Structure-activity relationships at human and rat A2B adenosine receptors of xanthine derivatives substituted at the 1-, 3-, 7-, and 8-positions

Article abstract of DOI:10.1021/jm0104318

In the search for improved selective antagonist ligands of the A_2B adenosine receptor, which have the potential as antiasthmatic or antidiabetic drugs, we have synthesized and screened a variety of alkylxanthine derivatives substituted at the 1-, 3-, 7-, and 8-positions. Competition for ¹²⁵I-ABOPX (¹²⁵I-3-(4-amino-3-iodobenzyl)-8-(phenyl-4-oxyacetate)-1 -propylxanthine) binding in membranes of stably transfected HEK-293 cells revealed uniformly higher affinity (<10-fold) of these xanthines for human than for rat A_2B adenosine receptors. Binding to rat brain membranes expressing A₁ and A_2A adenosine receptors revealed greater A_2B selectivity over A_2A than A₁ receptors. Substitution at the 1-position with 2-phenylethyl (or alkyl/olefinic groups) and at N-3 with hydrogen or methyl favored A_2B selectivity. Relative to enprofylline 2b, pentoxifylline 35 was equipotent and 1-propylxanthine 3 was > 13-fold more potent at human A_2B receptors. Most N-7 substituents did not enhance affinity over hydrogen, except for 7-(2-chloroethyl), which enhanced the affinity of theophylline by 6.5-fold to 800 nM. The A_2B receptor affinity-enhancing effects of 7-(2-chloroethyl) vs 7-methyl were comparable to the known enhancement produced by an 8-aryl substitution. Among 8-phenyl analogues, a larger alkyl group at the 1-position than at the 3-position favored affinity at the human A_2B receptor, as indicated by 1-allyl-3-methyl-8-phenylxanthine, with a K_i value of 37 nM. Substitution on the 8-phenyl ring indicated that an electron-rich ring was preferred for A_2B receptor binding. In conclusion, new leads for the design of xanthines substituted in the 1-, 3-, 7-, and 8-positions as A_2B receptor-selective antagonists have been identified.

Full text of DOI:10.1021/jm0104318

J . Med. Chem. 2002, 45, 2131-2138
2131
Articles
Str u ctu r e-Activity Rela tion sh ip s a t Hu m a n a n d Ra t A2B Ad en osin e Recep tor s
of Xa n th in e Der iva tives Su bstitu ted a t th e 1-, 3-, 7-, a n d 8-P osition s
Soon-Ai Kim,† Melissa A. Marshall,‡ Neli Melman,† Hak Sung Kim,† Christa E. Mu¨ller,§ J oel Linden,‡ and
Kenneth A. J acobson*,†
Molecular Recognition Section, Laboratory of Bioorganic Chemistry, National Institute of Diabetes & Digestive & Kidney
Diseases, National Institutes of Health, Bethesda, Maryland 20892, Departments of Internal Medicine and Molecular
Physiology & Biological Physics, University of Virginia, Box MR4 6012, Health Science Center, Charlottesville, Virginia 22908,
and Pharmazeutisches Institut Pharmazeutische Chemie, Universita¨t Bonn, Bonn, Germany
Received September 11, 2001
In the search for improved selective antagonist ligands of the A2B adenosine receptor, which
have the potential as antiasthmatic or antidiabetic drugs, we have synthesized and screened
a variety of alkylxanthine derivatives substituted at the 1-, 3-, 7-, and 8-positions. Competition
for 125I-ABOPX (125I-3-(4-amino-3-iodobenzyl)-8-(phenyl-4-oxyacetate)-1-propylxanthine) binding
in membranes of stably transfected HEK-293 cells revealed uniformly higher affinity (<10-
fold) of these xanthines for human than for rat A2B adenosine receptors. Binding to rat brain
membranes expressing A1 and A2A adenosine receptors revealed greater A2B selectivity over
A2A than A1 receptors. Substitution at the 1-position with 2-phenylethyl (or alkyl/olefinic groups)
and at N-3 with hydrogen or methyl favored A2B selectivity. Relative to enprofylline 2b,
pentoxifylline 35 was equipotent and 1-propylxanthine 3 was >13-fold more potent at human
A2B receptors. Most N-7 substituents did not enhance affinity over hydrogen, except for 7-(2-
chloroethyl), which enhanced the affinity of theophylline by 6.5-fold to 800 nM. The A2B receptor
affinity-enhancing effects of 7-(2-chloroethyl) vs 7-methyl were comparable to the known
enhancement produced by an 8-aryl substitution. Among 8-phenyl analogues, a larger alkyl
group at the 1-position than at the 3-position favored affinity at the human A2B receptor, as
indicated by 1-allyl-3-methyl-8-phenylxanthine, with a Ki value of 37 nM. Substitution on the
8-phenyl ring indicated that an electron-rich ring was preferred for A2B receptor binding. In
conclusion, new leads for the design of xanthines substituted in the 1-, 3-, 7-, and 8-positions
as A2B receptor-selective antagonists have been identified.
In tr od u ction
Four extracellular G protein-coupled receptors for
have identified several new xanthines with improved
potency and selectivity for human A2B receptors.10,14
A
p-cyanoanilide derivative in this series, N-(4-cyanophe-
nyl)-2-[4-(2,3,6,7-tetrahydro-2,6-dioxo-1,3-dipropyl-1H-
purin-8-yl)phenoxy]acetamide) 1, was shown to be 204-,
255-, and 289-fold selective for human A2B receptors vs
human A1, A2A, and A3 receptors, although less selective
vs rat A1 and A2A receptors. Compound 1 (100 nM) was
shown to completely inhibit calcium mobilization stimu-
lated by 1 µM NECA in HEK-293 (human embryonic
kidney) cells expressing human A2B receptors.10
adenosine have been identified as follows: A1, A2A, A2B
and A3.1 A2B receptors, which are coupled to stimulation
of adenylyl cyclase2,3 and also lead to a rise in intrac-
ellular calcium,4 are involved in the control of vascular
tone,5 hepatic glucose balance,6 cell growth and gene
expression,7 mast cell degranulation,8 and intestinal
water secretion.9 Activation of A2B receptors in human
retinal endothelial cells may lead to neovascularization
by a mechanism involving increased vascular endothe-
lial growth factor expression.7 Selective xanthine an-
tagonists of the A2B receptor have recently been re-
ported.10,11 Such antagonists are potentially useful in
the treatment of asthma,12,13 intestinal disorders,9 and
diabetes (through improved glucose uptake in skeletal
muscle and suppression of glucose production in hepa-
tocytes).6
,
On the basis of adenosine receptor binding assays, we
Nonselective radioligands have been used to charac-
terize binding to recombinant human A2B receptors
overexpressed in cell lines such as HEK-293. These
include 125I-ABOPX (125I-3-(4-amino-3-iodobenzyl)-8-
(phenyl-4-oxyacetate)-1-propylxanthine),15 [3H]8-cyclo-
* To whom correspondence should be addressed. Tel.: (301)496-
9024. Fax: (301)480-8422. E-mail: kajacobs@helix.nih.gov.
† National Institutes of Health.
