 1.2 Hz, 1H), 3.98−

3.92 (m, 1H), 1.76−1.74 (m, 1H), 1.54−1.51 (m, 2H), 0.90 (d, J = 6.8

Hz, 3H), 0.83 (d, J = 6.8 Hz, 3H). HRMS (ESI): [M + H]⁺

C₁₂H₁₈NO₄S calcd 272.0957, found 272.0944.

(S)-2-(4-Fluorophenylsulfonamido)-4-methylpentanoic Acid

(13b). The title compound was prepared from 3a and 4-

ﬂuorobenzenesulfonyl chloride according to the general procedure as

an oﬀ white solid (0.95 g, 43%). ¹H NMR (400 MHz, CDCl₃) δ 7.89−

7.82 (m, 2H), 7.16−7.09 (m, 2H), 5.05 (d, J = 1.2 Hz, 1H), 3.98−3.92

(m, 1H), 1.82−1.75 (m, 1H), 1.59−1.47 (m, 2H), 0.92 (d, J = 5.2 Hz,

3H), 0.87 (d, J = 5.2 Hz, 3H). HRMS (ESI): [M + H]⁺C₁₂H₁₇FNO₄S

calcd 290.0862, found 290.0851.

1

light yellow solid (0.43 g, 18%). H NMR (400 MHz, DMSO-d₆) δ

12.67 (brs, 1H), 8.5 (s, 1H), 8.40 (d, J = 8.0 Hz, 2H), 8.01 (d, J = 8.0 Hz,

2H), 3.78−3.34 (m, 1H), 1.61−1.58 (m, 1H), 1.45−1.41 (m, 2H), 0.84

(d, J = 6.4 Hz, 3H), 0.75 (d, J = 6.4 Hz, 3H). HRMS (ESI): [M + H]⁺

C₁₂H₁₇N₂O₆S calcd 317.0807, found 317.0808.

2-(4-Methylphenylsulfonamido)acetic Acid (16a). The title

compound was prepared from glycine (15a) and p-toluenesulfonyl

chloride according to the general procedure as a colorless solid (1.03 g,

34%). ¹H NMR (400 MHz, DMSO-d₆) δ 12.72 (brs, 1H), 7.94 (t, J =

6.0 Hz, 1H), 7.67 (d, J = 8.4 Hz, 2H), 7.37 (d, J = 8.4 Hz, 2H), 3.54 (d, J

= 6.0 Hz, 2H), 2.35 (s, 3H). HRMS (ESI): [M + H]⁺C₉H₁₂NO₄S calcd

230.0487, found 230.0486.

(S)-2-(4-Methylphenylsulfonamido)propanoic Acid (16b).

The title compound was prepared from ^L-alanine (15b) and p-

toluenesulfonyl chloride according to the general procedure as a

colorless solid (1.50 g, 55%). ¹H NMR (400 MHz, DMSO-d₆) δ 12.62

(brs, 1H), 8.04 (d, J = 8.4 Hz, 1H) (s, 1H), 7.66 (d, J = 8.0 Hz, 2H), 7.36

(d, J = 8.0 Hz, 2H), 3.76−3.68 (m, 1H), 2.37 (s, 3H), 1.12 (d, J = 7.2

Hz, 3H). HRMS (ESI): [M + H]⁺C₁₀H₁₄NO₄S calcd 244.0644, found

244.0638.

(S)-2-(4-Bromophenylsulfonamido)-4-methylpentanoic

Acid (13c). The title compound was prepared from 3a and 4-

bromobenzenesulfonyl chloride according to the general procedure as a

light yellow solid (1.57 g, 59%). ¹H NMR (400 MHz, CDCl₃) δ 7.72 (d,

J = 8.8 Hz, 2H), 7.63 (d, J = 8.8 Hz, 2H), 5.10 (d, J = 1.2 Hz, 1H), 4.01−

3.95 (m, 1H), 1.83−1.76 (m, 1H), 1.61−1.53 (m, 2H), 0.91 (d, J = 6.8

Hz, 3H), 0.88 (d, J = 6.4 Hz, 3H). HRMS (ESI): [M + H]⁺

C₁₂H₁₇BrNO₄S calcd 350.0062, found 350.0055.

(S)-2-(4-Methoxyphenylsulfonamido)-4-methylpentanoic

Acid (13d). The title compound was prepared from 3a and 4-

(S)-3-Hydroxy-2-(4-methylphenylsulfonamido)propanoic

Acid (16c). The title compound was prepared from ^L-serine (15c) and

L

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

p-toluenesulfonyl chloride according to the general procedure as a

colorless solid (0.57 g, 23%). ¹H NMR (400 MHz, DMSO-d₆) δ 12.60

(s, 1H), 7.89 (d, J = 8.4 Hz, 1H), 7.67 (d, J = 8.4 Hz, 2H), 7.33 (d, J =

8.4 Hz, 2H), 4.95 (brs, 1H), 3.73−3.68 (m, 1H), 3.50−3.40 (m, 2H),

2.37 (s, 3H). HRMS (ESI): [M + H]⁺C₁₀H₁₄NO₅S calcd 260.0593,

found 260.0585.

(S)-3-Methyl-2-(4-methylphenylsulfonamido)butanoic Acid

(16d). The title compound was prepared from ^L-valine (15d) and p-

toluenesulfonyl chloride according to the general procedure as a

colorless solid (0.58 g, 25%). ¹H NMR (400 MHz, DMSO-d₆) δ 12.55

(s, 1H), 7.91 (d, J = 9.6 Hz, 1H), 7.65 (d, J = 8.4 Hz, 2H), 7.34 (d, J =

8.4 Hz, 2H), 3.50−3.44 (m, 1H), 2.34 (s, 3H), 1.92−1.85 (m, 1H), 0.81

(d, J = 6.8 Hz, 3H), 077 (d, J = 6.8 Hz, 3H). HRMS (ESI): [M + H]⁺

C₁₂H₁₈NO₄S calcd 272.0957, found 272.0950.

1H), 7.57 (d, J = 7.6 Hz, 2H), 7.35 (t, J = 8.0 Hz, 1H), 7.29 (t, J = 8.0

Hz, 1H), 7.29 (d, J = 8.0 Hz, 2H), 7.03 (d, J = 8.0 Hz, 2H), 6.89 (t, J =

7.6 Hz, 1H), 3.83 (q, J = 7.6 Hz, 1H), 3.05 (dd, J = 14.5, 6.7 Hz, 1H),

2.89 (dd, J = 14.5, 7.8 Hz, 1H), 2.43 (s, 3H). HRMS (ESI): [M + H]⁺

C₁₈H₁₉N₂O₄S calcd 359.1066, found 359.1066.

(S)-3-(1H-Indol-3-yl)-2-(3-methylphenylsulfonamido)-

propanoic Acid (18b). The title compound was prepared from ^L-

tryptophan (15k) and m-toluenesulfonyl chloride according to the

general procedure as a light brown solid (0.750 g, 43%). ¹H NMR (400

MHz, DMSO-d₆) δ 12.61 (brs, 1 H), 10.79 (s, 1H), 8.19 (d, J = 8.4 Hz,

1H), 7.39 (s, 2H), 7.30−7.25 (m, 4H), 7.05−7.01 (m, 2H), 6.92 (t, J =

8.0 Hz, 1H), 3.90 (q, J = 7.6 Hz, 1H), 3.03 (dd, J = 14.5, 6.7 Hz, 1H),

2.82 (dd, J = 14.5, 7.8 Hz, 1H), 2.26 (s, 3H). HRMS (ESI): [M + H]⁺

C₁₈H₁₉N₂O₄S calcd 359.1066, found 359.1066.

(S)-2-(4-Bromophenylsulfonamido)-3-(1H-indol-3-yl)-

propanoic Acid (18c). The title compound was prepared from ^L-

tryptophan (15k) and 4-bromobenzenesulfonyl chloride according to

the general procedure as a colorless solid (0.82 g, 54%). ¹H NMR (400

MHz, DMSO-d₆) δ 12.61 (brs, 1 H), 10.78 (s, 1H), 8.38 (d, J = 8.4 Hz,

1H), 7.51 (d, J = 8.0 Hz, 2H), 7.40 (t, J = 8.0 Hz, 2H), 7.31 (d, J = 7.2

Hz, 1H), 7.29 (d, J = 8.0 Hz, 1H), 7.07 (s, 1H), 7.03 (d, J = 8.0 Hz, 1H),

6.92 (t, J = 7.6 Hz, 1H), 3.92 (q, J = 7.6 Hz, 1H), 3.05 (dd, J = 14.5, 6.7

Hz, 1H), 2.89 (dd, J = 14.5, 7.8 Hz, 1H). HRMS (ESI): [M + H]⁺

C₁₇H₁₆BrN₂O₄S calcd 423.0014, found 424.0009.

(2S,3S)-3-Hydroxy-2-(4-methylphenylsulfonamido)butanoic

Acid (16e). The title compound was prepared from ^L-(−)-threonine

(15e) and p-toluenesulfonyl chloride according to the general

1

procedure as a colorless solid (0.94 g, 41%). H NMR (400 MHz,

DMSO-d₆) δ 7.67 (d, J = 8.0 Hz, 2H), 7.51 (d, J = 9.2 Hz, 1H), 7.33 (d, J

= 8.0 Hz, 2H), 3.96−3.93 (m, 1H), 3.63−3.61 (m, 1H), 2.28 (s, 3H),

1.00 (d, J = 6.4 Hz, 3H). HRMS (ESI); [M + H]⁺C₁₁H₁₆NO₅S calcd

274.0749, found 274.0749.

(S)-2-(4-Methylphenylsulfonamido)-4-(methylthio)butanoic

Acid (16f). The title compound was prepared from ^L-methionine (15f)

and p-toluenesulfonyl chloride according to the general procedure as a

colorless solid (0.26 g, 13%). ¹H NMR (400 MHz, DMSO-d₆) δ 8.08

(d, J = 8.0 Hz, 1H), 7.65 (d, J = 8.4 Hz, 2H), 7.35 (d, J = 8.4 Hz, 2H),

3.81−3.79 (m, 1H), 2.44−2.24 (m, 5H), 1.91 (s, 3H), 1.86−1.64 (m,

2H). HRMS (ESI): [M + H]⁺C₁₂H₁₈NO₄S₂calcd 304.0677, found

304.0677.

(S)-Benzyl 4-Methyl-2-(4-methylbenzamido)pentanoate

(11). The title compound was prepared from ^L-leucine benzylester

(10) and p-toluenebenzoic acid following general procedure for amide

1

coupling reaction as a colorless solid (0.76 g, 94%). H NMR (400

MHz, CDCl₃) δ 7.68 (d, J = 8.0 Hz, 2H), 7.39−7.32 (m, 5H), 7.22 (d, J

= 8.4 Hz, 2H), 6.51 (d, J = 7.6 Hz, 1H), 5.22−5.16(m, 2H), 4.93−4.87

(m, 1H), 2.39 (s, 3H), 1.80−1.62 (m, 3H), 0.97 (d, J = 6.0 Hz, 3H),

0.95 (d, J = 6.0 Hz, 3H). HRMS (ESI): [M + H]⁺C₂₁H₂₆NO₃S calcd

340.1913, found 340.1913.

(S)-4-(Benzyloxy)-2-(4-methylphenylsulfonamido)-4-oxobu-

tanoic Acid (16g). The title compound was prepared from 5-benzyl ^L-

aspartate (15g) and p-toluenesulfonyl chloride according to the general

1

procedure as a colorless solid (1.10 g, 66%). H NMR (400 MHz,

General Procedure for Amide Coupling. EDCI·HCl (1.1 equiv)

and HOBt (1.1 equiv) were added to a stirred solution of carboxylic

acid (1 equiv), amine (1 equiv), and TEA (2.5 equiv) in DCM at room

temperature, and the reaction mixture was stirred at the same

temperature for 18 h. The solvent was evaporated, and the residue

was treated with saturated sodium bicarbonate and extracted with

DCM. The combined organic layer was then washed with brine, dried

over magnesium sulfate, ﬁltered, and concentrated under reduced

pressure. The residue was puriﬁed through ﬂash column chromatog-

raphy (hexane/ethyl acetate).

