Cross-utilization of b-galactosides and cellobiose in Geobacillus stearothermophilus

JBC Papers in Press. Published on June 3, 2020 as Manuscript RA120.014029

The latest version is at https://www.jbc.org/cgi/doi/10.1074/jbc.RA120.014029

Growth of G. stearothermophilus on galactosides & cellobiose

Cross-utilization of β-galactosides and cellobiose in Geobacillus stearothermophilus

Smadar Shulami^1#, Arie Zehavi^1#, Valery Belakhov², Rachel Salama¹, Shifra Lansky³, Timor Baasov², Gil

Shoham³* and Yuval Shoham¹*

¹Department of Biotechnology and Food Engineering, Technion-Israel Institute of Technology, Haifa,

Israel 32000

²Schulich Faculty of Chemistry, Technion - Israel Institute of Technology, Haifa 32000, Israel.

³Institute of Chemistry and the Laboratory for Structural Chemistry and Biology, The Hebrew University

of Jerusalem, Jerusalem 91904, Israel.

# These authors contributed equally to this work.

*Corresponding authors: Yuval Shoham, E-mail: yshoham@technion.ac.il ; Gil Shoham,

gil2@mail.huji.ac.il

Running title: Growth of G. stearothermophilus on galactosides & cellobiose

Keywords: glycoside hydrolases; 6-phospho-β-galactosidase; 6-phospho-β-glucosidase; PTS system; G.

stearothermophilus; galactose; galactosyl-glycerol; lactose; ABC transport system; bacterial metabolism;

cellobiose

1

Growth of G. stearothermophilus on galactosides & cellobiose

galactan (1-3). Utilization of these polysaccharides

Abstract

include

extracellular

and

intracellular

Strains of the Gram-positive, thermophilic

bacterium Geobacillus stearothermophilus possess

elaborate systems for the utilization of

hemicellulolytic polysaccharides, including xylan,

arabinan, and galactan. These systems have been

studied extensively in strains T-1 and T-6,

representing microbial models for the utilization of

soil polysaccharides, and many of their

components have been characterized both

biochemically and structurally. Here, we

hemicellulolytic enzymes, ATP-binding cassette

(ABC) sugar-transport systems, carbohydrate

sensing systems, sugar metabolism enzymes and

regulatory proteins (4-8). A major challenge for

soil bacteria in the natural environment is to sense

the scarce carbon sources and compete on these

sources with nearby microorganisms. Indeed, we

have demonstrated that G. stearothermophilus

employs a unique strategy for the efficient

utilization of polysaccharides in its immediate

environment. First, it utilizes two- or three-

component systems to sense minute amounts of

mono- or di-saccharides in the surrounding, which

signal the presence of the corresponding

characterized

stearothermophilus

routes

by

which

mono-

G.

and

utilizes

disaccharides such as galactose, cellobiose, lactose,

and galactosyl-glycerol. The G. stearothermophilus

genome

encodes

a

phosphoenolpyruvate

polysaccharides (2,9).

The two- or three-

carbohydrate phospho-transferase system (PTS) for

cellobiose. We found that the cellobiose-PTS

system is induced by cellobiose and characterized

the corresponding GH1 6-phospho-β-glucosidase,

Cel1A. The bacterium also possesses two transport

systems for galactose, a galactose-PTS system and

an ABC galactose transporter. The ABC galactose

transport system is regulated by a three-component

sensing system. We observed that both systems, the

sensor and the transporter, utilize galactose-binding

proteins that also bind glucose with the same

affinity. We hypothesize that this allows the cell to

control the flux of galactose into the cell in the

presence of glucose. Unexpectedly, we discovered

that G. stearothermophilus T-1 can also utilize

lactose and galactosyl-glycerol via the cellobiose-

PTS system together with a bifunctional 6-

component sensing systems then activate dedicated

ABC sugar transporters that transfer the sugars into

the cell and induce the corresponding systems for

expressing extracellular endo-type glycoside

hydrolases that partially degrade the high

molecular weight polysaccharides into short

(usually decorated) oligosaccharides. Additional

ABC transporters for oligosaccharides transporters

transfer the large oligosaccharides into the cell, and

those are further hydrolyzed into sugar monomers

by a battery of specific intracellular glycoside

hydrolases (10-16). This utilization strategy allows

the bacterium to a) react rapidly to presence of

potential polysaccharides such as xylan, arabinan

and galactan in the immediate environment; b)

transfer efficiently the degradation products into

the bacterium cell; c) almost exclusively utilize the

degraded decorated oligosaccharides, since these

are rarely imported by other organisms. Essentially

the same strategy was recently demonstrated for

the utilization of yeast mannan by the human gut

phospho-β-galactosidase/glucosidase,

Gan1D.