‡ University of Virginia.
§ Universita¨t Bonn.
10.1021/jm0104318 CCC: $22.00 © 2002 American Chemical Society
Published on Web 04/25/2002

2132 J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11
Sch em e 1. Synthesis of Xanthine Derivatives 14b-d a
Kim et al.
Sch em e 3. Synthesis of Xanthine Derivatives 64 and
65a
a
a
Reagents: (a) NaH, Cl2(CH2)2, DMF.
Reagents: (a) 10% NaOH, EtOH, R-Br; (b) NaNO2, 6 N HCl,
AcOH; (c) Na2S2O4; (d) HC(OMe)3.
(Schemes 2 and 3). The yields and characterization of
the xanthine derivatives prepared are listed in Table
2.
Sch em e 2. Synthesis of Xanthine Derivatives 19b,ca
Biology. Binding experiments were carried out using
125I-ABOPX15 for binding to recombinant human or rat
A2B receptors overexpressed in HEK-293 cells (Tables
1 and 3). The xanthines examined included those
substituted at the 1-position alone (3-8), the 3-position
alone (2b), the 1- and 3-positions (2a and 9-17), the
1-, 3-, and 7-positions (18-36), the 1- and 8-positions
(37), the 1-, 3-, and 8-positions (38-62), and the 1-, 3-,
7-, and 8-positions (63-65). At the 8-position, cycloalkyl
or aryl substituents were included. For selected deriva-
tives, binding to membranes expressing rat A1 and A2A
adenosine receptors as an indication of rat A2B selectiv-
ity was also carried out (Table 3).
Enprofylline (3-propylxanthine 2b) was previously
identified as being roughly 1 order of magnitude selec-
tive for the human A2B vs human A1 and A2A receptors.13
Surprisingly, the A2B affinity of the enprofylline isomer
(1-propylxanthine 3) was 13-fold greater than enprofyl-
line itself. Another monosubstitution was examined at
N-1: propargyl, allyl, and n-butyl analogues 4-6 dis-
played similar affinity with Ki values (equilibrium
inhibition constant) of approximately 0.5 µM, and even
the more bulky substitutents, 2-phenylethyl 7 and
cyclopentyl 8, were relatively potent with Ki values of
0.4 and 1.0 µM, respectively.
a
Reagents: (a) NaH, Br(CH2)nCl, DMF.
pentyl-1,3-dipropylxanthine,13 and [3H]4-(2-[7-amino-
2-{furyl}{1,2,4}triazolo{2,3-a}{1,3,5}triazin-5-ylamino-
ethyl)phenol.16 [3H]N-(4-Cyanophenyl)-2-[4-(2,3,6,7-tet-
rahydro-2,6-dioxo-1,3-dipropyl-1H-purin-8-yl)phenoxy]-
acetamide) 1 was recently introduced as a new selective
radioligand that bound to human A2B receptors with a
KD of 1 nM.17
In the present study, in an effort to better understand
the structure-activity relationships (SAR) of antagonist
ligands of the A2B adenosine receptor, we have screened
a variety of alkylxanthine derivatives substituted at the
1-, 3-, 7-, and 8-positions and synthesized some deriva-
tives that were designed by analysis of the biological
results obtained from screening. In this study, previ-
ously uncharacterized patterns in the SAR of rat and
human A2B receptors have been identified.
Symmetrical 1,3-substitution of xanthine with methyl
2a , ethyl 9, n-Pr 10, or allyl 11 resulted in Ki values of
roughly 1 µM at A2B receptors, while the 1,3-di-n-hexyl
derivative 12 was less potent. Among asymmetrically
substituted xanthines, the 1-ethyl-3-methyl derivative
13 was equipotent to the 1,3-diethyl analogue 9 and
elongation at the 1-position, as in 16, did not have a
significant effect. The 1-propargyl-3-methyl derivative
14a was equipotent to the 1-propargyl derivative 4.
Other 1-position substitutions were included (14b-d )
and studied in binding (Table 3). Branched alkyl chains,
in 15 and 17, reduced affinity of A2B binding. A
comparison of 6 and 16 indicated that addition of a
3-ethyl group reduced affinity 4-fold.
Resu lts
Ch em ist r y. Sixty-five xanthine derivatives (Table
1) were examined as antagonists of binding at the
human A2B adenosine receptor. Many of these ligands
had been investigated in earlier studies of A1 and A2A
receptors.14,18-25,37 Other compounds were synthesized,
based on SAR indications that arose during the course
of the present study.
Compounds 14b-d , which were substituted with
various phenylalkyl groups in the 1-position, were
synthesized in four steps (Scheme 1). Alkylation of
6-amino-1-methyluracil was performed with 10% aque-
ous NaOH and the appropriate alkyl halide. Compounds
66b-d were converted to xanthines 14b-d according
to standard procedures as reported.10,25 The synthesis
of several 8-H and 8-aryl derivatives alkylated at the
7-position, 19b, 19c, 64, and 65, was performed using
NaH and the alkyl halide in dimethylformamide (DMF)
Most N-7 substituents did not enhance affinity of
alkylxanthines over hydrogen at this position. For
example, theophylline 2a and caffeine 18 were equipo-
tent with Ki values of approximately 10 µM for the
human A2B receptor. Most other 7-position substitutions

Human and Rat Adenosine Receptors
J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11 2133

2134 J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11
Kim et al.
Ta ble 2. Synthetic Yields and Characterization of Xanthine
Derivatives
compd
formula
13H12N4O2
14H14N4O2‚0.2H2O
15H16N4O2
10H13ClN4O2
11H15ClN4O2
17H18ClN4O2
yield (%)
analysis
14b
14c
14d
19b
19c
64
C
C
C
C
C
C
44
32
60
88
95
66
32
C, H, N
C, H, N
C, H, N
C, H, N
C, H, N
HRMSa
HRMSa
65
C19H24ClN4O2
a
High-resolution mass in positive ion FAB mode determined
to be within acceptable limits. Compound 64: calcd, 345.1118;
found, 345.1110. Compound 65: calcd, 375.1588; found, 375.1573.
HPLC demonstrated >95% purity, retention times (mobile phase,
min): 64, (A) 22.69; (B) 23.63; 65, (A) 23.58; (B) 30.18.