CDCl₃) δ 7.73 (d, J = 8.4 Hz, 2H), 7.39−7.25 (m, 7H), 5.64 (d, J = 8.0

Hz, 1H), 5.04 (s, 2H), 4.21−4.17 (m, 1H), 3.04 (dd, J = 17.4, 4.2 Hz,

1H), 2.87 (dd, J = 17.6, 5.2 Hz, 1H), 2.39 (s, 3H). HRMS (ESI): [M +

H]⁺C₁₈H₂₀NO₆S calcd 378.1011, found378.0995.

(S)-5-(Benzyloxy)-2-(4-methylphenylsulfonamido)-5-oxo-

pentanoic Acid (16h). The title compound was prepared from 5-

benzyl ^L-glutamate (15h) and p-toluenesulfonyl chloride according to

the general procedure as a colorless solid (1.15 g, 70%). ¹H NMR (400

MHz, CDCl₃) δ 7.68 (d, J = 8.4 Hz, 2H), 7.36−7.30 (m, 5H), 7.22 (d, J

= 8.4 Hz, 2H), 5.67 (d, J = 9.2 Hz, 1H), 5.07 (s, 2H), 4.01−3.96 (m,

1H), 2.51−2.38 (m, 2H), 2.34 (s, 3H), 2.17−2.12 (m, 1H), 1.93−1.88

(m, 1H). HRMS (ESI): [M + H]⁺C₁₉H₂₂NO₆S calcd 392.1168, found

392.1168.

(S)-4-Methyl-N-(4-methyl-1-oxo-1-(1,4,7-trioxa-10-azacyclo-

dodecan-10-yl)pentan-2-yl)benzenesulfonamide (1a). The title

compound was prepared from 4a and 1,4,7-trioxa-10-azacyclododecane

according to the general procedure as a colorless solid (0.14 g, 31%).

(S)-2-(4-Methylphenylsulfonamido)-3-phenylpropanoic

Acid (16i). The title compound was prepared from ^L-phenylalanine

(15i) and p-toluenesulfonyl chloride according to the general

1

Mp: 78−80 °C. H NMR (400 MHz, CDCl₃) δ 7.71 (d, J = 8.0 Hz,

2H), 7.27 (d, J = 8.0 Hz, 2H), 5.59 (d, J = 10.0 Hz, 1H), 4.25−4.19 (m,

1H), 3.78−3.71 (m, 2H), 3.69−3.37 (m, 11H), 3.22−3.12 (m, 3H),

2.40 (s, 3H), 1.98−1.91 (m, 1H), 1.49−1.33 (m, 2H), 0.91 (d, J = 4.4

Hz, 3H) 0.89 (d, J = 4.4 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃) δ

172.37, 143.28, 137.20, 129.43, 127.30, 71.44, 70.49, 69.80, 69.68,

69.22, 68.93, 51.64, 49.99, 48.96, 42.69, 24.22, 23.52, 21.51, 21.05,

20.93. HRMS (ESI): [M + H]⁺C₂₁H₃₅N₂O₆S calcd 443.2216, found

443.2216; purity ≥99.29% (as determined by RP-HPLC, method A, t_R

= 13.35 min).

1

procedure as a colorless solid (0.60 g, 31%). H NMR (400 MHz,

DMSO-d₆) δ 12.72 (s, 1H), 8.18 (d, J = 9.2 Hz, 1H), 7.44 (d, J = 8.4 Hz,

2H), 7.21−7.16 (m, 5H), 7.10−7.08 (m, 2H), 3.85−3.76 (m, 1H),

2.94−2.89 (m, 1H), 2.72−2.67 (m, 1H), 2.34 (s, 3H). HRMS (ESI):

[M + H]⁺C₁₆H₁₈NO₄S calcd 320.0957, found 320.0949.

(S)-2-(4-Methylphenylsulfonamido)-3-(4-(tosyloxy)phenyl)-

propanoic Acid (16j). The title compound was prepared from ^L-

tyrosine (15j) and p-toluenesulfonyl chloride according to the general

1

procedure as a colorless solid (0.81 g, 30%). H NMR (400 MHz,

(R)-4-Methyl-N-(4-methyl-1-oxo-1-(1,4,7-trioxa-10-azacy-

clododecan-10-yl)pentan-2-yl)benzenesulfonamide (1b). The

title compound was prepared from 4b and 1,4,7-trioxa-10-azacyclodo-

decane according to the general procedure as a colorless solid (0.09 g,

21%). Mp: 69−71 °C. ¹H NMR (400 MHz, CDCl₃) δ 7.71 (d, J = 7.6

Hz, 2H), 7.27 (d, J = 7.6 Hz, 2H), 5.59 (d, J = 9.6 Hz, 1H), 4.25−4.19

(m, 1H), 3.78−3.7 (m, 2H), 3.61−3.39 (m, 11H), 3.23−3.12 (m, 3H),

2.40 (s, 3H), 1.97−1.90 (m, 1H), 1.49−1.33 (m, 2H), 0.92 (d, J = 4.2

Hz, 3H), 0.89 (d, J = 5.6 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃) δ

172.33, 143.25, 137.19, 129.39, 127.26, 71.41, 70.46, 69.77, 69.66,

69.18, 68.89, 51.60, 49.96, 48.93, 42.64, 24.18, 23.49, 21.49, 20.90.

HRMS (ESI): [M + H]⁺C₂₁H₃₅N₂O₆S calcd 443.2216, found

DMSO-d₆) δ 8.17 (d, J = 9.2 Hz, 1H), 7.69 (d, J = 8.4 Hz, 2H), 7.48−

7.41 (m, 4H), 7.21 (d, J = 8.0 Hz, 2H), 7.09 (d, J = 8.8 Hz, 1H), 6.81 (d,

J = 8.8 Hz, 2H), 3.83−3.77 (m, 1H), 3.07−3.03 (m, 1H), 2.69−2.63

(m, 1H), 2.33 (s, 3H), 2.28 (s, 3H). HRMS (ESI): [M + H]⁺

C₂₃H₂₄NO₇S₂calcd 490.0994, found 490.0992.

(S)-3-(1H-Indol-3-yl)-2-(4-methylphenylsulfonamido)-

propanoic Acid (16k). See ref 16.

(S)-3-(1H-Indol-3-yl)-2-(2-methylphenylsulfonamido)-

propanoic Acid (18a). The title compound was prepared from ^L-

tryptophan (15k) and o-toluenesulfonyl chloride according to the

general procedure as a light brown solid (0.70 g, 40%). ¹H NMR (400

MHz, DMSO-d₆) δ 12.61 (brs, 1 H), 10.78 (s, 1H), 8.26 (d, J = 8.4 Hz,

M

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

443.2208; purity ≥98.18% (as determined by RP-HPLC, method A, t_R

= 13.33 min).

was prepared from 4a and 4-(4-methylpiperidin-1-yl)aniline (8d)

according to the general procedure as a colorless solid (0.11 g, 72%).

Mp: 184−186 °C. ¹H NMR (400 MHz, CDCl₃) δ 7.76 (d, J = 8.0 Hz,

2H), 7.51 (s, 1H), 7.27 (d, J = 8.0 Hz, 2H), 7.17 (d, J = 8.8 Hz, 2H),

6.85 (d, J = 8.8 Hz, 2H), 4.98 (d, J = 8.0 Hz, 1H), 3.77−3.72 (m, 1H),

3.59−3.56 (m, 2H), 2.65−2.58 (m, 2H), 2.35 (s, 3H), 1.73−1.70 (m,

2H), 1.62−1.56 (m, 2H), 1.50−1.45 (m, 2H), 1.37−1.25 (m, 2H), 0.97

(d, J = 6.4 Hz, 3H), 0.84 (d, J = 6.0 Hz, 3H), 0.71 (d, J = 5.6 Hz, 3H);

¹³C NMR (100 MHz, CDCl₃) δ 169.10, 149.23, 144.04, 136.22, 129.80,

128.83, 127.32, 121.44, 116.76, 56.15, 50.32, 42.18, 34.02, 30.61, 24.39,

22.91, 21.87, 21.51, 21.35. HRMS (ESI): [M + H]⁺C₂₅H₃₆N₃O₃S calcd

458.2477, found 458.2477; purity ≥99.32% (as determined by RP-

HPLC, method B, t_R= 19.59 min).

(S)-4-Methyl-2-(4-methylphenylsulfonamido)-N-(4-thiomor-

pholine-1,1-dioxophenyl)pentanamide (9e). The title compound

was prepared from 4a and 4-(4-aminophenyl)thiomorpholine 1,1-

dioxide (8e) according to the general procedure as a colorless solid

(0.12 g, 70%). Mp: 195−197 °C. ¹H NMR (400 MHz, CDCl₃) δ 7.90

(s, 1H), 7.77 (d, J = 8.0 Hz, 2H), 7.33 (d, J = 8.8 Hz, 2H), 7.28 (d, J =

8.0 Hz, 2H), 6.86 (d, J = 8.8 Hz, 2H), 4.97 (d, J = 6.8 Hz, 1H), 3.82−

3.76 (m, 5H), 3.10 (t, J = 5.2 Hz, 4H), 2.37 (s, 3H), 1.67−1.64(m, 1H),

1.55−1.45 (m, 2H), 0.84 (d, J = 6.4 Hz, 3H), 0.65 (d, J = 6.4 Hz, 3H);

¹³C NMR (100 MHz, CDCl₃) δ 169.51, 144.80, 144.19, 136.02, 130.78,

129.85, 127.36, 121.86, 117.00, 56.12, 50.53, 48.10, 41.93, 24.40, 22.89,

21.54, 21.21. HRMS (ESI): [M + H]⁺C₂₃H₃₂N₃O₅S₂calcd 494.1783,

found 494.1783; purity ≥99.99% (as determined by RP-HPLC,

method A, t_R= 13.21 min).

(S)-4-Methyl-N-(4-methyl-1-morpholino-1-oxopentan-2-yl)-

benzenesulfonamide (5a). The title compound was prepared from

4a and morpholine according to the general procedure as a colorless

solid (0.09 g, 74%). Mp: 162−164 °C. ¹H NMR (400 MHz, CDCl₃) δ

7.70 (d, J = 7.6 Hz, 2H), 7.29 (d, J = 7.6 Hz, 2H), 5.60 (d, J = 9.6 Hz,

1H), 4.04−4.01 (m, 1H), 3.61−3.51 (m, 2H), 3.41−3.36 (m, 1H),

3.31−3.14 (m, 5H), 2.42 (s, 3H), 2.00−1.93 (m, 1H), 1.50−1.43 (m,

1H), 1.17−1.11 (m, 1H), 0.95 (d, J = 6.8 Hz, 3H), 0.92 (d, J = 6.8 Hz,

3H); ¹³C NMR (100 MHz, CDCl₃) δ 169.91, 143.56, 136.56, 129.46,

127.53, 66.36, 66.04, 51.04, 45.41, 42.55, 42.25, 24.07, 23.27, 21.50,

21.11. HRMS (ESI): [M + H]⁺C₁₇H₂₇N₂O₄S calcd 355.1692, found

355.1692; purity ≥98.57% (as determined by RP-HPLC, method A, t_R

= 12.34 min).