Growth curves of strain T-1 growing in the

presence of cellobiose, with either lactose or

galactosyl-glycerol, revealed initially logarithmic

growth on cellobiose and then linear growth

supported by the additional sugars. We conclude

that Gan1D allows the cell to utilize residual

Bacteroidetes and was coined

a

“selfish

mechanism” (17).

In addition to the complete utilization

machinery for xylan, arabinan and galactan,

G. stearothermophilus also possesses scavenging

mechanisms for the utilization of mono- or di-

saccharides that are often found in the

surroundings, resulting from the extensive

degradation of the corresponding polysaccharides

by other soil microorganisms. In this case, the

sugars are imported by the bacterium into the cell

galactose-containing

disaccharides,

taking

advantage of the promiscuity of the cellobiose-PTS

system.

Introduction

Geobacillus stearothermophilus T-1 is

a

thermophilic, Gram-positive, soil bacterium, which

is capable of utilizing plant cell-wall derived

polysaccharides, including xylan, arabinan and

via

a

different type of transporters, the

phosphoenolpyruvate-dependent

phospho-

2

Growth of G. stearothermophilus on galactosides & cellobiose

transferase systems (PTS). The PTS systems

mutans (32%). Adjacent to the operon lays the celR

gene encoding for a transcriptional regulator

belonging to the GntR family. The genes for the EI

and HPr proteins are located elsewhere on the

chromosome.

usually use phosphoenolpyruvate (PEP) as the

phosphoryl donor for sugar phosphorylation,

together with three essential catalytic entities,

termed enzyme I, enzyme II, and HPr (heat-stable,

histidine-phosphorylatable protein) (18). During

their import via the PTS systems, sugars are

simultaneously phosphorylated at the C6 hydroxyl

group of the terminal sugar unit at the non-reducing

end, and are further cleaved (inside the cell) by

dedicated 6-phospho-β-glycosidases/galactosidases

(19).

In the present study, we identified in

G. stearothermophilus strain T-1 such PTS systems

for cellobiose and galactose, and biochemically

characterized the corresponding enzymes involved.

These are the 6-phospho-β-galactosidase Gan1D,

belonging to glycoside hydrolase (GH) family

GH1, and the 6-phospho-β-glycosidase Cel1A

belonging also to family GH1. In addition, we

demonstrate that the bacterium can utilize the β-

galactosides lactose and galactosyl-glycerol, using

the cellobiose PTS system together with the

bifunctional 6-phospho-β-galactosidase, Gan1D.

mRNA expression of cellobiose utilizing genes

G. stearothermophilus T-1 is unable to grow on

cellulose but grows very well on cellobiose. To test

whether the celBCD, celA and celR genes are

involved in cellobiose utilization, we measured the

corresponding mRNA levels in cultures grown on

cellobiose, xylose or glucose. Total mRNA was

extracted from mid-exponential phase cultures and

the cDNA was amplified with primers specific to

celA, celB, celC, celD and celR as well as for the

isocitrate dehydrogenase gene, ict, that was used

for normalization. Relative expression was

measured by real-time RT PCR, as presented in

Figure 1B. The expression levels of the

corresponding genes were 7-15-fold higher in the

cellobiose-grown culture, as compared to cultures

grown on xylose or glucose. The relatively high

levels of celA mRNA compared to the celBCD

genes, may reflect differences in mRNA stability.

These results suggest that the celBCDA operon is

induced by cellobiose and thus highly likely to be

involved in cellobiose utilization.

Results

Identifying of the cellobiose utilization gene

cluster

Biochemical characterization of Cel1A

As part of

hemicellulolytic

a

systematic search for

utilization systems in

The biochemical activity of Cel1A was

determined using different chromogenic and

natural substrates (Table 1). Cel1A exhibited a

significant catalytic activity on substrates with

glucose-6-phosphate at the glycon moiety, and had

no detectable activity toward unphosphorylated

substrates. These results suggest that Cel1A is a 6-

phospho-β-glucosidase, with high specificity

toward glucose-6-phosphate as the glycon moiety.