F igu r e 1. Competition by 7-substituted xanthines for 125I-
ABOPX binding to recombinant human A2B receptors. The
indicated antagonists (see Table 1) were incubated to equilib-
rium (2 h) in 100 µL with radioligand (0.7 nM 125I-ABOPX)
and human HEK-A2B cell membranes (25 µg of membrane
protein). Each point is the mean ( SEM of triplicate deter-
minations. Where not shown, the SEM is smaller than the
symbol. Ki values derived from triplicate experiments are
summarized in Table 1.
of theophylline examined, i.e., 20-27, including charged
and heteroatom substitution, produced Ki values of 10-
20 µM. The notable exception to this pattern was
2-chloroethyltheophylline 19a (Ki value of 1.4 µM),
which displayed a 7.5-fold greater affinity than caffeine.
Homologues of 19a were also prepared and studied in
binding (Table 3). As illustrated in Figure 1, the potency
order of 7-substituted compounds was 2-Cl-ethyl 19a
> 3-Cl-propyl 19b > 4-Cl-butyl 19c. A 7-methyl group
slightly reduced the affinity of 1,3-diallylxanthine (28
vs 11). Among caffeine analogues in which the 1-sub-
stituent was modified, including charged and hetero-
atom substitution in 29-35, some variation in affinity
was observed (Ki values of 4-21 µM), with the 1-prop-
argyl analogue 29 as the most potent. The relatively
high affinity of pentoxifylline 35 (Ki ) 5.2 µM) is notable
since this compound is used therapeutically to treat
intermittent claudication. An isomer 36 was less potent
than 29.
For the 8-cyclopentyl analogues 37 and 38, the
absence of a 3-alkyl group slightly increased affinity.
An 8-phenyl substituent, well-explored as a means of
enhancing affinity at A1 and A2A receptors,19-21 gener-
ally enhanced affinity at the human A2B receptor by
Ta ble 3. Affinities of Xanthine Derivatives in Radioligand Binding Assays at Rat A1 and A2A Receptors and Selected Compounds at
Other Subtypesa-d
Ki (nM)
Ki ratio
a
b
c
compd
rA1
rA2A
rA2B
rA1/rA2B
rA2A/rA2B
1
2a
3
16.8 ( 3.6f
6920 ( 160f
3310 ( 580
12 700 ( 5600
24 300 ( 4300
8890 ( 1090
37 600 ( 8900
5570 ( 760
24 700 ( 8100
5830 ( 250
1660 ( 620
27 600 ( 3900
24 400 ( 4800
2170 ( 940
15 200 ( 1100
23 600 ( 3900
17 700 ( 3700
7.68 ( 1.46
1.0
612 ( 287f
12.8 ( 1.1
1.3
0.46
1.8
48
0.44
>10
6700 ( 320f
15 100 ( 2700
1880 ( 190
<10% (10-5
<10% (10-5
<10% (10-5
<10% (10-5
<10% (10-5
<10% (10-4
9780 ( 220
)
4
)
)
)
)
)
5e
6
7e
8
13
14a e
14b
14ce
14d
16
19a
19b
19c
37
38
51e
54
55
56
57
58
59
62
63
64e
65e
33 600 ( 7700
3190 ( 1970
2150 ( 260
2.7
0.16
5.0
16
0.31
>20
>10
10 200 ( 1500
5530 ( 610
<10% (10-4
<10% (10-4
<10% (10-4
)
)
)
15 300 ( 2000
1.6
4230 ( 1580
5390 ( 780
14 200 ( 100
18 700 ( 500
2.8
1.7
0.95
0.78
>10
<10% (10-4
)
33 300 ( 4300
1.8
500
186 ( 5
174 ( 35
0.005
1.7
3
11
302 ( 49
1920 ( 400
39.0 ( 5.2
<10% (10-5
107 ( 10
)
220 ( 11
7.46 ( 0.58
97.7 ( 2.7
17 300 ( 6500
5500 ( 760
1340 ( 680
30.3 ( 3.5
39.2 ( 10.8
757 ( 109
<10% (10-5
2720 ( 470
)
<10% (10-5
)
23 500 ( 9800
3570 ( 1360
16 700 ( 4300
35 ( 4% (10-5
1660 ( 130
)
1700 ( 90
3360 ( 530
>6
0.49
2.1
5.0
a
Displacement of specific [3H]R-PIA binding in rat brain membranes in HEK-293 cells, expressed as Ki ( SEM or percent displacement
at the indicated concentration (n ) 3-5). Displacement of specific [3H]CGS 21680 binding in rat striatal membranes, expressed as Ki
b
( SEM or percent displacement at the indicated concentration (n ) 3-5). c Rat A2B receptor expressed in HEK cells, using [125I]I-ABOPX
as radioligand. Human A3 receptor, Ki ( SEM (µM), using [125I]I-AB-MECA as radioligand: 3, 2.37 ( 0.08; 4, 3.08 ( 0.43; 5, 16.1 ( 2.9;
d
6, 4.61 ( 1.26; 7, 7.51 ( 1.64; 8, 0.639 ( 0.158; 14a , 10.9; 14b, 4.44 ( 0.89; 14c, 6.88 ( 0.47; 14d , 8.65 ( 2.73. e 5, MRS 1973; 7, MRS
1975; 14a , MRS 1980; 14c, MRS 3005; 51, MRS 1916; 64, MRS 3000; 65, MRS 1995. f Values from refs 10 and 14.

Human and Rat Adenosine Receptors
J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11 2135
be approximately an order of magnitude more selective
for human A2B vs A3 receptors, except compound 8,
which was equipotent at the two subtypes.
Discu ssion
Theophylline 2a is widely used as an antiasthmatic
drug, although its mechanism of action is uncertain. The
related xanthine, enprofylline13,14 2b, which is also
therapeutically efficacious in the treatment of asthma,
was earlier thought to act through a nonadenosine
receptor-mediated mechanism due to its low affinity at
A1 and A2A receptors. However, the discovery that
enprofylline has greater than anticipated affinity and
slight selectivity at the A2B subtype13 supports the
hypothesis that A2B receptor antagonism may contribute
to antiasthmatic activity of xanthines.12,26,27 This hy-
pothesis was strengthened by functional effects of A2B
receptor activation observed in mast cells of dog and
human.8,12,28 Thus, potent and/or selective A2B receptor
antagonists may provide new therapeutic agents.
The SAR of xanthines in binding to A2B adenosine
receptors was investigated in the present study. Sub-
stitution at the 1-position by a group larger than at the
3-position (H or Me) favored affinity at the A2B receptor.
The affinity of xanthines in binding to the human A2B
receptor was enhanced by substitution with propyl,
butyl, allyl, propargyl, or 2-phenylethyl groups at N-1,
while hydrogen or methyl at N-3 favored affinity at this
subtype.