(R)-4-Methyl-N-(4-methyl-1-morpholino-1-oxopentan-2-yl)-

benzenesulfonamide (5b). The title compound was prepared from

4b and morpholine according to the general procedure as a colorless

solid (0.10 g, 91%). Mp: 163−165 °C. ¹H NMR (400 MHz, CDCl₃) δ

7.70 (d, J = 7.6 Hz, 2H), 7.29 (d, J = 7.6 Hz, 2H), 5.61 (d, J = 9.6 Hz,

1H), 4.06−4.01 (m, 1H), 3.60−3.50 (m, 2H), 3.41−3.36 (m, 1H),

3.31−3.14 (m, 5H), 2.42 (s, 3H), 2.00−1.93 (m, 1H), 1.50−1.43 (m,

1H), 1.17−1.11 (m, 1H), 0.95 (d, J = 6.8 Hz, 3H), 0.92 (d, J = 6.8 Hz,

3H); ¹³C NMR (100 MHz, CDCl₃) δ 169.90, 143.55, 136.57, 129.45,

127.52, 66.39, 66.04, 51.02, 45.41, 42.53, 42.24, 24.06, 23.26, 21.50,

21.11. HRMS (ESI): [M + H]⁺C₁₇H₂₇N₂O₄S calcd 355.1692, found

355.1692; purity ≥97.81% (as determined by RP-HPLC, method A, t_R

= 12.35 min).

(S)-4-Methyl-N-(4-methyl-1-(4-morpholinophenylamino)-1-

oxopentan-2-yl)benzamide (12). Palladium charcoal was added to

the solution of 11 in methanol, and the reaction solution was stirred at

room temperature under H₂pressure for 3 h. After deprotection of the

benzyl group from the starting material indicated by TLC, the reaction

mass was ﬁltered through Celite and concentrated. The residue was

used without further puriﬁcation. The title compound was prepared

from the above acid and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.06 g, 24% over 2 steps). Mp:

208−210 °C. ¹H NMR (400 MHz, CDCl₃) δ 8.73 (s, 1H), 7.69 (d, J =

8.0 Hz, 2H), 7.42 (d, J = 8.0 Hz, 2H), 7.22 (d, J = 8.8 Hz, 2H), 6.84−

6.80 (m, 3H) 4.90−4.86 (m, 1H), 3.84 (t, J = 4.8 Hz, 4H), 3.08 (t, J =

4.8 Hz, 4H), 2.39 (s, 3H), 1.90−1.88 (m, 1H), 1.86−1.71 (m, 2H), 0.97

(d, J = 6.4 Hz, 3H), 0.90 (d, J = 6.4 Hz, 3H); ¹³C NMR (100 MHz,

CDCl₃) δ 170.73, 167.78, 140.09, 142.19, 131.08, 130.95, 129.19,

127.23, 116.18, 66.87, 53.05, 49.79, 41.41, 24.98, 22.93, 22.27, 21.44.

HRMS (ESI): [M + H]⁺C₂₄H₃₂N₃O₃calcd 410.2444, found 410.2439;

purity ≥99.74% (as determined by RP-HPLC, method A, t_R= 11.43

min).

( S ) - 4 - M e t h y l - N - ( 4 - m o r p h o l i n o p h e n y l ) - 2 -

(phenylsulfonamido)pentanamide (14a). The title compound was

prepared from 13a and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.11 g, 69%). Mp: 217−219 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.89 (d, J = 7.6 Hz, 2H), 7.75 (s, 1H),

7.56 (t, J = 7.6 Hz, 1H), 7.49 (t, J = 7.6 Hz, 2H), 7.24 (d, J = 8.8 Hz,

2H), 6.83 (d, J = 8.8 Hz, 2H), 5.07 (d, J = 7.2 Hz, 1H), 3.85 (t, J = 4.8

Hz, 4H), 3.81−3.77 (m, 1H), 3.10 (t, J = 4.8 Hz, 4H), 1.66−1.46 (m,

3H), 0.85 (d, J = 6.0 Hz, 3H), 0.69 (d, J = 6.0 Hz, 3H); ¹³C NMR (100

MHz, CDCl₃) δ 169.09, 147.56, 138.16, 132.15, 128.58, 128.25,

126.26, 120.56, 11.05, 65.83, 55.11, 48.60, 41.12, 28.68, 23.39, 21.89,

20.26. HRMS (ESI): [M + H]⁺C₂₂H₃₀N₃O₄S calcd 432.1957, found

432.1956; purity ≥98.65% (as determined by RP-HPLC, method A, t_R

= 10.31 min).

(S)-4-Methyl-2-(4-methylphenylsulfonamido)-N-(4-

morpholinophenyl)pentanamide (9a). The title compound was

prepared from 4a and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.04 g, 25%). Mp: 176−178 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.76 (d, J = 8.0 Hz, 2H), 7.69 (s, 1H),

7.28−7.16 (m, 4H), 6.83 (d, J = 8.8 Hz, 2H), 5.03 (d, J = 7.6 Hz, 1H),

3.85 (t, J = 4.8 Hz, 4H), 3.78−3.73 (m, 1H), 3.08 (t, J = 4.8 Hz, 4H),

2.33 (s, 3H), 1.70−1.60 (m, 2H), 1.52−1.46 (m, 1H), 0.86 (d, J = 6.0

Hz, 3H), 0.70 (d, J = 5.6 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃) δ

169.30, 148.49, 144.06, 136.20, 129.80, 129.75, 127.32, 121.52, 116.03,

66.84, 56.16, 49.64, 42.08, 24.39, 22.89, 21.51, 21.50, 21.31. HRMS

(ESI): [M + H]⁺C₂₃H₃₂N₃O₄S calcd 446.2114, found 446.2115; purity

≥99.99% (as determined by RP-HPLC, method A, t_R= 11.48 min).

(S)-4-Methyl-2-(4-methylphenylsulfonamido)-N-(4-(pyrroli-

din-1-yl)phenyl)pentanamide (9b). The title compound was

prepared from 4a and 4-(pyrrolidin-1-yl)aniline (8b) according to

the general procedure as a colorless solid (0.04 g, 24%). Mp: 183−185

°C. ¹H NMR (400 MHz, CDCl₃) δ 7.75 (d, J = 7.6 Hz, 2H), 7.42 (s,

1H), 7.27 (d, J = 8.0 Hz, 2H), 7.08 (d, J = 8.8 Hz, 2H), 6.45 (d, J = 8.8

Hz, 2H), 5.09 (d, J = 7.6 Hz, 1H), 3.78−3.73 (m, 1H), 3.24 (t, J = 6.4

Hz, 4H), 2.43 (s, 3H), 2.03−1.96 (m, 4H), 1.64−1.47 (m, 3H), 0.88 (d,

J = 5.6 Hz, 3H), 0.75 (d, J = 5.6 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃)

δ 169.11, 145.65, 143.87, 136.43, 129.76, 127.32, 125.44, 122.34,

111.46, 56.14, 47.75, 42.32, 25.41, 24.38, 22.94, 21.51, 21.39. HRMS

(ESI): [M + H]⁺C₂₃H₃₂N₃O₃S calcd 430.2164, found 430.2164; purity

≥99.99% (as determined by RP-HPLC, method A, t_R= 11.83 min).

(S)-4-Methyl-2-(4-methylphenylsulfonamido)-N-(4-(piperi-

din-1-yl)phenyl)pentanamide (9c). The title compound was

prepared from 4a and 4-(piperidin-1-yl)aniline (8c) according to the

general procedure as a colorless solid (0.06 g, 40%). Mp: 178−180 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.75 (d, J = 8.0 Hz, 2H), 7.59 (s, 1H),

7.25 (d, J = 8.0 Hz, 2H), 7.16 (d, J = 8.8 Hz, 2H), 6.84 (d, J = 8.8 Hz,

2H), 5.10 (d, J = 7.2 Hz, 1H), 3.77−3.74 (m, 1H), 3.09 (t, J = 5.6 Hz,

4H), 2.32 (s, 3H), 1.72−1.68 (m, 4H), 1.67−1.46 (m, 5H), 0.86 (d, J =

6.0 Hz, 3H), 0.73 (d, J = 5.6 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃) δ

169.24, 149.57, 144.01, 136.30, 129.80, 128.91, 127.32, 121.48, 116.81,

56.19, 50.97, 42.18, 25.79, 24.40, 24.20, 22.93, 21.52, 21.50, 21.37.

HRMS (ESI): [M + H]⁺C₂₄H₃₄N₃O₃S calcd 444.2321, found

444.2321; purity ≥99.99% (as determined by RP-HPLC, method B,

t_R= 18.20 min).

(S)-2-(4-Fluorophenylsulfonamido)-4-methyl-N-(4-

morpholinophenyl)pentanamide (14b). The title compound was

prepared from 13b and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.05 g, 31%). Mp: 168−170 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.91−7.87 (m, 2H), 7.65 (s, 1H), 7.22

(d, J = 8.8 Hz, 2H), 7.13 (t, J = 8.4 Hz, 2H), 6.82 (d J = 8.8 Hz, 2H),

5.26 (d, J = 8.0 Hz, 1H), 3.82 (t, J = 4.8 Hz, 4H), 3.80−3.77 (m, 1H),

3.10 (t, J = 4.8 Hz, 4H), 1.63−1.57 (m, 2H), 1.53−1.48 (m, 1H), 0.87

(d, J = 6.4 Hz, 3H), 0.74 (d, J = 6.0 Hz, 3H); ¹³C NMR (100 MHz,

CDCl₃) δ 169.28, 166.50, 163.96, 148.64, 135.48, 135.45, 130.08,

(S)-4-Methyl-2-(4-methylphenylsulfonamido)-N-(4-(4-meth-

ylpiperidin-1-yl)phenyl)pentanamide (9d). The title compound

N

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

129.99, 129.43, 121.61, 116.52, 116.29, 116.06, 66.81, 56.20, 49.55,

42.12, 24.41, 22.87, 21.35. HRMS (ESI): [M + H]⁺C₂₂H₂₉FN₃O₄S

calcd 450.1863, found 450.1863; purity ≥99.15% (as determined by

RP-HPLC, method A, t_R= 11.15 min).

(S)-2-(4-Bromophenylsulfonamido)-4-methyl-N-(4-

morpholinophenyl)pentanamide (14c). The title compound was

prepared from 13c and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.10 g, 70%). Mp: 185−187 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.72 (d, J = 8.4 Hz, 2H), 7.59 (d, J = 8.4

Hz, 2H), 7.56 (s, 1H), 7.17 (d, J = 8.4 Hz, 2H), 6.82 (d, J = 8.4 Hz, 2H),

5.38 (d, J = 7.6 Hz, 1H), 3.86 (t, J = 4.6 Hz, 4H), 3.82−3.77 (m, 1H),

3.12 (t, J = 5.0 Hz, 4H), 1.67−1.50 (m, 3H), 0.88 (d, J = 6.4 Hz, 3H),

0.78 (d, J = 6.0 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃) δ 169.18,

148.70, 138.50, 132.41, 129.25, 128.74, 128.12, 121.70, 116.07, 66.82,

56.26, 49.53, 42.12, 24.41, 22.87, 21.43. HRMS (ESI): [M + H]⁺

C₂₂H₂₉BrN₃O₄S calcd 510.1062, found 510.1064; purity ≥99.99% (as

determined by RP-HPLC, method A, t_R= 12.75 min).

( S ) - 2 - ( 4 - M e t h y l p h e n y l s u l f o n a m i d o ) - N - ( 4 -

morpholinophenyl)propanamide (17b). The title compound was

prepared from 16b and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.10 g, 60%). Mp: 215−217 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.94 (s, 1H), 7.77 (d, J = 8.4 Hz, 2H),

7.32−7.30 (m, 4H), 6.85 (d, J = 8.4 Hz, 2H), 5.04 (d, J = 7.6 Hz, 1H),

3.89−3.85 (m, 5H), 3.11 (t, J = 5.2 Hz, 4H), 2.40(s, 3H), 1.31 (d, J =

6.8 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃) δ 169.09, 148.50, 144.22,

136.09, 129.96, 129.76, 127.23, 121.44, 116.07, 66.83, 53.15, 49.61,

21.54, 18.86. HRMS (ESI): [M + H]⁺C₂₀H₂₆N₃O₄S calcd 404.1644,

found 404.1643; purity ≥99.99% (as determined by RP-HPLC,

method B, t_R= 17.87 min).

(S)-3-Hydroxy-2-(4-methylphenylsulfonamido)-N-(4-

morpholinophenyl)propanamide (17c). The title compound was

prepared from 16c and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.10 g, 61%). Mp: 208−210 °C.