The effect of temperature on Cel1A activity was

determined at pH 6.5, using the chromogenic

substrate oNPβGlc6P. The optimal temperature in a

20 min reaction was 70°C (Figure 2A). The

thermal stability was determined after incubating

Cel1A at temperatures between 30°C to 85°C for

10 minutes. The enzyme was stable at temperatures

below 65°C and lost over 90% of its activity at

75°C (Figure 2B). The activity of Cel1A was

determined at different pH values in the range of

G. stearothermophilus, we identified in strain T-1 a

4.3 kb gene cluster, which appears to be involved

in the utilization of cellobiose (Figure 1A). The

cluster was identified via bioinformatics analysis of

the genome sequence of strains T-1 and includes an

operon of four genes and a transcriptional regulator

gene. Based on sequence homology, the celBCD

genes encode for a complete PTS system. The

CelD protein is homologous to proteins from the

lactose/cellobiose EIIC family that bind cellobiose

or lactose. CelC and CelB are the EIIA and EIIB

domains, respectively, which transfer the

phosphoryl group from HPr to the transported

sugar. The forth gene in this operon, celA, encodes

for a 6-phospho-β-glucosidase, Cel1A, which

shows sequence homology to a number of GH1 6-

phospho-glucosidases, including those from

Streptococcus pyogenes (51% sequence identity),

Lactobacillus plantarum (32%) and Streptococcus

3

Growth of G. stearothermophilus on galactosides & cellobiose

3.5 - 9.5 (Figure 2C). The pH profile is a typical

GalP exhibits significant sequence similarity to

periplasmic sugar-binding proteins with a 27 amino

acid signal peptide at its N-terminus. GalS exhibits

characteristic features of bacterial histidine kinase

proteins, including two transmembrane (TM)

helices (TM1, residues 7-25 and TM2, residues

177-197) flanking an extracellular domain

(residues 26-176) and a conserved C-terminal

cytoplasmic region containing the ATP-binding

kinase domain. Downstream to the galS gene

lays the galT2 gene, which encodes for a protein

with high sequence similarity to response

regulators. As in the case for many response

regulators, GalT2 has a predicted two-domain

architecture, with an N-terminus signal receiver

domain (REC), linked to a C-terminus effector

domain (22). The N-terminal signal receiver

domain (positioned at residues 5-118) shares a

significant homology with the Rec superfamily of

the REC domains, whereas the C-terminal domain

(residues 157-225) contains a putative helix-turn-

helix motif, resembling the AraC-type DNA-

bell-shaped curve, which may reflect the ionization

of the two catalytic carboxylates. The enzyme was

most active at the pH range of 6.5 to 8, and lost

about 90% of its activity at pH 3.5 and 9.5. Based

on sequence alignment of Cel1A with other

retaining GH1 enzymes, the putative acid/base and

nucleophile catalytic residues are Glu174 and

Glu373, respectively. These residues were

substituted with alanine and the effect of the

mutations on the activity of the enzyme was

determined using oNPβGlc6P as the substrate. The

Michaelis-Menten catalytic constants of the Cel1A-

E174A catalytic mutant towards oNP-Glc6P were

0.01 mM, 2.1 s⁻¹, and 2.1×10⁵s⁻¹M⁻¹for K_m, k_cat

and k_cat/K_m, respectively. The k_catvalue was about

50-fold lower, compared to the wild type, and the

K_mwas 10-fold lower, compared to the wild type,

suggesting the accumulation of a glycosyl-enzyme

intermediate. Such results are expected for an acid-

base mutant since the relatively high reactivity of

the o-nitrophenol leaving group (pK_a7.22) elevates

the rate of the first glycosylation step even without

a proton assistant. The second deglycosylation step

remains considerably slow due to the loss of the

base required for the activation of the catalytic

water molecule (20). The alanine replacement of

the Glu373 nucleophile, resulted in a non-

detectable activity toward oNP-Glc6P, reflecting

the inability of this mutant to bind the substrate and

stabilize the first transition state. In similar

retaining glycoside hydrolases, the nucleophile is

usually involved in a strong interaction with the C2

hydroxyl group of the glycone sugar (21).

binding domain (23).

Taken together, these

observations suggest that the galPST2 and

galE2F2G2 clusters encode for a three-component

sensing system and an ABC galactose transport

system, respectively.

mRNA expression levels of the galactose related

genes

Based on genome sequence analysis, strain T-1

encodes for four sugars-specific PTS systems, two

for the disaccharides, cellobiose and trehalose, and

two for the mono-sugars, mannitol and galactose

(Figure 4A). To determine whether the galPST2

and galE2F2G2 gene clusters are involved in

galactose utilization and to identify the PTS system

for galactose, the mRNA levels of the galPST2,

galE2F2G2 and the four sugar-PTS systems were

measured in cultures grown in the presence of

galactose and related sugars (Figure 4). The

expression of galE2 was 5-fold higher on

galactose-grown cultures, compared to cultures

grown on either glucose, xylose or galactan (Figure

4B). These results support our original suggestion

that the galE2F2G2 operon constitutes an ABC

galactose transporter. The expression of the galP

gene, which is part of a three-component sensing

system, appears to be relatively low and constant,

regardless of the carbon source used (Figure 4B).