A 7-(2-chloroethyl) substituent strikingly favored A2B
receptor selectivity. Most N-7 substituents did not
enhance affinity over hydrogen, except for 2-chloroethyl,
which enhanced the human A2B receptor affinity of
theophylline by 6.5-fold. Thus, 7-(2-chloroethyl)theo-
phylline displayed a Ki value of 800 nM. Previously, 7-(2-
chloroethyl)theophylline was noted to be slightly selec-
tive for adenosine A2A vs A1 receptors.29 At the A2B
receptor, the effects of the 7-(2-chloroethyl) group were
compatible with the enhancement produced by 8-aryl
substitution. For example, the affinity of an 8-aryl-7-
chloroethyl analogue 64 was intermediate between
those of the corresponding 7-H and 7-methyl analogues.
Compound 64 was roughly 35-fold more potent at the
human A2B receptor than the 7-methyl analogue 63 and
8-fold less potent than the 7-H analogue, 51.
F igu r e 2. Correlation in the affinities of various xanthines
for binding to human and rat A2B adenosine receptors. The
pKi values of compounds that were evaluated for binding to
rat and human receptors (Table 2) are plotted and fit by linear
regression.
roughly 20-fold. 8-Phenyltheophylline 39 (Ki value of
415 nM) displayed a 22-fold greater human A2B receptor
affinity than theophylline 2a . Substitution of the 8-phe-
nyl ring indicated that an electron-rich ring was pre-
ferred in receptor binding. The rank order of potency of
substitution at the 8-aryl ring in theophylline analogues
39-47 was 4-hydroxy > 4-dimethylamino > 4-methoxy
> 4-sulfo > 3-carboxy and 4-nitro > 2-carboxy and 2,4-
dinitro.
Homologation of 1,3-dialkyl groups in 8-phenylxan-
thines enhanced affinity, by 22-fold in the case of 1,3-
dipropyl analogue 49 in comparison to 39. As with 8-H
xanthines, a 1-allyl substitutent greatly increased af-
finity at the A2B receptor in the 8-aryl series. Thus,
1-allyl-3-methyl-8-phenylxanthine 51 displayed a Ki
value of 37 nM. Branched substitution, in 52 as before,
greatly decreased affinity. Phenyl ring-substituted ana-
logues of 49 were also tested: The electron-withdrawing
2,6-difluoro and 4-chloro groups on the 8-aromatic ring,
in 53 and 60, reduced affinity. Various di- and trisub-
stituted phenyl rings, containing electron-donating
groups, displayed considerable affinity but not exceeding
that of 49. The functionalized congener XCC (xanthine
carboxylic congener, 8-[4-[(carboxymethyl)oxy]phenyl]-
1,3-dipropylxanthine, 61), which served as the basis of
A
2B receptor-selective amide derivatives such as 1,10 was
nearly as potent as 49.
The 7-(2-chloroethyl) group of 65 decreased the af-
finity of compound 49 by 36-fold to a Ki value of 690
nM. However, in comparison to the 7-methyl modifica-
tion of 8-phenylxanthines, this group increased affinity.
Compound 64, the 7-(2-chloroethyl) derivative of the
8-phenylxanthine derivative 63, displayed a 37-fold
greater affinity at human A2B receptors.
Selected compounds were tested in binding experi-
ments at rat A2B receptors (Table 3). A close correlation
between relative potencies at human and rat A2B
receptors was found (Figure 2). Affinities were usually
higher by 2-9-fold at the human vs the rat A2B receptor,
with more pronounced differences observed for the more
potent compounds. Compound 14c, a 1-phenylethyl
derivative, showed slight A2B receptor selectivity in the
rat. The reference compound 1 was still highly potent
at the rat A2B receptor, with a Ki value of 12.8 nM,
although not selective for A2B vs A1 receptors in the rat.
Several other compounds were selective for A2B vs A2A
but not A1 receptors in the rat: 3, 14a , 14d , 19b, and
51. Selected compounds were also tested at human A3
receptors (Table 3, footnote e), and most were found to
An 8-phenyl substituent, well-explored as a means of
enhancing affinity at A1 and A2A receptors,19-24 en-
hanced affinity at A2B receptors by roughly 20-fold. The
detail in the present study concerning 8-aryl ring
substitution and compatibility with other xanthine
substituents greatly extended previous findings.10,14 As
for simpler xanthines, even in the 8-phenyl series, a
larger alkyl group at the 1-position than at the 3-posi-
tion favored affinity at the A2B receptor. This was
illustrated by 1-allyl-3-methyl-8-phenylxanthine, 51,
which displayed a Ki value of 37 nM at A2B receptors.
Substitution of the 8-phenyl ring indicated that an
electron-rich ring (e.g., 4-hydroxy substitution, 41) was
preferred in receptor binding. Consistent with this
finding, nitro and other electron-withdrawing substit-
uents greatly reduced affinity.
The initial screen of A2B receptor affinity in the
present study utilized the human subtype, and selected
compounds were also evaluated at rat A2B receptors. We

2136 J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11
Kim et al.
NMR (CDCl3): δ 3.33 (s, 3H), 5.00 (s, 1H), 5.08 (s, 2H), 7.23-
7.42 (m, 5H). MS (positive ion FAB): 232 [M + H]+.
found uniformly higher affinity of substituted xanthines
for human than for rat A2B adenosine receptors, but
these differences were consistently less than 10-fold.
Compounds having various degrees of selectivity for rat
A2B receptors were 3-7 (1-substitituted xanthines),
14a -d (1-substitituted theophyllines), 51 (1-allyl-3-
methyl-8-phenylxanthine), and 64 (1-allyl-7-chloroethyl-
3-methyl-8-phenylxanthine). The 1-phenylethyl group
appeared to enhance A2B receptor selectivity in the rat.
Selectivity for the human A2B receptor has been easier
to achieve than selectivity for the rat homologue, mainly
due to the large species differences at A1 and A2A
receptors.10 To further define the selectivity of A2B
receptor antagonists, additional characterization at
receptor homologues of various species will be needed.
In conclusion, we have identified new leads for the
design of xanthine derivatives as selective antagonists
of the A2B receptor, including asymmetric substitution
at the 1- and 3-positions, 7-haloalkyl groups, and 8-aryl
ring substitution patterns. Furthermore, the affinities
at rat and human A2B receptors have been compared.
Optimal combinations of substituents on the 1-, 3-, 7-,
and 8-positions of xanthines may lead to more potent
and selective antagonists. Such selective compounds will
aid in the elucidation of the physiological role of this
receptor and possibly lead to therapeutically useful
agents for treating asthma, diabetes, and other dis-
eases.6,10,30,31
6-Am in o-1-m et h yl-5-n it r oso-3-b en zyl-1H -p yr im id in e-
2,4-d ion e (67b). Compound 66b (53 mg, 0.23 mmol) was
dissolved in a mixed solvent of water (1 mL), acetic acid (0.2
mL), and 6 N HCl (0.05 mL) and treated with NaNO2 (24 mg,
0.35 mmol) in small portions over a period of 10 min. The
mixture was filtered, and the filter cake was washed with
water to afford 67b (30 mg, 50%) as a violet solid. 1H NMR
(DMSO-d6): δ 3.25 (s, 3H), 5.10 (s, 2H), 7.23-7.40 (m, 5H).