¹H NMR (400 MHz, CDCl₃) δ 8.40 (s, 1H), 7.78 (d, J = 8.0 Hz, 2H),

7.37−7.32 (m, 4H), 6.86 (d, J = 8.4 Hz, 2H), 5.70 (d, J = 6.8 Hz, 1H),

4.10 (d, J = 10.4 Hz, 1H), 3.85−3.87 (m, 5H), 3.39−3.36 (m, 1H), 3.12

(t, J = 4.8 Hz, 4H), 2.43 (s, 3H), 2.30 (s, 1H); ¹³C NMR (100 MHz,

CDCl₃) δ 167.28, 148.67, 144.43, 135.87, 130.89, 129.50, 127.24,

121.49, 116.06, 66.83, 62.12, 57.57, 49.54. HRMS (ESI): [M + H]⁺

C₂₀H₂₆N₃O₅S calcd 420.1593, found 420.1593; purity ≥95.59% (as

determined by RP-HPLC, method B, t_R= 15.24 min).

(S)-3-Methyl-2-(4-methylphenylsulfonamido)-N-(4-

morpholinophenyl)butanamide (17d). The title compound was

prepared from 16d and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.10 g, 63%). Mp: 240−242 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.74 (d, J = 7.2 Hz, 2H), 7.51 (s, 1H),

7.25 (d, J = 8.0 Hz, 2H), 7.19 (d, J = 8.0 Hz, 2H), 6.82 (d, J = 8.8 Hz,

2H), 5.15 (d, J = 6.8 Hz, 1H), 3.85 (t, J = 4.4 Hz, 4H), 3.55(t, J = 5.6 Hz,

1H), 3.10 (t, J = 4.8 Hz, 4H), 2.35 (s, 3H), 2.21−2.18 (m, 1H), 0.90 (d,

J = 6.8 Hz, 3H), 0.83 (d, J = 6.8 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃)

δ 168.29, 148.64, 144.05, 136.08, 129.76, 129.45, 127.38, 121.62,

116.06, 66.83, 62.81, 49.63, 31.24, 21.53, 19.12, 17.36. HRMS (ESI):

[M + H]⁺C₂₂H₃₀N₃O₄S calcd 432.1957, found 432.1946; purity

≥99.99% (as determined by RP-HPLC, method B, t_R= 21.16 min).

(2S,3S)-3-Hydroxy-2-(4-methylphenylsulfonamido)-N-(4-

morpholinophenyl)butanamide (17e). The title compound was

prepared from 16e and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.07 g, 42%). Mp: 202−203 °C.

¹H NMR (400 MHz, CDCl₃) δ 8.42 (s, 1H), 7.78 (d, J = 7.2 Hz, 2H),

7.32−7.26 (m, 4H), 6.84 (d, J = 7.2 Hz, 2H), 5.80 (d, J = 5.6 Hz, 1H),

4.43 (brs, 1H), 3.85 (t, J = 4.4 Hz, 4H), 3.75 (d, J = 5.6 Hz, 1H), 3.11 (t,

J = 4.4 Hz, 4H), 2.79 (s, 1H), 2.41 (s, 3H), 0.94 (d, J = 5.2 Hz, 3H); ¹³C

NMR (100 MHz, CDCl₃) δ 169.37, 148.59, 144.18, 136.06, 129.93,

129.59, 127.22, 121.47, 116.06, 67.64, 66.82, 60.80, 49.56, 21.55, 18.09.

HRMS (ESI): [M + H]⁺C₂₁H₂₈N₃O₅S calcd 434.1750, found

434.1745; purity ≥98.74% (as determined by RP-HPLC, method B,

t_R= 16.15 min).

(S)-2-(4-Methylphenylsulfonamido)-4-(methylthio)-N-(4-

morpholinophenyl)butanamide (17f). The title compound was

prepared from 16f and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.07 g, 45%). Mp: 200−202 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.92 (s, 1H), 7.77 (d, J = 8.0 Hz, 2H),

7.30−7.26 (m, 4H), 6.84 (d, J = 8.4 Hz, 2H), 5.84 (d, J = 8.4 Hz, 1H),

4.03−3.98 (m, 1H), 3.85 (t, J = 4.8 Hz, 4H), 3.11 (t, J = 4.4 Hz, 4H),

2.53−2.47 (m, 1H), 2.44−2.41 (m, 1H), 2.39 (s, 3H), 2.03 (s, 3H),

1.99−1.95 (m, 2H); ¹³C NMR (100 MHz, CDCl₃) δ 168.19, 148.61,

144.17, 136.25, 129.90, 129.55, 127.30, 121.48, 116.06, 66.83, 56.59,

49.58, 31.17, 30.04, 21.56, 15.16. HRMS (ESI): [M + H]⁺

C₂₂H₃₀N₃O₄S₂calcd 464.1678, found 464.1669; purity ≥99.06% (as

determined by RP-HPLC, method B, t_R= 21.91 min).

(S)-3-(4-Methylphenylsulfonamido)-4-(4-morpholino-

phenylamino)-4-oxobutanoic Acid (17g). A general amide

coupling reaction was used to prepare intermediate (S)-benzyl 3-(4-

methylphenylsulfonamido)-4-(4-morpholinophenylamino)-4-oxobu-

tanoate from 16g and 4-morpholinoaniline (8a) as a colorless solid. To

the solution of the above prepared intermediate (1 equiv) in MeOH/

EA palladium/charcoal (0.1 equiv) was added, and the reaction mixture

(S)-2-(4-Methoxyphenylsulfonamido)-4-methyl-N-(4-

morpholinophenyl)pentanamide (14d). The title compound was

prepared from 13d and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.12 g, 76%). Mp: 192−194 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.81 (d, J = 8.8 Hz, 2H), 7.74 (s, 1H),

7.25 (d, J = 8.4 Hz, 2H), 6.92 (d, J = 8.8 Hz, 2H), 6.83 (d, J = 8.4 Hz,

2H), 5.01 (d, J = 6.8 Hz, 1H), 3.85 (t, J = 4.8 Hz, 4H), 3.79 (, 3H),

3.77−3.71 (m, 1H), 3.10 (t, J = 4.8 Hz, 4H), 1.66−1.60 (m, 2H), 1.51−

1.47 (m, 1H), 0.87 (d, J = 6.4 Hz, 3H), 0.71 (d, J = 5.6 Hz, 3H); ¹³C

NMR (100 MHz, CDCl₃) δ 169.37, 163.23, 148.48, 130.60, 129.80,

129.50, 121.47, 116.04, 114.36, 66.84, 56.24, 55.62, 49.63, 42.08, 24.41,

22.91, 21.32. HRMS (ESI): [M + H]⁺C₂₃H₃₂N₃O₅S calcd 462.2063,

found 462.2071; purity ≥99.16% (as determined by RP-HPLC,

method A, t_R= 10.57 min).

(S)-2-(Biphenyl-4-ylsulfonamido)-4-methyl-N-(4-

morpholinophenyl)pentanamide (14e). The title compound was

prepared from 13e and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.12 g, 80%). Mp: 213-215 °C.

¹H NMR (400 MHz, CDCl₃) δ 7.93 (d, J = 8.0 Hz, 2H), 7.67 (s, 1H),

7.63 (d, J = 8.4 Hz, 2H), 7.46−7.39 (m, 5H), 7.18 (d, J = 8.8 Hz, 2H),

6.74 (d, J = 8.4 Hz, 2H), 5.27 (d, J = 8.0 Hz, 1H), 3.87−382 (m, 5H),

3.03 (t, J = 4.8 Hz, 4H), 1.66−1.60 (m, 2H), 1.56−1.51 (m, 1H), 0.88

(d, J = 5.6 Hz, 3H), 0.76 (d, J = 5.6 Hz, 3H); ¹³C NMR (100 MHz,

CDCl₃) δ 169.19, 148.44, 146.01, 139.10, 137.78, 129.54, 128.95,

128.50, 127.80, 127.78, 127.33, 121.45, 115.97, 66.82, 56.31, 49.48,

42.14, 24.44, 22.91, 21.40. HRMS (ESI): [M + H]⁺C₂₈H₃₄N₃O₄S calcd

508.2270, found 508.2271; purity ≥98.94% (as determined by RP-

HPLC, method A, t_R= 15.08 min).

( S ) - 4 - M e t h y l - N - ( 4 - m o r p h o l i n o p h e n y l ) - 2 - ( 4 -

nitrophenylsulfonamido)pentanamide (14f). The title com-

pound was prepared from 13g and 4-morpholinoaniline (8a) according

to the general procedure as yellowish solid (0.03g, 21%). Mp: 215−217

°C. ¹H NMR (400 MHz, CDCl₃) δ 8.22 (d, J = 8.8 Hz, 2H), 8.02 (d, J =

8.8 Hz, 2H), 7.32 (s, 1H), 7.122 (d, J = 8.8 Hz, 2H), 6.78 (d, J = 8.8 Hz,

2H), 5.55 (d, J = 7.2 Hz, 1H), 3.91−3.84 (m, 5H), 3.09 (t, J = 4.8 Hz,

4H), 1.76−1.70 (m, 1H), 1.61−1.51 (m, 2H), 0.93 (d, J = 6.8 Hz, 3H),

0.87 (d, J = 6.8 Hz, 3H); ¹³C NMR (100 MHz, CDCl₃,) δ 167.51,

148.93, 147.89, 144.35, 127.77, 127.44, 123.26, 120.29, 114.95, 65.78,

55.45, 48.33, 41.19, 28.69, 23.40, 21.81, 20.56. HRMS (ESI): [M + H]⁺

C₂₂H₂₉N₄O₆S calcd 477.1808, found 477.1808; purity ≥99.99% (as

determined by RP-HPLC, method A, t_R= 11.86 min).

2-(4-Methylphenylsulfonamido)-N-(4-morpholinophenyl)-

acetamide (17a). The title compound was prepared from 16a and 4-

morpholinoaniline (8a) according to the general procedure as a

colorless solid (0.09 g, 55%). Mp: 182−184 °C. ¹H NMR (400 MHz,

CDCl₃) δ 7.96 (s, 1H), 7.76 (d, J = 8.4 Hz, 2H), 7.35−7.32 (m, 4H),

6.85 (d, J = 8.8 Hz, 2H), 5.31 (t, J = 6.8 Hz, 1H), 3.85 (t, J = 4.8 Hz,

4H), 3.69 (d, J = 6.4 Hz, 2H), 3.11 (t, J = 4.8 Hz, 4H), 2.42 (s, 3H); ¹³C

NMR (100 MHz, CDCl₃) δ 165.61, 148.65, 144.40, 135.40, 130.05,

129.43, 127.27, 121.54, 116.10, 66.84, 49.53, 46.49, 21.56. HRMS

(ESI): [M + H]⁺C₁₉H₂₄N₃O₄S calcd 390.1488, found 390.1485; purity

≥99.8% (as determined by RP-HPLC, method B, t_R= 17.55 min).

O

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

was stirred at room temperature under H₂pressure for 3 h. The reaction

solution was ﬁltered through Celite and the solvent was evaporated to

yield the title compound as a colorless solid (0.13 g, 55% over 2 steps).

(S)-3-(1H-Indol-3-yl)-2-(2-methylphenylsulfonamido)-N-(4-

morpholinophenyl)propanamide (19a). The title compound was

prepared from 18a and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.08 g, 60%). Mp: 125−127 °C.