Identification of the sensing and transport

systems for galactose

We have demonstrated previously that

G. stearothermophilus T-1 consumes galactan

efficiently, utilizing the galactan utilization gene

cluster, ganREFGBA (3). Following bioinformatics

analysis of the bacterium genome sequence we

identified a new cluster that appears to be involved

in galactose utilization. This new 12.5-kb cluster is

composed of genes encoding for a putative three-

component regulatory sensing system (GalPST2),

an ABC sugar transport system (GalE2F2G2), a

regulatory protein (GanR2) and two 6-phospho

glycosidases (Gan4C and Gan1D) (Figure 3).

4

Growth of G. stearothermophilus on galactosides & cellobiose

Although these results cannot correlate the system

to galactose, it is expected that the sensing systems

will be expressed constitutively. The mRNA

arabinose and xylotriose utilization systems (2,9).

Sequence analysis of the promoter region of galE2

revealed a putative -35 sequence (TTGATA),

which is a relatively close match to the σ^A

consensus sequence, TTGACA. This -35 sequence

is separated by 18-bp from the potential -10 region

(CAACAT), which differs from the B. subtilis

consensus, TATAAT, by three nucleotides (24).

The upstream region of the -35 of the galE2

levels of the four PTS systems were also measured

in cultures grown on either galactose or glucose

(Figure 4C). The expression level of the ptsA gene

in galactose-grown culture was about 9-fold higher

than for a culture grown on glucose, suggesting

that ptsA is part of the galactose PTS transporter,

dedicated for galactose import. Taken together,

these results suggest that G. stearothermophilus

T-1 has two transport systems for galactose.

promoter

contains

two

direct

repeats,

CAAAAAAGT, separated by 11-bp, which may

function as the recognition sequences for the

response regulator GanlT2 (Figure 6A). This

putative binding site, upstream of the -35 region,

can allow direct interaction of the activator with the

carboxy-terminal domain of the α subunit of RNA

polymerase (25,26). To test whether GalT2 can

bind the galE2 promoter region we utilized gel

mobility shift assays. These studies indicated that

the GalT2 protein (using N-His₆-GalT2) can bind

significantly to a 113-bp DNA fragment containing

the two direct repeats discussed above, and a nearly

complete shift was obtained in the presence of 0.3

µM GalT2 (Figure 6B). This relatively high

concentration of GalT2 (reflecting a relatively

weak protein-DNA binding) may originate from

the fact that the protein was not fully

phosphorylated, as often observed for other

response regulators (27). To test whether the

phosphorylation of GalT2 increase significantly its

binding to DNA, we phosphorylated GalT2 in

vitro, using Mg⁺²and acetyl phosphate as the

phosphate donor. As shown by size-exclusion

chromatography, such phosphorylation changed the

oligomeric state of GalT2 in solution, transforming

it from a monomer (not phosphorylated) to a dimer

(phosphorylated) (Figure 6C), as usually observed

for related response regulators. Indeed, the fully-

phosphorylated GalT2 protein (in its dimeric form)

gave a complete shift at 0.07 µM (Figure 6D),

demonstrating a significant increase in its DNA

binding capabilities. These results further support

the identification of GalT2 as a response regulator,

as such regulators usually change their

conformation upon phosphorylation, allowing them

to enhance their binding to their target DNA

segments (28,29).

GalP and GalE2 bind galactose

The putative three-component system for

galactose, GalPST2, and the galactose ABC

transport system, GalE2F2G2, both have dedicated

sugar-binding proteins (GalP and GalE2,

respectively) that are tethered to the local

membrane. The ability of these proteins to bind

galactose was confirmed by isothermal titration

calorimetry (ITC).

curves are shown in Figure

thermodynamic binding parameters

The calorimetric titration

and the

are

5

summarized in Table 2. These results demonstrate

that GalE2 and GalP are able to bind galactose

quite tightly, with dissociation constants in the

micromolar range, K_D= 1.4 µM and K_D= 6.1 µM,

respectively.

Similar titrations of GalP with

cellobiose and lactose did not result in a significant

enthalpy change. Surprisingly, however, both

proteins bind glucose in similar affinities to

galactose. Nevertheless, although glucose seems to

bind these proteins quite tightly, it is rather

unlikely that it can activate the corresponding

sensing systems, since the expression of the

operons of these systems are practically unaffected

by glucose (Figure 4B).

GalT2 binds to the galE2F2G2 promoter region

The fact that the potential three-component

sensing system for galactose (galPST2) is located

adjacent to a putative ABC transport system

(galE2F2G2), suggests that the sensing system is

functionally linked to this transport system, and

that GalT2 is therefore a response regulator that

regulates the expression of the transporter. This

type of adjacent arrangement of gene clusters was

found in G. stearothermophilus also for the

5

Growth of G. stearothermophilus on galactosides & cellobiose

the corresponding PTS system for disaccharides.