MS (positive ion FAB): 261 [M + H]+.
1-Ben zyl-3-m eth ylxa n th in e (14b). Sodium hydrosulfite
(120 mg, 0.69 mmol) was added in small portions to a
suspension of 67b (30 mg, 0.12 mmol) in ethyl acetate (4 mL)
and water (2 mL), until the violet color disappeared. The
organic layer was separated, and the aqueous layer was
extracted with ethyl acetate (2 × 10 mL). The combined
organic layer was washed with brine and dried over sodium
sulfate, filtered, and evaporated under reduced pressure to
dryness. The crude product was suspended in trimethylortho-
formate (2 mL) and refluxed for 2 h. Trimethylorthoformate
was removed by a nitrogen stream, and the residue was
purified by preparative TLC (chloroform:methanol ) 10:1). The
solid was recrystallized from ethyl acetate/hexane to furnish
xanthine 14b (13 mg, 44%) as a white solid having a mp 224-
1
226 °C. H NMR (CDCl3): δ 3.65 (s, 3H), 5.28 (s, 2H), 7.27-
7.35 (m, 3H) 7.49 (d, 2H, J ) 6.6 Hz), 7.73 (s, 1H), 11.93 (bs,
1H). MS (positive ion FAB): 257 [M + H]+.
6-Am in o-1-m et h yl-3-p h en et h yl-1H-p yr im id in e-2,4-d i-
on e (66c). Compound 66c was prepared by the procedure
described for 66b, except using ethanol as solvent, instead of
methanol, and obtained in 21% yield. 1H NMR (CDCl3): δ 2.91
(m, 2H), 3.42 (s, 3H), 4.12 (m, 2H), 4.56 (bs, 2H), 5.00 (s, 1H),
7.20-7.31 (m, 5H). MS (positive ion FAB): 246 [M + H]+.
6-Am in o-1-m eth yl-5-n itr oso-3-ph en eth yl-1H-pyr im idin e-
2,4-d ion e (67c). Compound 67c was prepared by the proce-
Exp er im en ta l Section
Syn th etic Meth ods. 1H nuclear magnetic resonance (NMR)
spectra were obtained with a Varian Gemini-300 spectrometer
using CDCl3 or DMSO-d6 as solvent. The chemical shifts are
expressed as parts per million (ppm) downfield from tetram-
ethylsilane or as relative ppm from CDCl3 (7.27 ppm) and
dimethyl sulfoxide (DMSO) (2.5 ppm). FAB (fast atom bom-
bardment) mass spectrometry was performed with a J EOL
SX102 spectrometer using 6-kV Xe atoms. CI-NH3 (chemical
ionization) mass spectra were carried out with a Finnigan 4600
mass spectrometer. Elemental analysis ((0.4% acceptable) was
performed by Atlantic Microlab Inc. (Norcross, GA). All melting
points were determined with a Unimelt capillary melting point
apparatus (Arthur H. Thomas Co., PA) and were uncorrected.
All xanthine derivatives were homogeneous as judged using
thin-layer chromatography (TLC) (MK6F silica, 0.25 mm, glass
backed; Whatman, Clifton, NJ ). Where needed, determinations
of purity were performed with a Hewlett-Packard 1090 high-
performance liquid chromatography (HPLC) system using an
SMT OD-5-60 C18 analytical column (250 mm × 4.6 mm,
Separation Methods Technologies, Inc., Newark, DE) in two
different linear gradient solvent systems. One solvent system
(A) was 0.1 M triethylammonium acetate buffer:CH3CN in
ratios of 80:20 to 20:80 in 30 min with a flow rate of 1 mL/
min. The other (B) was H2O:CH3OH in ratios of 60:40 to 10:
90 in 30 min, 10:90 after 30 min, with a flow rate of 1 mL/
min. Peaks were detected by UV absorption (250 nm) using a
diode array detector.
1
dure described for 67b in 51% yield. H NMR (DMSO-d6): δ
2.88 (t, 2H, J ) 7.8 Hz), 3.26 (s, 3H), 4.10 (t, 2H, J ) 8.0 Hz),
7.20-7.38 (m, 5H). MS (positive ion FAB): 275 [M + H]+.
3-Meth yl-1-(2-p h en yleth yl)xa n th in e (14c). Compound
14c was prepared by the procedure described for 14b in 32%
1
yield; mp 240-243 °C. H NMR (CDCl3): δ 2.97 (m, 2H), 3.66
(s, 3H), 4.29 (m, 2H), 7.22-7.29 (m, 2H) 7.32 (d, 3H, J ) 4.4
Hz), 7.78 (s, 1H), 11.45 (bs, 1H). MS (positive ion FAB): 271
[M + H]+.
6-Am in o-1-m eth yl-3-(3-p h en yl-p r op yl)-1H-p yr im id in e-
2,4-d ion e (66d ). Compound 66d was prepared by the proce-
1
dure described for 66c in 45% yield. H NMR (CDCl3): δ 1.97
(m, 2H), 2.68 (t, 2H, J ) 8.0 Hz), 3.39 (s, 3H), 3.97 (t, 2H, J )
7.4 Hz), 4.45 (bs, 2H), 4.97 (s, 1H), 7.10-7.28 (m, 5H). MS
(positive ion FAB): 260 [M + H]+.
6-Am in o-1-m et h yl-5-n it r oso-3-(3-p h en yl-p r op yl)-1H -
p yr im id in e-2,4-d ion e (67d ). Compound 67d was prepared
by the procedure described for 67b in 78% yield. 1H NMR
(DMSO-d6): δ 1.91 (m, 2H), 2.66 (t, 2H, J ) 7.7 Hz), 3.22 (s,
3H), 3.95 (t, 2H, J ) 7.3 Hz), 7.11-7.30 (m, 5H). MS
(CI/NH3): 289 [M + H]+.
3-Meth yl-1-(3-p h en ylp r op yl)xa n th in e (14d ). Compound
14d was prepared by the procedure described for 14b in 60%
1
yield; mp 176-180 °C. H NMR (CDCl3): δ 2.06 (quintet, 2H,
J ) 7.4 Hz), 2.75 (t, 2H, J ) 7.4 Hz), 3.63 (s, 3H), 4.14 (t, 2H,
J ) 7.4 Hz), 7.12-7.30 (m, 5H), 7.74 (s, 1H), 12.28 (bs, 1H).
MS (positive ion FAB): 285 [M + H]+.