¹H NMR (400 MHz, CDCl₃) δ 8.08 (s, 1H), 7.88 (d, J = 8.0 Hz, 1H),

7.71 (s, 1H), 7.34 (d, J = 7.2 Hz, 3H), 7.24−7.18 (m, 4H), 7.05−6.96

(m, 3H), 6.82 (d, J = 8.8 Hz, 2H), 5.23 (d, J = 5.2 Hz, 1H), 3.98−3.95

(m, 1H), 3.85 (t, J = 4.8 Hz, 4H), 3.23 (d, J = 6.8 Hz, 2H), 3.10 (t, J =

4.8 Hz, 4H), 2.24 (s, 3H); ¹³C NMR (100 MHz, CDCl₃) δ 168.65,

148.55, 136.99, 136.34, 135.89, 133.19, 132.64, 129.72, 129.53, 126.72,

126.09, 123.49, 122.62, 121.72, 120.15, 118.41, 116.06, 111.32, 109.32,

66.84, 57.47, 49.49, 29.03, 19.97. HRMS (ESI): [M + H]⁺

C₂₈H₃₁N₄O₄S calcd 519.2066, found 519.2066; purity ≥99.99% (as

determined by RP-HPLC, method A, t_R= 11.94 min).

(S)-3-(1H-Indol-3-yl)-2-(3-methylphenylsulfonamido)-N-(4-

morpholinophenyl)propanamide (19b). The title compound was

prepared from 18b and 4-morpholinoaniline (8a) according to the

general procedure as a colorless solid (0.07 g, 55%). Mp: 210−212 °C.

¹H NMR (400 MHz, DMSO-d₆) δ 10.77 (s, 1H), 9.73 (s, 1H), 8.14 (s,

1H), 7.46−7.40 (m, 3H), 7.29−7.21 (m, 5H), 7.07−7.01 (m, 2H), 6.94

(d, J = 8.0 Hz, 1H), 6.82 (d, J = 8.8 Hz, 2H), 4.10−4.05 (m,1H), 3.72 (t,

J = 4.4 Hz, 4H), 3.07−3.05 (m, 1H), 3.02 (t, J = 4.4 Hz, 4H), 2.87−2.83

(m, 1H), 2.16 (s, 3H); ¹³C NMR (100 MHz, DMSO-d₆) δ 169.23,

147.81, 141.40, 138.67, 136.36, 132.98, 131.16, 128.91, 127.58, 127.04,

124.30, 123.94, 121.26, 121.00, 118.71, 118.63, 115.62, 111.69, 109.59,

66.53, 58.08, 49.36, 29.08, 21.15. HRMS (ESI): [M + H]⁺

C₂₈H₃₁N₄O₄S calcd 519.2066, found 519.2066; purity ≥99.99% (as

determined by RP-HPLC, method A, t_R= 11.98 min).

(S)-3-(1H-Indol-3-yl)-2-(4-methylphenylsulfonamido)-N-

phenylpropanamide (20a). The title compound was prepared from

16k and aniline according to the general procedure as a colorless solid

(0.04 g, 35%). Mp: 186−188 °C. ¹H NMR (400 MHz, CDCl₃) δ 8.14

(s, 1H), 8.10 (s, 1H), 7.45 (d, J = 8.4 Hz, 2H), 7.34 (d, J = 7.6 Hz, 2H),

7.30−7.24 (m, 4H), 7.17−7.11 (m, 2H), 7.09−6.92 (m, 3H), 6.91 (s,

1H), 5.19 (d, J = 5.6 Hz, 1H), 4.05−4.01 (m, 1H), 3.20−3.17 (m, 2H),

2.29 (s, 3H); ¹³C NMR (100 MHz, CDCl₃) δ 168.86, 144.03, 137.00,

136.33, 134.91, 129.63, 128.89, 126.95, 126.69, 124.71, 123.49, 120.18,

119.99, 118.41, 111.35, 109.13, 57.43, 28.45, 21.51. HRMS (ESI): [M

+ H]⁺C₂₄H₂₄N₃O₃S calcd 434.1538, found 434.1538; purity ≥99.99%

(as determined by RP-HPLC, method A, t_R= 16.45 min).

1

Mp: 166−168 °C. H NMR (400 MHz, DMSO-d₆) δ 9.77 (s, 1H),

7.65−7.20 (m, 4H), 7.21 (d, J = 4.0 Hz, 2H), 6.82 (d, J = 8.8 Hz, 2H),

4.17 (t, J = 7.0 Hz, 1H), 3.72 (t, J = 4.4 Hz, 4H), 3.02 (t, J = 4.6 Hz, 4H),

2.57 (dd, J = 16.2, 6.6 Hz, 1H), 2.35 (dd, J = 16.0, 7.6 Hz, 1H), 2.25 (s,

3H); ¹³C NMR (100 MHz, DMSO-d₆) δ 171.53, 167.93, 147.78,

142.88, 138.51, 131.19, 129.66, 127.05, 120.99, 115.59, 66.53, 54.29,

49.40, 38.09, 21.38. HRMS (ESI): [M + H]⁺C₂₁H₂₆N₃O₆S calcd

448.1542, found 448.1541; purity ≥99.99% (as determined by RP-

HPLC, method B, t_R= 16.29 min).

(S)-4-(4-Methylphenylsulfonamido)-5-(4-morpholinophe-

nylamino)-5-oxopentanoic Acid (17h). A general amide coupling

reaction was used to prepare intermediate (S)-benzyl 4-(4-

methylphenylsulfonamido)-5-(4-morpholinophenylamino)-5-oxopen-

tanoate from 16h and 4-morpholinoaniline (8a) as a colorless solid. To

the solution of above prepared intermediate (1 equiv) in MeOH/EA

palladium/charcoal (0.1 equiv) was added, and the reaction mixture

was stirred at room temperature under H₂pressure for 3 h. The reaction

solution was ﬁltered through Celite, and the solvent was evaporated to

yield the title compound as white solid (0.12 g, 52%). Mp: 139−141 °C.

¹H NMR (400 MHz, DMSO-d₆) δ 9.67 (s, 1H), 7.65 (d, J = 8.4 Hz,

2H), 7.25 (d, J = 7.6 Hz, 2H), 7.19 (d, J = 8.8 Hz, 2H), 6.84 (d, J = 8.4

Hz, 2H), 3.83−3.79 (m, 1H), 3.72 (t, J = 4.6 Hz, 4H), 3.02 (t, J = 4.8

Hz, 4H), 2.26 (s, 3H), 2.20−2.11 (m, 2H), 1.80−1.70 (m, 2H); ¹³C

NMR (100 MHz, DMSO-d₆) δ 174.06, 168.74, 147.88, 142.92, 138.48,

130.98, 129.71, 126.97, 121.09, 115.68, 66.53, 56.73, 49.37, 30.53,

28.58, 21.37. HRMS (ESI): [M + H]⁺C₂₂H₂₈N₃O₆S calcd 462.1699,

found 462.1697; purity ≥99.14% (as determined by RP-HPLC,

method B, t_R= 16.43 min).

(S)-2-(4-Methylphenylsulfonamido)-N-(4-morpholinophen-

yl)-3-phenylpropanamide (17i). The title compound was prepared

from 16i and 4-morpholinoaniline (8a) according to the general

1

procedure as a colorless solid (0.10 g, 65%). Mp: 223−225 °C. H

NMR (400 MHz, CDCl₃) δ 7.83 (s, 1H), 7.57 (d, J = 7.6 Hz, 2H),

7.26−7.17 (m, 7H), 6.97 (d, J = 6.8 Hz, 2H), 6.83 (d, J = 8.4 Hz, 2H),

5.03 (d, J = 6.8 Hz, 1H), 3.98−3.93 (m, 1H), 3.85 (t, J = 4.4 Hz, 4H),

3.10 (t, J = 4.4 Hz, 4H), 3.09−3.04 (m, 1H), 2.969−2.91 (m, 1H), 2.40

(s, 3H); ¹³C NMR (100 MHz, CDCl₃) δ 168.00, 148.59, 144.04,

135.53, 135.22, 129.88, 129.49, 129.21, 128.99, 127.31, 127.19, 121.69,

116.05, 66.84, 58.56, 49.59, 38.41, 21.57. HRMS (ESI): [M + H]⁺

C₂₆H₃₀N₃O₄S calcd 480.1957, found 480.1956; purity ≥99.99% (as

determined by RP-HPLC, method A, t_R= 12.01 min).

(S)-2-(4-Bromophenylsulfonamido)-3-(1H-indol-3-yl)-N-

phenylpropanamide (21a). The title compound was prepared from

18c and aniline according to the general procedure as a colorless solid

1

(0.08 g, 40%). Mp: 215−217 °C. H NMR (400 MHz, DMSO-d₆) δ

10.78 (s, 1H), 9.98 (s, 1H), 8.40 (s, 1H), 7.40−7.39 (m, 5H), 7.36 (d, J

= 8.4 Hz, 2H), 7.30−7.23 (m, 3H), 7.10 (s, 1H), 7.06−7.01 (m, 2H),

6.93 (t, J = 7.2 Hz, 1H), 4.16−4.13 (m, 1H), 3.05 (dd, J = 14.2, 6 Hz,

1H), 2.87 (dd,, J = 14.7, 8 Hz, 1H); ¹³C NMR (100 MHz, DMSO-d₆) δ

169.75, 140.44, 138.78, 136.38, 132.12, 131.86, 128.97, 128.55, 127.44,

126.22, 124.49,123.95, 121.27, 119.92, 118.73, 118.62, 111.76, 109.38,

58.08, 28.95. HRMS (ESI): [M + H]⁺C₂₃H₂₁BrN₃O₃S calcd 498.0487,

found 498.0487; purity ≥96.56% (as determined by RP-HPLC,

method A, t_R= 19.59 min).

(S)-3-(1H-Indol-3-yl)-2-(4-methylphenylsulfonamido)-N-

(thiophen-2-ylmethyl)propanamide (20b). The title compound

was prepared from 16k and thiophen-2-ylmethanamine according to

the general procedure as a colorless solid (0.09 g, 66%). Mp: 158−160

°C. ¹H NMR (400 MHz, CDCl₃) δ 8.20 (s, 1H), 7.41 (d, J = 8.4 Hz,

2H), 7.28−7.24 (m, 2H), 7.16−7.11 (m, 2H), 7.01−6.88 (m, 3H), 6.87

(s, 1H), 6.81 (s, 1H), 6.74 (s, 1H), 5.13 (d, J = 6.0 Hz, 1H), 4.48−4.45

(m, 2H), 3.94−3.91 (m, 1H), 3.11−3.09 (m, 2H), 2.31 (s, 3H); ¹³C

NMR (100 MHz, CDCl₃) δ 170.55, 143.79, 140.17, 136.31, 135.18,

129.55, 126.85, 126.76, 126.09, 125.12, 123.52, 122.35, 119.86, 118.41,

111.30, 109.03, 56.85, 38.35, 28.44, 21.55. HRMS (ESI): [M + H]⁺

C₂₃H₂₄N₃O₃S₂calcd 454.1259, found 454.1270; purity ≥99.41% (as

determined by RP-HPLC, method A, t_R= 15.40 min).

(S)-3-(4-Hydroxyphenyl)-2-(4-methylphenylsulfonamido)-

N-(4-morpholinophenyl)propanamide (17j). A general amide

coupling reaction was used to prepare intermediate (S)-4-(2-(4-

methylphenylsulfonamido)-3-(4-morpholinophenylamino)-3-

oxopropyl)phenyl 4-methylbenzenesulfonate from 16j and 4-morpho-

linoaniline (8a) as a colorless solid. To the solution of the above

prepared intermediate (1 equiv) in ethanol was added sodium

hydroxide (5 equiv), and the solution was reﬂuxed for 4 h. The

reaction mixture was cooled down to room temperature, and the

ethanol was evaporated under reduced pressure. The residue was

acidiﬁed with 1.5 N HCl and extracted with ethyl acetate. The

combined organic fraction was dried over magnesium sulfate, ﬁltered,

and concentrated. The residue was puriﬁed through ﬂash column

chromatography eluting with 0−5% MeOH in DCM to yield the title

compound as a white solid (0.03 g, 40%). Mp: 224−226 °C. ¹H NMR

(400 MHz, DMSO-d₆) δ 9.61 (s, 1H), 9.18 (s, 1H), 8.05 (s, 1H), 7.49

(d, J = 8.0 Hz, 2H), 7.15 (d, J = 8.4 Hz, 4H), 6.93 (d, J = 7.6 Hz, 2H),

6.82 (d, J = 9.2 Hz, 2H), 6.57 (d, J = 8.8 Hz, 2H), 3.98−3.85 (m, 1H),

3.72 (t, J = 4.6 Hz, 4H), 3.01 (t, J = 4.6 Hz, 4H), 2.78−2.73 (m, 1H),

2.67−2.59 (m, 1H), 2.33 (s, 3H); ¹³C NMR (100 MHz, DMSO-d₆) δ

168.85, 156.33, 147.79, 142.60, 138.63, 131.05, 130.62, 129.51, 127.39,

126.84, 121.06, 115.65, 115.25, 66.53, 59.01, 49.37, 21.37. HRMS

(ESI): [M + H]⁺C₂₆H₃₀N₃O₅S calcd 496.1906, found 496.1898; purity

≥99.99% (as determined by RP-HPLC, method B, t_R= 19.93 min).