Considering these observations, we hypothesized

Biochemical characterization of Gan1D

The 12.5-kb galactose utilization cluster also

contains the gan1D gene, which is expressed in

cultures grown on galactose or galactan (Figure

4B). We have previously described the 3D crystal

structure of Gan1D, as well as its catalytic mutants

complexed with substrates and products (30).

These Gan1D structures revealed the structural

features that allow the enzyme to accommodate

both 6-phospho-galactose and 6-phospho-glucose

at the glycone binding site (-1) (30). To further

characterize the specificity of Gan1D, its catalytic

activity was studied using different chromogenic

and natural substrates (Table 3). Gan1D readily

hydrolyzed substrates with a glycoside-6-phosphate

as the glycone moiety such as lactose-6-phosphate.

The enzyme had no detectable activity toward non-

phosphorylated substrates, in a good correlation

with similar studies conducted on other GH1 6-

that the utilization of β-galactosides (lactose or

galactosyl-glycerol) in strain T-1 is linked to an

alternative PTS system. A somewhat supporting

evidence for that is the observation that

Lactococcus lactis IL1403, can utilize lactose only

in the presence of cellobiose (34). In analogy, it

was tempting to speculate that the utilization of β-

galactosides (lactose or galactosyl-glycerol) in

G. stearothermophilus T-1 is actually depended on

its cellobiose PTS system (celBCD). To test this

hypothesis, strain T-1 was grown in a defined

mBSM medium, containing either 0.4% lactose or

galactosyl-glycerol in the presence of various

concentrations of cellobiose. The resulting growth

curves were characterized with an initial

exponential growth on cellobiose, followed by a

linear growth on lactose or galalctosyl-glycerol

(Figure 7AB). The extent of the logarithmic

growth was proportional to the initial cellobiose

concentration, suggesting that in this phase, it is

cellobiose that is mostly consumed. Following the

logarithmic phase, the cultures exhibited linear

growth, this time likely consuming lactose or

galactosyl-glycerol. The slopes of the linear

growth were proportional to the turbidity (cell

mass) at end of the logarithmic phase (see inserts in

Figure 7AB). These unexpected results can be

explained by the following behavior of the

bacterium. At the end of logarithmic phase, it

seems that all of the cellobiose is already

consumed, and at that stage, the cells do not

express the now non-induced cellobiose PTS genes

(celBCD). Hence, at the end of the exponential

growth, the number of PTS systems per cell seem

to remain constant, neglecting obvious natural

turnover. At that point, the limiting factor of the

growth rate is likely to be the transport of lactose or

galactosyl-glycerol into the cell, probably via the

already fixed population of the cellobiose PTS

systems. This hypothesis seems to be in good

correlation with the linear cell growth observed

from this point on, which is now proportional to the

(now unchanged) overall number of cellobiose PTS

systems per cell.

phospho-β-glycosidases (20,31).

Interestingly,

however, the enzyme exhibited bifunctional

specificity, showing similar catalytic activities on

substrates containing glucose-6-phosphate or

galactose-6-phosphate as their glycone moiety

(Table 3).

Growth of strain T-1 on β-galactosides

substrates in the presence of cellobiose

The physiological role of Gan1D in

G. stearothermophilus T-1 was initially puzzling

since we failed to identify a dedicated PTS system

for galacto-disaccharides. Indeed, neither lactose

nor galactosyl-glycerol were found to support the

growth of G. stearothermophilus T-1. Lactose is

not expected to be abundant in soil, the natural

niche of the bacterium, however, galactosyl-

glycerol, the degradation product of galacto-lipids,

should be available there. The most abundant

galacto-lipids in plants are those of mono-

galactosyl-diacyl-glycerol

(MGDG)

and

digalactosyl-diacyl-glycerol (DGDG), mainly

found in plant chloroplast membranes (32,33). The

degradation of both of these molecules by lipases

releases galactosyl-glycerol, a β-galactoside bound

Taken these observations together, it appears as

if G stearothermophilus T-1 is capable of utilizing

to

glycerol

(1-0-β-galactosyl-glycerol).

Interestingly, unlike the genetic context of many

phospho-glycosidases, the gan1D gene in strain

T-1 as well as its homologous enzymes in many

other bacteria, do not lay adjacent to the genes of

galacto-disaccharides

using

the

alternative

cellobiose PTS system for import and the Gan1D

enzyme for processing.