6-Am in o-1-m et h yl-3-b en zyl-1H -p yr im id in e-2,4-d ion e
(66b). To a suspension of 6-amino-1-methyluracil (706 mg, 5
mmol) in methanol (15 mL) was added 10% aqueous NaOH
solution (2 mL, 5 mmol) and benzyl bromide (0.65 mL, 5.5
mmol). The reaction mixture was refluxed for 3 h and
quenched by the addition of saturated NH4Cl solution. The
solvent was evaporated under reduced pressure, and the
residue was diluted with chloroform (50 mL). The organic
phase was washed with water and brine and dried over sodium
sulfate, filtered, and evaporated under reduced pressure. The
residue was purified by flash column chromatography (silica,
chloroform:methanol ) 10:1) to give 97 mg of 66b (33%, based
7-(3-Ch lor op r op yl)th eop h yllin e (19b). Sodium hydride
(24 mg, 60% in mineral oil, 0.61 mmol) was added to a solution
of theophylline (100 mg, 0.56 mmol) in DMF (2 mL), and the
reaction mixture was stirred at room temperature for 10 min.
1-Bromo-3-chloropropane (0.07 mL, 0.70 mmol) was then
added dropwise. The reaction mixture was stirred at room
temperature for 24 h, and the solvent was removed by a
nitrogen stream. The residue was purified using preparative
TLC (ethyl acetate:hexane:methanol ) 10:10:1) to give 19b
(126 mg, 88%) as a white solid. The solid was recrystallized
from ethyl acetate/n-hexane; mp 122-124 °C. 1H NMR
1
on recovered starting material) as a white foaming solid. H

Human and Rat Adenosine Receptors
J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11 2137
(CDCl3): δ 2.39 (m, 2H), 3.42 (s, 3H), 3.50 (t, 2H, J ) 5.9 Hz),
3.61 (s, 3H), 4.49 (t, 2H, J ) 6.5 Hz), 7.62 (s, 1H). MS (positive
ion FAB): 257 [M + H]+.
Radioligand binding experiments were performed in triplicate
with 20-25 µg of membrane protein in a total volume of 0.1
mL of HE buffer (10 mM HEPES and 1 mM EDTA, pH 7.4)
supplemented with 1 U/mL adenosine deaminase and 5 mM
MgCl2. Nonspecific binding was measured in the presence of
100 µM NECA. Xanthine derivatives for competition assays
were diluted in HE buffer with 10% DMSO. The incubation
time was 3 h at 21 °C. Competition experiments were carried
out using between 0.5 and 1.0 nM 125I-ABOPX. Membranes
were filtered on Whatman GF/C filters using a Brandel cell
harvester (Gaithersburg, MD) and washed three times during
15-20 s with ice-cold buffer (10 mM Tris, 1 mM MgCl2, pH
7.4). Ki values for different compounds were derived from IC50
values as described, assuming a KD value for 125I-ABOPX of
36 nM at the human A2B receptor. Data from replicate
experiments were tabulated as means ( SEM. Nonspecific
binding, measured in the presence of 100 µM NECA (RBI-
Sigma, St. Louis, MO), was 25% of total binding. All nonra-
dioactive compounds were initially dissolved in DMSO and
diluted with buffer to the final concentration, with the amount
of DMSO in the final assay tubes consistently e0.5%.
7-(4-Ch lor obu tyl)th eop h yllin e (19c). Compound 19c was
prepared by the procedure described for 19b in 95% yield; mp
1
115-117 °C. H NMR (CDCl3): δ 1.81 (m, 2H), 2.07 (m, 2H),
3.42 (s, 3H), 3.57 (t, 2H, J ) 6.3 Hz), 3.60 (s, 3H), 4.35 (t, 2H,
J ) 7.1 Hz), 7.56 (s, 1H). MS (positive ion FAB): 271 [M +
H]+.
1-Allyl-7-ch lor oeth yl-3-m eth yl-8-p h en ylxa n th in e (64).
Sodium hydride (10 mg, 60% in mineral oil, 0.25 mmol) was
added dropwise to a solution of 1-allyl-3-methyl-8-phenylxan-
thine 5136 (6 mg, 0.02 mmol) in DMF (1 mL), and the reaction
mixture was stirred at room temperature for 10 min. 1,2-
Dichloroethane (0.05 mL, 0.6 mmol) was added, and the
reaction mixture was stirred at 70 °C for 36 h. The solvent
was removed by a nitrogen stream. The residue was purified
using preparative TLC (dichloromethane:2-propanol ) 100:1)
1
to give 64 (4.8 mg, 70%) as a white solid; mp 130-133 °C. H
NMR (CDCl3): δ 3.66 (s, 3H), 3.94 (t, 2H, J ) 6.0 Hz) 4.66 (t,
2H, J ) 6.3 Hz) 4.68 (d, 2H, J ) 5.5 Hz) 5.22 (dd, 1H, J )
10.2, 1.1 Hz) 5.31 (dd, 1H, J ) 17.3, 1.1 Hz) 5.96 (m, 1H) 7.54-
7.56 (m, 3H) 7.64-7.68 (m, 2H). High-resolution MS (positive
ion FAB) calcd for C17H18ClN4O2 [M + H]+, 345.1118; found,
345.1110. HPLC indicated 99% purity (retention times (min):
A, 22.7; B, 23.6).
For competition experiments, at least six different concen-
trations of competitor, spanning 3 orders of magnitude ad-
justed appropriately for the IC50 of each compound, were
used. IC50 values, calculated with the nonlinear regression
method implemented in the Prism program (GraphPAD, San
Diego, CA), were converted to apparent Ki values.33 Equilib-
rium binding competition experiments at rat A1, rat A2A, and
human A3 adenosine receptors were carried out as previously
reported.34-36
7-Ch lor oeth yl-1,3-d ip r op yl-8-p h en ylxa n th in e (65). To
a solution of 1,3-dipropyl-8-phenylxanthine 4925 (13 mg, 0.042
mmol) in DMF (2 mL) was added NaH (18 mg, 60% in mineral
oil, 0.45 mmol), and the reaction mixture was stirred for 10
min at room temperature. 1,2-Dichloroethane (0.10 mL, 1.27
mmol) was added dropwise, and the reaction mixture was
stirred at 70 °C for 48 h. The solvent was removed by a
nitrogen stream. The residue was purified using preparative
TLC (dichloromethane:2-propanol ) 100:1) to give 65 (5.0 mg,
32%) as a white solid; mp 128-132 °C. 1H NMR (CDCl3): δ
1.09 (t, 3H, J ) 7.4 Hz), 1.10 (t, 3H, J ) 7.7 Hz), 1.82 (m, 2H),
1.95 (m, 2H), 4.06 (t, 2H, J ) 6.3 Hz), 4.11 (dd, 2H, J ) 7.4,
7.7 Hz), 4.23 (dd, 2H, J ) 7.7, 7.4 Hz), 4.74 (t, 2H, J ) 6.2
Hz), 7.64-7.66 (m, 3H), 7.74-7.77 (m, 2H). High-resolution
MS (positive ion FAB) calcd for C19H24ClN4O2 [M + H]+,
375.1588; found, 375.1573. HPLC indicated 96% purity (reten-
tion times (min): A, 23.6; B, 30.2).