(S)-3-(1H-Indol-2-yl)-2-(4-methylphenylsulfonamido)-N-(4-

morpholinophenyl)propanamide (BC-DXI-495, 2). See ref 16.

(S)-2-(4-Bromophenylsulfonamido)-3-(1H-indol-3-yl)-N-(thi-

ophen-2-ylmethyl)propanamide (21b). The title compound was

prepared from 18c and thiophen-2-ylmethanamine according to the

general procedure as a colorless solid (0.08 g, 60%). Mp: 170−170 °C.

P

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

¹H NMR (400 MHz, DMSO-d₆) δ 10.73 (s, 1H), 8.62 (t, J = 6.0 Hz,

(s, 3H), 3.12−3.07 (m, 1H), 2.91−2.85 (m, 1H); ¹³C NMR (100 MHz,

DMSO-d₆) δ 170.34, 159.41, 157.59, 149.21, 139.95, 136.41, 131.85,

128.51, 127.56, 127.44, 127.31, 126.32, 124.69, 121.28, 118.84, 118.60,

114.53, 111.75, 108.86, 106.83, 56.84, 54.41, 28.77. HRMS (ESI): [M

+ H]⁺C₂₇H₂₄BrN₄O₄S₂calcd 611.0422, found 611.0422; purity

≥99.88% (as determined by RP-HPLC, method A, t_R= 20.42 min).

(S )-2-(4-Br omoph en yl sul fon amido)- N-( 4- (2, 4-

dimethoxyphenyl)thiazol-2-yl)-3-(1H-indol-3-yl)propanamide

(21e). The title compound was prepared from 18c and 4-(2,4-

dimethoxyphenyl)thiazol-2-amine as a colorless solid (0.05 g, 31%).

1H), 8.22 (s, 1H), 7.42−7.33 (m, 6H), 7.27 (d, J = 8.4 Hz, 1H), 7.05−

7.01 (m, 2H), 6.94−6.88 (m, 2H), 6.86 (d, J = 2.4 Hz, 1H), 4.30−4.26

(m, 2H), 3.99−3.95 (m, 1H), 2.99 (dd, J = 14.2, 6.0 Hz, 1H), 2.80 (dd,,

J = 14.7, 8 Hz, 1H); ¹³C NMR (100 MHz, DMSO-d₆) δ 170.92, 142.19,

140.45, 136.42, 131.74, 128.36, 127.33, 127.03, 126.07, 125.71, 125.41,

124.60, 121.16, 118.54, 111.17, 109.41, 51.31, 37.66, 29.12. HRMS

(ESI): [M + H]⁺C₂₂H₂₁BrN₃O₃S₂calcd 518.0208, found 518.0223;

purity ≥98.48% (as determined by RP-HPLC, method A, t_R= 16.60

min).

(S)-3-(1H-Indol-3-yl)-2-(4-methylphenylsulfonamido)-N-(4-

methylthiazol-2-yl)propanamide (20c). The title compound was

prepared from 16k and 4-methylthiazol-2-amine according to the

general procedure as a colorless solid (0.08 g, 60%). Mp: 299−301 °C.

¹H NMR (400 MHz, DMSO-d₆) δ 12.11 (s, 1H), 10.84 (s, 1H), 8.24 (s,

1H), 7.44 (d, J = 8.4 Hz, 2H), 7.38 (d, J = 7.6 Hz, 1H), 7.27 (d, J = 8.0

Hz, 1H), 7.06−7.00 (m, 4H), 6.89 (t, J = 7.6 Hz, 1H), 6.71 (s, 1H),

4.24−4.19 (m, 1H), 3.08−3.02 (m, 1H), 2.87−2.81 (m, 1H), 2.23 (s,

3H), 2.21 (s, 3H); ¹³C NMR (100 MHz, DMSO-d₆) δ 170.12, 157.14,

147.01, 142.66, 137.91, 136.39, 129.39, 127.41, 126.75, 124.41, 121.21,

118.74, 118.57, 111.67, 108.93, 108.29, 57.02, 28.79, 21.33, 17.28.

HRMS (ESI): [M + H]⁺C₂₂H₂₃N₄O₃S₂calcd 455.1212, found

455.1234; purity ≥99.16% (as determined by RP-HPLC, method A, t_R

= 14.99 min).

(S)-2-(4-Bromophenylsulfonamido)-3-(1H-indol-3-yl)-N-(4-

methylthiazol-2-yl)propanamide (21c). The title compound was

prepared from 18c and 4-methylthiazol-2-amine according to the

general procedure as a colorless solid (0.10 g, 92%). Mp: 303−305 °C.

¹H NMR (400 MHz, DMSO-d₆) δ 12.21 (s, 1H), 10.85 (s, 1H), 8.53

(d, J = 8.5 Hz, 1H), 7.44 (d, J = 8 Hz, 1H), 7.44−7.36 (m, 4H), 7.27 (d,

J = 8 Hz, 1H), 7.07−7.02 (m, 2H), 6.90 (t, J = 8.4 Hz, 1H), 6.73 (s, 1H),

4.29−4.25 (m, 1H), 3.07 (dd, J = 14.2, 6 Hz, 1H), 2.87 (dd,, J = 14.7, 8

Hz, 1H), 2.25 (s, 3H); ¹³C NMR (100 MHz, DMSO-d₆) δ 169.89,

157.01, 147.10, 139.96, 136.39, 131.85, 128.49, 127.30, 126.29, 124.64,

121.24, 118.77, 118.58, 111.76, 108.84, 104.45, 56.98, 28.76, 17.31.

HRMS (ESI): [M + H]⁺C₂₁H₂₀BrN₄O₃S₂calcd 519.0160, found

519.0176; purity ≥98.96% (as determined by RP-HPLC, method A, t_R

= 16.20 min).

Synthesis of Compounds 20d, 21d, 21e, and 21f. EDCI·HCl

(1.1 equiv) and HOBt (1.1 equiv) were added to a stirred solution of

carboxylic acid (1 equiv), amine (1 equiv) and DIPEA (2.5 equiv) in

DMF at room temperature, and the reaction mixture was stirred at 60

°C for 16 h. The reaction mass was cooled to room temperature,

acidiﬁed with 1.5 N HCl and extracted with ethyl acetate. The

combined organic layer was then washed with saturated sodium

bicarbonate, brine and concentrated under reduced pressure. The

residue was puriﬁed through ﬂash column chromatography (hexane/

ethyl acetate).

1

Mp: 165−168 °C. H NMR (400 MHz, DMSO-d₆) δ 12.35 (s, 1H),

10.76 (s, 1H), 8.48 (s, 1H), 7.81 (d, J = 8.8 Hz, 2H), 7.96 (d, J = 8.8 Hz,

1H), 7.47 (s, 2H), 7.46−7.40 (m, 4H), 7.37 (d, J = 9.2 Hz, 1H), 7.07−

7.02 (m, 2H), 6.92 (d, J = 8.8 Hz, 1H), 6.89−6.60 (m, 2H), 4.34−4.30

(m, 1H), 3.90 (s, 3H), 3.80 (s, 3H), 3.12−3.07 (m, 1H), 2.91−2.85 (m,

1H); ¹³C NMR (100 MHz, DMSO-d₆) δ 170.29, 160.41, 158.19,

155.95, 145.30, 139.98, 136.41, 131.82, 130.11, 128.416, 127.31,

126.32, 124.73, 121.28, 118.85, 118.60, 116.26, 111.76, 110.21, 108.88,

105.49, 99.16, 56.86, 55.97, 55.72, 28.77. HRMS (ESI): [M + H]⁺

C₂₈H₂₆BrN₄O₅S₂calcd 641.0528, found 641.0524; purity ≥99.99% (as

determined by RP-HPLC, method A, t_R= 21.01 min).

(S)-2-(4-Bromophenylsulfonamido)-3-(1H-indol-3-yl)-N-(4-

(2-methoxyphenyl)thiazol-2-yl)propanamide (21f). The title

compound was prepared from 18c and 4-(2-methoxyphenyl)thiazol-

2-amine as a colorless solid (0.09 g, 75%). Mp: 196−198 °C. ¹H NMR

(400 MHz, DMSO-d₆) δ 12.39 (s, 1H), 10.76 (s, 1H), 8.48 (s, 1H),

7.64 (s, 1H), 7.47 (d, J = 7.6 Hz, 1H), 7.41−7.11 (m, 6H), 7.08−7.01

(m, 5H), 6.91(t, J = 7.6 Hz, 1H), 4.34−4.30 (m, 1H), 3.91 (s, 3H),

3.12−3.07 (m, 1H), 2.91−2.85 (m, 1H); ¹³C NMR (100 MHz, DMSO-

d₆) δ 170.38, 157.06, 156.11, 145.24, 139.98, 136.43, 131.83, 129.27,

128.48, 127.32, 126.34, 124.74, 122.99, 121.29, 120.88, 118.84, 118.62,

112.52, 112.12, 111.77, 108.88, 56.88, 55.91, 28.78. HRMS (ESI): [M

+ H]⁺C₂₇H₂₄BrN₄O₄S₂calcd 611.0422, found 611.0404; purity

≥99.15% (as determined by RP-HPLC, method A, t_R= 21.07 min).

Biology. Cell Culture and Materials. A549, H460, and CHO cells

were cultured in RPMI media supplemented with 10% FBS and 1%

penicillin/streptomycin in 5% CO₂at 37 °C. WI-26 cells were

cultivated in DMEM media using the same conditions as above. All cell

lines, antibodies speciﬁc for DX2 and AIMP2, and puriﬁed DX2

proteins were kindly provided by Biobank of Biocon (Medicinal

Bioconvergence Research Center, Seoul National University). Anti-

bodies speciﬁc for Siah1 (no. ab2237) and actin (no. A1978) were

purchased from Abcam and Sigma, respectively. Anti-ubiquitin (no. sc-

8017) and anti-HSP70 (no. sc-29352) antibodies were purchased from

Santa Cruz Biotechnology. MG-132 (no. 474790) and doxycycline (no.

D3447) were purchased from Millipore and Sigma, respectively.

Screening. A549 cells (4 × 10⁴cells/mL) expressing nano-

luciferase-tagged DX2 were seeded in 96-well, ﬂat-bottom white plates

(no. 3903 Corning) and incubated for 12 h. The cells were treated with

the synthetic compounds (40 μM), individually, for 4 h, and

luminescence was measured according to the manufacturer’s protocol

(Promega). A549 cells were treated with six compounds (40 μM),

individually, and each showed over 50% inhibition of DX2 using the

same conditions as above; nanoluciferase-tagged AIMP2 was

introduced ectopically for negative screening. The compound showing

the highest and lowest inhibition of DX2 and AIMP2, respectively (BC-

DXI-843), was identiﬁed as a lead. All experiments were independently

repeated three times.

(S)-3-(1H-Indol-3-yl)-N-(4-(4-methoxyphenyl)thiazol-2-yl)-2-

(4-methylphenylsulfonamido)propanamide (BC-DXI-843,

20d). The title compound was prepared from 16k and 4-(4-

methoxyphenyl)thiazol-2-amine as a colorless solid (0.13 g, 65%).