In support of this

6

Growth of G. stearothermophilus on galactosides & cellobiose

hypothesis, it is noted that G. stearothermophilus T- G. stearothermophilus seems to be regulated by the

6, a close relative of strain T-1, possesses a similar anti-terminator GlcT.

cellobiose PTS system, but lacks a 1825-bp

In G. stearothermophilus strain T-1, galactose

segment containing the gan1D homologous gene. In can also be imported by a non-PTS ABC galactose

turn, this strain grows very well on cellobiose, yet transporter (galE2G2F2) (Figure 8). The operon is

fails to grow on lactose or galactosyl-glycerol in the upregulated in the presence of galactose and the

presence of cellobiose (Figure 7C).

corresponding substrate binding protein (SBP)

GalE2, was shown to have a significant galactose

binding (Table 2). In Lactococcus lactis, the import

of galactose occurs via high affinity non-PTS

system (K_din the µM range), whereas the galactose

PTS system is a low-affinity transporter (K_din the

mM range). The specific binding affinity of the

strain T-1 galactose PTS system is yet to be

determined, however our current data indicates that

GalE2 binds galactose with a relatively high-

affinity, with K_dvalues in the µM range (Table 2).

A three-component sensing system regulates the

expression of the galactose ABC transporter. The

galP, galS and galT2 gene products constitute a

three-component sensing system, in which GalP is

a galactose-binding lipoprotein, GalS is a class-I

histidine kinase and GalT2 is the response

regulator, which seems to be phosphorylated by

GalS (Figure 8). In a good correlation with similar

sensing systems, GalP binds extracellular galactose

and is likely to activate the sensor histidine kinase,

either by direct protein-protein interaction, or by

presenting the sugar to the histidine kinase sensor

domain. In turn, the auto-phosphorylated GalS

histidine kinase phosphorylates the response

regulator, GalT2, thereby passing the sensing

signal into the cell. Thus, GalP seems to be a

typical SBP, functioning here as an auxiliary

component that assists this three-component

system in sensing small amounts of extracellular

galactose.

GalT2 seems to function as a typical response

regulator, and accordingly possesses a phospho-

acceptor receiver domain (REC), a common

module in a variety of response regulators (27).

Interestingly, many response regulators are able to

catalyze their own phosphorylation in vitro in the

presence of Mg⁺²and a suitable phosphoryl donor,

and in the absence of any auxiliary proteins (37).

Phosphorylation of the REC domains usually

induce dimerization of the response regulator,

commonly associated with conformational

changes, thereby facilitating its binding to the

target DNA segment (usually palindromic or direct

repeat sequences) (38,39). Indeed, we were able

Discussion

G. stearothermophilus possesses

a

cellobiose- and galactose- PTS systems. G.

stearothermophilus encodes for four putative PTS

systems, dedicated for the import of cellobiose,

galactose, mannitol and trehalose. The cellobiose-

PTS system was identified based on the

observation that the celBCDA operon is expressed

in the presence of cellobiose (Figure 1B) and that

Cel1A rapidly hydrolyzes 6-phospho-cellobiose

(Table 1). The cellobiose-PTS system is most

likely regulated by CelR. A sequence resembling

an operator site for CelR includes an inverted

repeat of 8-bp (5’-TTTTTATT -N₁₃N

–

AATAAAAA-3’) and it is located within the

promoter region of the celBCDA operon. G.

stearothermophilus can readily utilize cellobiose,

although it does not encode for cellulolytic genes.

Thus, this bacterium seems to possess the ability to

scavenge from the surroundings residual

cellobiose, which is the main product of cellulose

degradation by cellulolytic microorganisms.

The PTS system for galactose was identified in

G. stearothermophilus based on the measurements

of mRNA levels of the ptsA gene, in the presence

of galactose. The system is encoded by a four-gene

operon, consisting of a multi-domain EII protein,

with the corresponding domains of EIIA, EIIB and

EIIC fused together (ptsA), a histidine-containing

phospho-carrier (HPr)-like protein (ptsB), and a

phosphoenolpyruvate-protein kinase (the EI

component) (ptsC). The first gene in the operon is

glcT, encoding for an anti-terminator protein of the

BlgG family. Both genes (glcT and ptsA) are

separated by a palindromic sequence that functions

as a transcriptional terminator. GlcT possesses an

N-terminal RNA binding domain, followed by two

PTS regulation domains, which are likely to be

phosphorylated and thereby modulate the RNA

binding activity (35,36).