P h a r m a cologica l Meth od s. Clon in g of A2B Recep tor .
The rat A2B receptor was cloned by Dr. Eric Yuan-J i Day
(University of Virginia) by the following method: Sprague-
Dawley rats were euthanized with an overdose of pentobar-
bital. The urinary bladders were removed and stored in
RNALater (Qiagen). mRNA was extracted from rat bladder
tissue using a Qiagen mRNA extraction kit. The rat A2B
receptor was amplified by RT-polymerase chain reaction (PCR)
with the forward primer GGCCATGCAGCTAGAGACGCAG-
GAC and reverse primer TAGGTCACAAGCTCAGACTGA and
then cloned into TOPO2.1 and confirmed by sequencing. The
confirmed PCR product was then subcloned in a pDouble-
Trouble vector using the restriction enzyme sites for HindIII
and ECoRV.
Stable Tr an sfection . HEK-293 cells were grown in DMEM/
F12 with 10% fetal bovine serum (FBS) and 1% penicillin/
streptomycin to 50% confluence in six well dishes. Cells were
transfected with 2 µg of plasmid DNA and 5 µL of lipo-
fectamine in accordance with the manufacturer’s instructions
(GibcoBRL). Transfected cells were grown for 48 h prior to
selection by the addition of 1 mg/mL G418 in the medium.
Resistant colonies were isolated and screened using radioli-
gand binding with 125I-ABOPX. Clonal lines with high specific
binding were expanded and maintained in 0.5 mg/mL G418.
Several clones with expression levels of approximately 20 000
fmol/mg were preserved. The average KD for 125I-ABOPX for
the rat A2B receptor was determined to be 40.9 nM (SEM )
4.4, n ) 7).
Ack n ow led gm en t. We thank Dr. J ohn Daly (NID-
DK) for helpful discussions and for the gift of xanthine
derivatives.
Refer en ces
(1) Linden, J .; J acobson, K. A. Molecular biology of recombinant
adenosine receptors. In Cardiovascular Biology of Purines;
Burnstock, G., Dobson, J . G., Liang, B. T., Linden, J ., Eds.;
Kluwer: Norwell, MA, 1998; pp 1-20.
(2) Daly, J . W.; Butts-Lamb, P.; Padgett, W. Subclasses of adenosine
receptors in the central nervous system: interaction with
caffeine and related methylxanthines. Cell. Mol. Neurobiol. 1983,
3, 69-80.
(3) Hide, I.; Padgett, W. L.; J acobson, K. A.; Daly, J . W. A2A
-
Adenosine receptors from rat striatum and rat pheochromocy-
toma PC12 cells: Characterization with radioligand binding and
by activation of adenylate cyclase. Mol. Pharmacol. 1992, 41,
352-359.
(4) Feoktistov, I.; Murray, J . J .; Biaggioni, I. Positive modulation
of intracellular Ca2+ by adenosine A2B, prostacyclin and pros-
taglandin E2 receptors via a cholera toxin-sensitive mechanism
in human erythroleukemia cells. Mol. Pharmacol. 1994, 45,
1160-1167.
(5) Rubino, A.; Ralevic, V.; Burnstock, G. Contribution of P1-(A2B
subtype) and P2-purinoceptors to the control of vascular tone
in the rat isolated mesenteric arterial bed. Br. J . Pharmacol.
1995, 115, 648-652.
(6) Harada, H.; Asano, O.; Hoshino, Y.; Yoshikawa, S.; Matsukura,
M.; Kabasawa, Y.; Niijima, J .; Kotake, Y.; Watanabe, N.;
Kawata, T.; Inoue, T.; Horizoe, T.; Yasuda, N.; Minami, H.;
Nagata, K.; Murakami, M.; Nagaoka, J .; Kobayashi, S.; Tanaka,
I.; Abe, S. 2-Alkynyl-8-aryl-9-methyladenines as novel adenosine
receptor antagonists: Their synthesis and structure-activity
relationships toward hepatic glucose production induced via
agonism of the A2B receptor. J . Med. Chem. 2001, 44, 170-179.
(7) Grant, M. B.; Tarnuzzer, R. W.; Caballero, S.; Ozeck, M. J .;
Davis, M. I.; Spoerri, P. E.; Feoktistov, I.; Biaggioni, I.; Shryock,
J . C.; Belardinelli, L. Adenosine receptor activation induces
vascular endothelial growth factor in human retinal endothelial
cells. Circ. Res. 1999, 85, 699-706.
(8) Auchampach, J . A.; J in, J .; Wan, T. C.; Caughey, G. H.; Linden,
J . Canine mast cell adenosine receptors: cloning and expression
of the A3 receptors and evidence that degranulation is mediated
by the A2B receptor. Mol. Pharmacol. 1998, 52, 846-860.
(9) Strohmeier, G. R.; Reppert, S. M.; Lencer, W. I.; Madara, J . L.
The A2B adenosine receptor mediates cAMP responses to ad-
enosine receptor agonists in human intestinal epithelia. J . Biol.
Chem. 1995, 270, 2387-2394.
Bin d in g Assa ys. Membranes from HEK-293 cells stably
expressing the human or rat A2B receptor were used for
competition binding assays with 125I-ABOPX (2200 Ci/mmol).10,32

2138 J ournal of Medicinal Chemistry, 2002, Vol. 45, No. 11
Kim et al.
(10) Kim, Y.-C.; J i, X.-D.; Melman, N.; Linden, J .; J acobson, K. A.
Anilide derivatives of an 8-phenylxanthine carboxylic congener
are highly potent and selective antagonists at human A2B
adenosine receptors. J . Med. Chem. 2000, 43, 1165-1172.
(11) de Zwart, M.; Vollinga, R. C.; von Frijtag Drabbe Ku¨nzel, J . K.;
Beukers, M.; Sleegers, D.; IJ zerman, A. P. Potent antagonists
for the Human Adenosine A2B receptor. Derivatives of the
triazolotriazine adenosine receptor antagonist ZM241385 with
high affinity. Drug Dev. Res. 1999, 48, 95-103.
(25) Mu¨ller, C. E.; Shi, D.; Manning, M., J r.; Daly, J . W. Synthesis
of paraxanthine analogues (1,7-disubstituted xanthines) and
other xanthines unsubstituted at the 3-position: structure-
activity relationships at adenosine receptors. J . Med. Chem.