1

Mp: 249−251 °C. H NMR (400 MHz, DMSO-d₆) δ 12.27 (s, 1H),

10.77 (s, 1H), 8.21 (d, J = 8.4 Hz, 1H), 7.79 (d, J = 8.4 Hz, 2H), 7.45 (d,

J = 8.0 Hz, 2H), 7.41 (d, J = 8.0 Hz, 2H), 7.27 (d, J = 8.0 Hz, 1H), 7.06−

6.97 (m, 6H), 6.90 (t, J = 7.6 Hz, 1H), 4.33−4.27 (m, 1H), 3.79 (s, 3H),

3.11−3.05 (m, 1H), 2.88−2.83 (m, 1H), 2.18 (s, 3H); ¹³C NMR (100

MHz, DMSO-d₆) δ 170.39, 159.41, 157.63, 149.14, 142.68, 137.90,

136.42, 129.41, 127.56, 127.43, 127.41, 126.79, 124.48, 121.26, 118.82,

118.61, 114.55, 111.66, 108.95, 106.69, 56.88, 55.56, 28.80, 21.33.

HRMS (ESI): [M + H]⁺C₂₈H₂₇N₄O₄S₂calcd 547.1474, found

547.1474; purity ≥99.99% (as determined by RP-HPLC, method A, t_R

= 19.53 min).

In Vitro Pull-down Assay. DX2-His 6 (0.1 mg) and HSP70 (0.25

mg) were mixed at an equal molar ratio (1:1) in 50 mM Tris-HCl (pH

7.4) lysis buﬀer containing 100 mM NaCl, 0.5% Triton X-100, 10%

glycerol, 1 mM EDTA, and protease inhibitors (Calbiochem). BC-

DXI-843 was then added in a dose-dependent manner and incubated

for 4 h. After incubation, DX2-His 6 proteins were precipitated with Ni-

IDA beads (ELPIS-BIOTECH) and washed with cold lysis buﬀer three

times. HSP70 that co-precipitated with DX2-His 6 was separated and

detected by SDS−PAGE and coomassie staining, respectively.

(S)-2-(4-Bromophenylsulfonamido)-3-(1H-indol-3-yl)-N-(4-

(4-methoxyphenyl)thiazol-2-yl)propanamide (21d). The title

compound was prepared from 18c and 4-(4-methoxyphenyl)thiazol-2-

amine as a colorless solid (0.12 g, 62%). Mp: 260−262 °C. ¹H NMR

(400 MHz, DMSO-d₆) δ 12.40 (s, 1H), 10.77 (s, 1H), 8.48 (s, 1H),

7.81 (d, J = 8.8 Hz, 2H), 7.48−7.37 (m, 5H), 7.27 (d, J = 8.0 Hz, 1H),

7.08−6.97 (m, 5H), 6.92 (t, J = 8.0 Hz, 1H), 4.34−4.31 (m, 1H), 3.79

Complementation Assay Using Nanoluciferase Binary

Technology. DX2 and HSP70 were cloned into pBiT1.1-N[TK/

LgBiT] and pBiT2.1-N[TK/SmBiT] to express LgBiT-tagged DX2 and

Q

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

SmBiT-tagged HSP70, respectively. A549 cells were ectopically

induced with LgBiT-DX2 and SmBiT-HSP70 and then treated with

BC-DXI-843 in a dose-dependent manner for 4 h. After incubation,

luciferase activity was measured with a nanoluciferase assay system

following the manufacturer’s protocol (Promega). For a negative

binding control, PRKACA (protein kinase A catalytic subunit) and

PKRAR2A (protein kinase A type 2A regulatory subunit) were cloned

into pBiT1.1-N[TK/LgBiT] and pBiT2.1-N[TK/SmBiT], respec-

tively, following the same experimental procedures as above. The

experiments were independently repeated three times.

Immunoprecipitation. The cells were lysed with 50 mM Tris-HCl

(pH 7.4) lysis buﬀer containing 100 mM NaCl, 0.5% Triton X-100,

0.1% SDS, 10% glycerol, 1 mM EDTA, and protease inhibitors

(Calbiochem). Total cell extracts were mixed with a DX2-speciﬁc

antibody and incubated with agarose A for 12 h. After incubation, co-

precipitates with agarose A were washed with lysis buﬀer without SDS

and subjected to SDS−PAGE and immunoblotting using speciﬁc

antibodies against the proteins of interest. To monitor the

ubiquitination of DX2, the cells were cultured in media supplemented

with MG-132 (50 μM) following the same experimental procedure

described above.

ﬂuorescence emission. Ligand stock solutions were titrated into a

protein sample dissolved in phosphate buﬀer (pH 7.4) containing 137

mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, and 2 mM KH₂PO₄.

Protein samples were excited at 280 nm, and the decrease in

ﬂuorescence emission upon ligand binding was measured at 335 nm

as a function of ligand concentration. All titration data were ﬁt to a

hyperbolic binding equation to obtain K_dvalues.

RT-PCR. Total RNA extracted by using an RNeasy Mini Kit

(Qiagen) was subjected to RT-PCR with dNTP, random hexamer, and

Moloney murine leukemia virus (MMLV). The same volume of cDNA

was used in a PCR assay to detect the mRNA expression of DX2,

AIMP2, and actin using the following speciﬁc primers: DX2,

CTGGCCACGTGCAGGATTACGGGG and AAGTGAATCCCAG-

CTGATAG; AIMP2, ATGCCGATGTACCAGGTAAAG and

CTTAAGGAGCTTGAGGGCCGT; actin, CCTTCCTGGGCATG-

GAGTCCT and GGAGCAATGATCTTGATCTT.

Statistics. Statistical tests were performed with Prism (GraphPad).

All error bars represent standard deviation (SD). For calculation of

IC₅₀, EC₅₀, and K_dvalues, we used Prism (GraphPad).

ASSOCIATED CONTENT

■

Cell Viability Assay. A549 (1.5 × 10⁴cells/mL) or WI-26 (4 × 10⁴

cells/mL) cells were cultured in 96-well, ﬂat-bottom plates for 24 h.

Diluted compounds in serum-free media were added to the cells and

incubated for 72 h. To test each compound’s DX2 dependency, stable

cells expressing DX2 upon induction with DMSO (Sigma) were

cultured in 96-well plates and treated with each compound. An amount

of 10 μL of MTT solution (5 mg/mL, Sigma) was added to the cells and

incubated for 1.5 h at 37 °C. After discarding the culture media with the

MTT solution, the precipitated formazan crystals in each well were

dissolved with 100 μL of DMSO (Duchefa). Absorbance was measured

at 560 nm using a microplate reader (Sunrise, TECAN). All

experiments were independently repeated three times.

3D Cell Culture Assay. H460 cells cultivated in 2D culture

conditions were detached using Accumax (EMD Millipore) for 3D cell

culture. Cells were counted with a disposable hemocytometer, C-Chip

(INCYTO), and diluted in media supplemented with 1% penicillin/

streptomycin and 10% FBS to a concentration of 5000 cells/100 μL.

The cells were seeded onto ultralow attachment, 96-well, 3D-culture

plates (Corning). After incubation for 48 h, spheroid, 3D-cultured

cancer cells were treated with each compound for 72 h. Cell viability

was determined using the CellTiter-Glo 3D cell viability assay

(Promega) according to the manufacturer’s instructions.

sı

* Supporting Information

The Supporting Information is available free of charge at

https://pubs.acs.org/doi/10.1021/acs.jmedchem.9b01961.

Determining the signiﬁcant residues for binding of BC-

DXI-843 to DX2 (Figure S1A,B); DX2 degradation

caused by BC-DXI-843 (Figure S1C,D); BC-DXI-843-

dependent inhibition of DX2 and HSP70 binding (Figure

S2); ¹H NMR and ¹³C NMR spectra of the ﬁnal

compounds (PDF)

Coordinates information for structure representation

(PDB)

Molecular formula strings and some data (CSV)

AUTHOR INFORMATION

■

Corresponding Authors

Sunghoon Kim − Medicinal Bioconvergence Research Center,

College of Pharmacy & College of Medicine, Gangnam Severance

Hospital, Yonsei University, Incheon 21983, Republic of Korea;

orcid.org/0000-0002-1570-3230; Phone: +82-2-880-

8180; Email: sungkim@snu.ac.kr

Xenograft. H460 cells (1 × 10⁷) were subcutaneously inoculated

into the back of 7-week-old female BALB/cSLC-nu/nu mice (Central

Lab. Animal Inc., Korea) (n = 4/group). BC-DXI-843 (50 mg/kg) was

intraperitoneally injected every other day for 15 days. The embedded

tumor volume and body weight were measured ﬁve and four times,

respectively, over the experimental period. After 15 days, all mice were

sacriﬁced, and the size and weight of the excised tumors were measured

after photos of the mice were taken. Animal experiments complied with

the University Animal Care and Use Committee guidelines at Seoul

National University.

Kyeong Lee − College of Pharmacy, Dongguk UniversitySeoul,

Goyang 10326, Republic of Korea; orcid.org/0000-0002-

5455-9956; Phone: +82-31-961-5214; Email: kaylee@

dongguk.edu

Authors

Aneesh Sivaraman − College of Pharmacy, Dongguk

UniversitySeoul, Goyang 10326, Republic of Korea

Dae Gyu Kim − Medicinal Bioconvergence Research Center,

College of Pharmacy & College of Medicine, Gangnam Severance

Hospital, Yonsei University, Incheon 21983, Republic of Korea

Deepak Bhattarai − College of Pharmacy, Dongguk University

Seoul, Goyang 10326, Republic of Korea

Docking and System Preparation for Computational

Modeling. Modeling and initial docking calculations were performed

̈

using the Schrodinger Suite molecular modeling package (version

2017-3). The default parameters were used unless otherwise noted. The

homology structure that was built in our previous study was prepared

using the Protein Preparation Wizard.²⁶First, force ﬁeld atom types and

bond orders were assigned, missing atoms were added, and tautomer/

ionization states were assigned so that their tautomers were adjusted to

optimize the hydrogen bond. Constrained energy minimization was

then performed. Typically, docking sites were explored and

characterized using the Site Map²⁷tool. On the basis of previous

binding studies using NMR, X-ray, and site-directed mutagenesis, we

prepared Grid box and docked using Glide.^28,29

Minkyoung Kim − College of Pharmacy, Dongguk University

Seoul, Goyang 10326, Republic of Korea

Hwa Young Lee − College of Pharmacy, Dongguk University

Seoul, Goyang 10326, Republic of Korea

Semi Lim − Medicinal Bioconvergence Research Center, College of

Pharmacy & College of Medicine, Gangnam Severance Hospital,

Yonsei University, Incheon 21983, Republic of Korea

Jiwon Kong − Medicinal Bioconvergence Research Center, College

of Pharmacy & College of Medicine, Gangnam Severance

Fluorescence-Based Equilibrium Binding Assay. All titration

experiments were conducted at 20 °C using a Jasco FP 6500

spectroﬂuorometer (Easton, MD, USA). Puriﬁed DX2 protein was

equilibrated with various concentrations of ligands before measuring

R

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

(7) Choi, J. W.; Kim, D. G.; Park, M. C.; Um, J. Y.; Han, J. M.; Park, S.

G.; Choi, E. C.; Kim, S. AIMP2 promotes TNFalpha-dependent

apoptosis via ubiquitin-mediated degradation of TRAF2. J. Cell Sci.

2009, 122, 2710−2715.

(8) Yum, M. K.; Kang, J. S.; Lee, A. E.; Jo, Y. W.; Seo, J. Y.; Kim, H. A.;

Kim, Y. Y.; Seong, J.; Lee, E. B.; Kim, J. H.; Han, J. M.; Kim, S.; Kong, Y.

Y. AIMP2 controls intestinal stem cell compartments and tumori-

genesis by modulating Wnt/beta-catenin signaling. Cancer Res. 2016,

76, 4559−4568.