Based on these

observations, the galactose PTS system of

7

Growth of G. stearothermophilus on galactosides & cellobiose

to show that in vitro auto-phosphorylation of

stearothermophilus T-1, homologous genes for

GalT2 promoted its dimer formation in solution,

and facilitated its ability to bind DNA. The

potential binding sites for GalT2 are located

upstream of the -35 region of galE2 (the first gene

in the galactose ABC transporter operon) which is

made of two direct repeat sequences,

CAAAAAAGT, separated by 11 nucleotides. A

binding upstream of the -35 region usually enables

a direct interaction of the bound activator with the

these three enzymes, tagatose isomerase, tagatose

6-P

kinase

and

D-tagatose-1,6-

bisphosphate aldolase. Interestingly, these three

genes are not clustered together, as common in

other Gram-positive bacteria (44,45). The putative

tagatose aldolase gene from strain T-1 shares 40%

identity with the tagatose-bisphosphate aldolase

gene (gatY), which in Bacillus licheniformis is part

of a five-gene cluster involved in the D-tagatose

alpha

carboxy-terminal

domain

of

the

pathway (46).

Although such bioinformatics

corresponding RNA polymerase (26).

Direct

analysis suggests a similar tagatose pathway in

repeats are common binding sites for activators

(38,39), and in G. stearothermophilus such

sequences are found in the upstream region of xynE

(a part of the xylotriose ABC transporter) and araE

(a part of the arabinose ABC transporter) (2,9).

Three-component sensing systems for mono-

sugars is likely to provide the bacterium with a

highly sensitive and rapidly responding mechanism

for detecting and utilizing potential high-

Geobacillus, we cannot rule out the involvement of

a

phosphatase, which, in principle, could

alternatively catalyze the hydrolysis of Gal6P into

galactose and phosphate (47).

Regulation of the galactose related genes. In G.

stearothermophilus, regulation of the galactose

utilization related genes appears to involve several

regulatory mechanisms. As noted above, the

galactose-PTS system is regulated by the anti-

terminator transcriptional protein GlcT, and the

expression of the ABC galactose transporter

(galE2G2F2) is positively regulated by the

response regulator GalT2. Surprisingly, the sugar

binding protein of the galactose ABC transport

system (GalE2) binds with similar affinities to both

galactose and glucose, as was also observed for

GalP, the SBP component of the galactose sensing

system. These observations could suggest that

glucose competes with galactose over the binding

to both GalP and GalE2, thereby preventing the

expression of galactose-related genes when the

glucose concentration is relatively high. Such

glucose-galactose competition will ensure that the

activation of the galactose utilization system,

occurs only when the glucose levels are relatively

low, following a mechanism similar to “inducer

exclusion” (48). In E. coli, the non-phosphorylated

form of the EIIA protein, a part of the glucose PTS

system, is known to inhibit sugar transporters,

exerting the known “glucose effect” (48). In

support for this hypothesis is the absence of

catabolic responsive elements in the ganE2

promoter, which usually involve the binding of the

catabolite control protein A (CcpA). CcpA is

known to be a major regulator of carbon

metabolism in Gram-positive bacteria (49,50).

The regulation of the gan1D gene probably

involves the negative regulator GanR. We have

previously characterized the galactan utilization

molecular-weight

polysaccharides

in

the

extracellular environment. Such sensing system

was recently characterized in Clostridium

Beijerinckii, dedicated for the utilization of xylose

(40).

sensing was found in Clostridium thermocellum for

the regulation of cellulosomal genes. This

A somewhat different mechanism for

mechanism is based on a transmembranal RsgI-like

protein, which is made of an extracellular

carbohydrate binding module (CBM) and an

intracellular anti-sigma peptide. In such systems,

the binding of the target saccharide to the CBM

sensing domain leads to the release of the

corresponding alternative sigma factor, thereby

enabling the expression of the corresponding genes

(41,42).

The 6-Phospho-galactose metabolism in

G. stearothermophilus T-1. In principle, 6-

phospho-galactose and 6-phospo-lactose can be

metabolized by the tagatose-6-phosphate (Tag6P)

pathway, while galactose can be also metabolized

via the Leloir pathway (43). In G.

stearothermophilus T-1 D-galactose-6-phosphate is

formed after the transport of lactose or galactose

via the corresponding PTS systems (Figure 8). D-

galactose-6-phosphate is catabolized by three

enzymes of the Tag6P pathway, resulting in

dihydroxyacetone phosphate (DHAP) and D-

glyceraldehyde 3-phosphate (G3P) (Figure 8).

Using sequence alignment, we identified in G.

8

Growth of G. stearothermophilus on galactosides & cellobiose

cluster (ganEFGBA). This operon is regulated by

galactosyl-glycerol showed an initial logarithmic

growth followed by a linear growth (Figure 7). The

slope curves of the linear growth were proportional

to the turbidity (cell mass) at end of the logarithmic

phase. These results suggest that cellobiose is

utilized first, supporting logarithmic growth, and

when depleted, either lactose or galactosyl-glycerol

can enter the cell via the same cellobiose-PTS

system, although at a somewhat lower affinity. The

linear growth is likely to reflect the fact that the

transfer of lactose (or galactosyl-glycerol) is a rate

limiting step, and that in the absence of cellobiose,

the cellobiose-PTS operon is not expressed. With

this in mind, it seems that Gan1D could be involved

GanR, which binds to an invert repeat upstream the

-35 site (3). Galacto-oligosaccharides, although

not galactose, function as the molecular inducers.