1993, 36, 3341-3349.
(26) Feoktistov, I.; Polosa, R.; Holgate, S. T.; Biaggioni, I. Adenosine
A2B receptors: a novel therapeutic target in asthma? Trends
Pharmacol. Sci. 1998, 19, 148-153.
(27) Fozard, J . R.; Hannon, J . P. Adenosine receptor ligands: poten-
tial as therapeutic agents in asthma and COPD. Pulm. Phar-
macol. Ther. 1999, 12, 111-114.
(12) Feoktistov, I.; Biaggioni, I. Adenosine A2B Receptors. Pharmacol.
Rev. 1997, 49, 381-402.
(13) Robeva, A. S.; Woodard, R.; J in, X.; Gao, Z.; Bhattacharya, S.;
Taylor, H. E.; Rosin, D. L.; Linden, J . Molecular characterization
of recombinant human adenosine receptors. Drug Dev. Res. 1996,
39, 243-252.
(14) J acobson, K. A.; IJ zerman, A. P.; Linden, J . 1,3-Dialkylxanthine
derivatives having high potency as antagonists at human A2B
adenosine receptors. Drug Dev. Res. 1999, 47, 45-53.
(15) Linden, J . Molecular characterization of A2A and A2B receptors.
Drug Dev. Res. 1998, 43, 2.
(28) Kirshenbaum, A. S.; Hettinger, B.; Day, Y.-J .; Gilfillan, A. M.;
Metcalfe, D. D.; Kim, Y.-C.; Linden, J .; J acobson, K. A. MRS
1754, a Selective A2B Adenosine Receptor Antagonist, Inhibits
Degranuilation of Cultured Human but Not Murine Mast Cells.
American Academy of Allergy, Asthma, and Immunology 57th
Annual Meeting, New Orleans, LA, 2001; abstr. 20000803.
(29) Coffin, V. L.; Spealman, R. D. Psychomotor-stimulant effects of
3-isobutyl-1-methylxanthine: comparison with caffeine and 7-(2-
chloroethyl)theophylline. Eur. J . Pharmacol. 1989, 170, 35-40.
(30) Cristalli, G. Synthesis and characterization of potent ligands at
human recombinant adenosine receptors. Drug Dev. Res. 1998,
43, 23.
(31) Feoktistov, I.; Goldstein, A. E.; Biaggioni, I. Cyclic AMP and
protein kinase A stimulate Cdc42: role of A2 adenosine receptors
in human mast cells. Mol. Pharmacol. 2000, 58, 903-910.
(32) Linden, J .; Thai, T.; Figler, R.; J in, X.; Robeva, A. S. Charac-
terization of human A2B adenosine receptors: radioligand bind-
ing, western blotting, and coupling to Gq in human embryonic
kidney 293 cells and HMC-1 mast cells. Mol. Pharmacol. 1999,
56, 705-713.
(16) J i, X.-d.; J acobson, K. A. Use of the triazolotriazine [3H]-
ZM241385 as a radioligand at recombinant human A2B adenos-
ine receptors. Drug Des. Discovery 1999, 16, 217-226.
(17) J i, X.-d.; Kim, Y.-C.; Ahern, D. G.; Linden, J .; J acobson, K. A.
[3H]MRS 1754, a selective antagonist radioligand for A2B ad-
enosine receptors. Biochem. Pharmacol. 2001, 61, 657-663.
(18) Daly, J . W.; Hide, I.; Mu¨ller, C. E.; Shamim, M. Caffeine
analogues: structure-activity relationships at adenosine recep-
tors. Pharmacology 1991, 42, 309-321.
(19) Shamim, M. T.; Ukena, D.; Padgett, W. L.; Daly, J . W. Effects
of 8-phenyl and 8-cycloalkyl substituents on the activity of
mono-, di-, and trisubstituted alkylxanthines with substitution
at the 1-, 3-, and 7-positions. J . Med. Chem. 1989, 32, 1231-
1237.
(33) Linden, J . Calculating the dissociation constant of an unlabeled
compound from the concentration required to displace radiolabel
binding by 50%. J . Cycl. Nucl. Res. 1982, 8, 163-172.
(34) Schwabe, U.; Trost, T. Characterization of adenosine receptors
in rat brain by (-) [3H]N6-phenylisopropyladenosine. Naunyn-
Schmiedeberg’s Arch. Pharmacol. 1980, 313, 179-187.
(35) J arvis, M. F.; Schutz, R.; Hutchison, A. J .; Do, E.; Sills, M. A.;
Williams, M. [3H]CGS 21680, an A2 selective adenosine receptor
agonist directly labels A2 receptors in rat brain tissue. J .
Pharmacol. Exp. Ther. 1989, 251, 888-893.
(20) J acobson, K. A.; de la Cruz, R.; Schulick, R.; Kiriasis, L.; Padgett,
W.; Pfleiderer, W.; Kirk, K. L.; Neumeyer, J . L.; Daly, J . W.
8-Substituted xanthines as antagonists at A1- and A2-adenosine
receptors. Biochem. Pharmacol. 1988, 37, 3653-3661.
(21) Shamim, M. T.; Ukena, D.; Padgett, W. L.; Hong, O.; Daly, J .
W. 8-Aryl-and 8-cycloalkyl-1,3-dipropylxanthines: further potent
and selective antagonists for A1-adenosine receptors. J . Med.
Chem. 1988, 31, 613-617.
(22) Ukena, D.; Shamim, M. T.; Padgett, W. L.; Daly, J . W. Analogues
of caffeine: antagonists with selectivity for A2 adenosine recep-
tors. Life Sci. 1986, 39, 743-750.
(36) Olah, M. E.; Gallo-Rodriguez, C.; J acobson, K. A.; Stiles, G. L.
[
125I]AB-MECA,
a high affinity radioligand for the rat A3
adenosine receptor. Mol. Pharmacol. 1994, 45, 978-982.
(37) Daly, J . W.; Padgett, W. L.; Shamim, M. T.; Butts-Lamb, P.;
Waters, J . 1,3-Dialkyl-8-(p-sulfophenyl)xanthines: Potent water-
soluble antagonists for A1- and A2-adenosine receptors. J . Med.
Chem. 1985, 28, 487-492.
(23) Daly, J . W.; Padgett, W. L.; Shamim, M. T. Analogues of 1,3-
dipropyl-8-phenylxanthine: enhancement of selectivity at A1-
adenosine receptors by aryl substituents. J . Med. Chem. 1986,
29, 1520-1524.
(24) Daly, J . W.; Padgett, W. L.; Shamim, M. T. Analogues of caffeine
and theophylline: effect of structural alterations on affinity at
adenosine receptors. J . Med. Chem. 1986, 29, 1305-1308.
J M0104318