(9) Won, Y. S.; Lee, S. W. Selective regression of cancer cells

expressing a splicing variant of AIMP2 through targeted RNA

replacement by trans -splicing ribozyme. J. Biotechnol. 2012, 158, 44−

49.

Hospital, Yonsei University, Incheon 21983, Republic of Korea;

orcid.org/0000-0003-3990-5619

Ja-il Goo − Department of Biotechnology, Korea University, Seoul

02841, Republic of Korea

Seunghwan Shim − Department of Biotechnology, Korea

University, Seoul 02841, Republic of Korea

Seungbeom Lee − College of Pharmacy, CHA University,

Gyeonggi-do 11160, Republic of Korea

Young-Ger Suh − College of Pharmacy, CHA University,

Gyeonggi-do 11160, Republic of Korea; College of Pharmacy,

Seoul National University, Seoul 08826, Republic of Korea;

orcid.org/0000-0003-1799-8607

Yongseok Choi − Department of Biotechnology, Korea University,

Seoul 02841, Republic of Korea

(10) Kim, S.; Choi, J. W. AIMP2-DX2 Gene and its Uses. US 2011/

0136119A1, 2011.

(11) Choi, J. W.; Kim, D. G.; Lee, A. E.; Kim, H. R.; Lee, J. Y.; Kwon,

N. H.; Shin, Y. K.; Hwang, S. K.; Chang, S. H.; Cho, M. H.; Choi, Y. L.;

Kim, J.; Oh, S. H.; Kim, B.; Kim, S. Y.; Jeon, H. S.; Park, J. Y.; Kang, H.

P.; Park, B. J.; Han, J. M.; Kim, S. Cancer-associated splicing variant of

tumor suppressor AIMP2/p38: pathological implication in tumori-

genesis. PLoS Genet. 2011, 7, No. e1001351.

Complete contact information is available at:

https://pubs.acs.org/10.1021/acs.jmedchem.9b01961

Author Contributions

^∇A.S. and D.G.K. contributed equally to this work.

(12) Choi, J. W.; Lee, J. W.; Kim, J. K.; Jeon, H. K.; Choi, J. J.; Kim, D.

G.; Kim, B. G.; Nam, D. H.; Kim, H. J.; Yun, S. H.; Kim, S. Splicing

variant of AIMP2 as an effective target against chemoresistant ovarian

cancer. J. Mol. Cell Biol. 2012, 4, 164−173.

(13) Jung, J. Y.; Kim, E. Y.; Kim, A.; Chang, J.; Kwon, N. H.; Moon, Y.;

Kang, E. J.; Sung, J. S.; Shim, H.; Kim, S.; Chang, Y. S. Ratio of

autoantibodies of tumor suppressor AIMP2and its oncogenic variant is

associated with clinical outcome in lung cancer. J. Cancer 2017, 8,

1347−1354.

(14) Kim, D. G.; Lee, J. Y.; Lee, J. H.; Cho, H. Y.; Kang, B. S.; Jang, S.

Y.; Kim, M. H.; Guo, M.; Han, J. M.; Kim, S. J.; Kim, S. Oncogenic

mutation of AIMP2/p38 inhibits its tumor-suppressive interaction with

Smurf2. Cancer Res. 2016, 76, 3422−3436.

(15) Kim, S.; Kim, D. G.; Lim, S. Method for Screening Anticancer

Agent Inhibiting Binding of AIMP2 - DX2 and HSP70. US

20190033295A1, 2019.

(16) Lim, S.; Cho, H. Y.; Kim, D. G.; Roh, Y.; Son, S.; Mushtaq, A. U.;

Kim, M.; Bhattarai, D.; Sivaraman, A.; Lee, Y.; Lee, J.; Yang, W. S.; Kim,

H. K.; Kim, M. H.; Lee, K.; Jeon, Y. H.; Kim, S. Targeting the

interaction of AIMP2-DX2 with HSP70 suppresses cancer develop-

ment. Nat. Chem. Biol. 2020, 16 (1), 31−41.

(17) Lee, H. S.; Kim, D. G.; Oh, Y. S.; Kwon, N. H.; Lee, J. Y.; Kim, D.;

Park, S. H.; Song, J. H.; Lee, S.; Han, J. M.; Park, B. J.; Lee, J.; Kim, S.

Chemical suppression of an oncogenic splicing variant of AIMP2

induces tumour regression. Biochem. J. 2013, 454, 411−416.

(18) Oh, A. Y.; Jung, Y. S.; Kim, J.; Lee, J. H.; Cho, J. H.; Chun, H. Y.;

Park, S.; Park, H.; Lim, S.; Ha, N. C.; Park, J. S.; Park, C. S.; Song, G. Y.;

Park, B. J. Inhibiting DX2-p14/ARF interaction exerts antitumor effects

in lung cancer and delays tumor progression. Cancer Res. 2016, 76,

4791−4804.

(19) Park, B. J.; Song, G. Y.; Oh, A. Y.; Lee, J. H.; Her, J. H. Compound

for Inhibiting Binding between DX2 Protein and p14/ARF Protein, and

Pharmaceutical Composition for Treating or Preventing Cancer

Disease Containing same as Eﬀective Ingredient. US10280178B2,

2019.

(20) Kim, S.; Kwon, N. H.; Kim, D. G. Pharmaceutical Composition

for Preventing or Treating Cancer. US9539236B2, 2017.

(21) Hou, Y.; Zhu, L.; Li, Z.; Shen, Q.; Xu, Q.; Li, W.; Liu, Y.; Gong, P.

Design, synthesis and biological evaluation of novel 7-amino-[1,2,4]-

triazolo[4,3-f]pteridinone, and 7-aminotetrazolo[1,5-f]pteridinone

derivative as potent antitumor agents. Eur. J. Med. Chem. 2019, 163,

690−709.

(22) Sengupta, S.; Rajagopalan, S.; Belavagi, N.; Ramachandra, M. 2,4-

Diaminopyrimidine Derivatives as Protein Kinase Inhibitors. WO

2012/059932Al, 2012.

Notes

The authors declare no competing ﬁnancial interest.

ACKNOWLEDGMENTS

■

This study was funded with a National Research Foundation of

Korea (NRF) grant funded by the Korea Government (MSIT)

(Grants NRF 2018R1A5A2023127 and NRF-M3A6A4-2010-

0029785).

ABBREVIATIONS USED

■

AIMP2, aminoacyl-tRNA synthetase-interacting multifunction-

al protein 2; HSP70s, 70 kDa heat shock proteins; p53,

phosphoprotein p53; TGF-β, transforming growth factor-β;

TNF-α, tumor necrosis factor-α; FBP, fuse-binding protein;

TRAF2, TNF receptor-associated factor 2; GST, Glutathione S-

transferase; DCM, dichloromethane; DMF, N,N-dimethylfor-

mamide; TEA, triethylamine; DIPEA, N,N-diisopropylethyl-

amine; EDC·HCl, 1-ethyl-3-(3-dimethylaminopropyl)-

carbodiimidehydrochloride; HOBt, hydroxybenzotriazole;

EtOH, ethanol; MeOH, methanol; EtOAc, ethyl acetate;

HRMS, high-resolution mass spectrometry; HPLC, high-

performance liquid chromatography; mp, melting point.

REFERENCES

■

(1) Kim, S.; You, S.; Hwang, D. Aminoacyl-tRNA synthetases and

tumorigenesis: more than housekeeping. Nat. Rev. Cancer 2011, 11,

708−718.

(2) Kwon, N. H.; Fox, P. L.; Kim, S. Aminoacyl- tRNA synthetases as

therapeutic targets. Nat. Rev. Drug Discovery 2019, 18, 629−650.

(3) Han, J. M.; Lee, M. J.; Park, S. G.; Lee, S. H.; Razin, E.; Choi, E. C.;

Kim, S. Hierarchical network between the components of the multi-

tRNA synthetase complex: implications for complex formation. J. Biol.

Chem. 2006, 281, 38663−38667.

(4) Park, S. G.; Choi, E. C.; Kim, S. Aminoacyl-tRNA synthetase-

interacting multifunctional proteins (AIMPs): A triad for cellular

homeostasis. IUBMB Life 2010, 62, 296−302.

(5) Han, J. M.; Park, B. J.; Park, S. G.; Oh, Y. S.; Choi, S. J.; Lee, S. W.;

Hwang, S. K.; Chang, S. H.; Cho, M. H.; Kim, S. AIMP2/p38, the

scaffold for the multi-tRNA synthetase complex, responds to genotoxic

stresses via p53. Proc. Natl. Acad. Sci. U. S. A. 2008, 105, 11206−11211.

(6) Kim, M. J.; Park, B. J.; Kang, Y. S.; Kim, H. J.; Park, J. H.; Kang, J.

W.; Lee, S. W.; Han, J. M.; Lee, H. W.; Kim, S. Downregulation of

FUSE-binding protein and c-myc by tRNA synthetase cofactor p38 is

required for lung cell differentiation. Nat. Genet. 2003, 34, 330−336.

(23) Ran, K.; Gao, C.; Deng, H.; Lei, Q.; You, X.; Wang, N.; Shi, Y.;

Liu, Z.; Wei, W.; Peng, C.; Xiong, L.; Xiao, K.; Yu, L. Identification of

S

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

pubs.acs.org/jmc

Article

novel 2-aminothiazole conjugated nitrofuran as antitubercular and

antibacterial agents. Bioorg. Med. Chem. Lett. 2016, 26, 3669−3674.

(24) Jyh Huang, J.; Chuang, S. H.; Lee, Y. E.; Huang, Y.; Lau, J.

Modulators of Hec1 Activity and Methods Therefor. US 2012/

059932Al, 2013.

(25) Park, M. C.; Jeong, H.; Son, S. H.; Kim, Y.; Han, D.; Goughnour,

P. C.; Kang, T.; Kwon, N. H.; Moon, H. E.; Paek, S. H.; Hwang, D.;

Seol, H. J.; Nam, D. H.; Kim, S. Novel morphologic and genetic analysis

of cancer cells in a 3D microenvironment identifies STAT3 as a

regulator of tumor permeability barrier function. Cancer Res. 2016, 76,

1044−1054.

(26) Sastry, G. M.; Adzhigirey, M.; Day, T.; Annabhimoju, R.;

Sherman, W. Protein and ligand preparation: parameters, protocols,

and influence on virtual screening enrichments. J. Comput.-Aided Mol.

Des. 2013, 27, 221−234.

(27) Halgren, T. A. Identifying and characterizing binding sites and

assessing druggability. J. Chem. Inf. Model. 2009, 49, 377−389.

(28) Halgren, T. A.; Murphy, R. B.; Friesner, R. A.; Beard, H. S.; Frye,

L. L.; Pollard, W. T.; Banks, J. L. Glide: a new approach for rapid,

accurate docking and scoring. 2. Enrichment factors in database

screening. J. Med. Chem. 2004, 47, 1750−1759.

(29) Friesner, R. A.; Banks, J. L.; Murphy, R. B.; Halgren, T. A.; Klicic,

J. J.; Mainz, D. T.; Repasky, M. P.; Knoll, E. H.; Shelley, M.; Perry, J. K.;

Shaw, D. E.; Francis, P.; Shenkin, P. S. Glide: a new approach for rapid,

accurate docking and scoring. 1. Method and assessment of docking

accuracy. J. Med. Chem. 2004, 47, 1739−1749.

T

https://dx.doi.org/10.1021/acs.jmedchem.9b01961

J. Med. Chem. XXXX, XXX, XXX−XXX

Article Doi

Synthesis and Structure-Activity Relationships of Arylsulfonamides as AIMP2-DX2 Inhibitors for the Development of a Novel Anticancer Therapy

DOI: 10.1021/acs.jmedchem.9b01961

Source and publish data:

Authors:

Article abstract of DOI:10.1021/acs.jmedchem.9b01961

Full text of DOI:10.1021/acs.jmedchem.9b01961

Products guided by the article

R&D Labs maybe for 34235-88-6

Relevant to this article

Hot Product