Very similar binding sequence is located in the

gan1D promoter region, suggesting that gan1D

may also be regulated by GanR. Interestingly,

almost the same sequence appears in the promoter

region of the galactose metabolism operon,

galKETR (the Leloir pathway), which is most

likely regulated by a different negative regulator,

GalR.

Gan1D is

a

bifunctional 6-phospho-β-

galactosidase/glucosidase. In the GH1 family, two

catalytic specificities towards phosphorylated

substrates have been reported so far, those of 6-

phospho-glucosidase and 6-phospho-galactosidase.

Glucose-6-phosphate (Glc-6P) and Galactose-6-

phosphate (Gal-6P) differ only by the exact

configuration of their C4 atom, where the O4

hydroxyl group adopts an axial position in Gal-6P,

and an equatorial position in Glc6P. Surprisingly,

Gan1D exhibited relatively similar catalytic

activities towards sugar substrates with Glc-6P or

Gal-6P in their glycone moiety. From the genomic

context, however, it was expected that Gan1D

in

two

important

functions

in

G.

stearothermophilus T-1. First, it allows the cell to

utilize residual galactose containing disaccharides,

especially the more abundant galactosyl-glycerol,

taking advantage of the relative promiscuity of the

cellobiose-PTS system.

Considering the

competition on the scarce carbon sources in the

soil, this could represent a significant growth

advantage. Second, it is also possible that the

promiscuous cellobiose-PTS system allows the

entrance of other non-metabolizable galactose-

based compounds, which may accumulate in the

cell and inhibit growth. In such cases, Gan1D can

potentially hydrolyze these compounds to facilitate

their removal. In this respect, the E. coli lacA gene

product, thiogalactoside transacetylase, could have

a somewhat similar function (52) as suggested here

for Gan1D.

would function only as

a

6-phospho-β-

galactosidase. These results appear to be somewhat

less surprising in view of the catalytic specificity

data reported for homologous GH1 6-phospho-β-

galactosidases, many of which were also shown to

be less specific in regards to the glycone sugar of

their substrate, and specifically with regards to the

configuration of the OH group at the C4 position of

this sugar (e.g. glucose vs. galactose) [21, 23].

The natural biological role of Gan1D. 6-

Phospho-β-galactosidases are relatively common in

lactic bacteria, used for the utilization of lactose,

which is imported into the cell via a lactose-PTS

system (51). In the case of G. stearothermophilus,

however, the fact that strain T-1 encodes for an

enzyme (Gan1D) with 6-phospho-β-galactosidase

activity, but lacks a dedicated lactose-PTS system

seemed to be enigmatic. Nevertheless, we were

surprised to find out that strain T-1 can utilize

lactose and galactosyl-glycerol in the presence of

Experimental procedures

Bacterial growth conditions

Growth media for G. stearothermophilus was

modified Basic Salt Medium (mBSM) (53)

supplemented with 1% of carbon source. Liquid

mBSM contained the following per liter: KH₂PO₄,

0.4 g; MgSO₄.7H₂O, 0.1 g; (NH₄)₂SO₄, 2 g;

[MOPS 3-(N-morpholino) propanesulfonic acid]-

Sodium salt, adjusted to pH 7.0, 10 g. After

autoclave, mBSM was supplemented with (per

liter); nitrilotriacetic acid, 0.2 g, NaOH, 0.125 g, 1

ml of amino acids stock solution (0.05 g/lit of 19

amino acids except tyrosine), and 1 ml of three

different trace elements solutions. Solution I

cellobiose.

These unexpected observations

suggested that the cellobiose-PTS system could

also transfer lactose and galactosyl-glycerol.

Growth curves of strain T-1, growing in presence of

cellobiose together with either lactose or

.

contained per liter: MgSO₄7H₂O, 0.145 g; Solution

.

II contained per liter: CaCl₂2H₂O, 0.132g; and

9

Growth of G. stearothermophilus on galactosides & cellobiose

.

Solution III contained in g per liter: FeSO₄7H₂O,

.

0.998 g; MnSO₄4H₂O, 0.592 g; ZnCl₂, 0.42 g; and

.

CuSO₄5H₂O, 0.624g.

The pH of the latter

solution was adjusted to 2.0 with sulfuric acid.

Synthesis of 6-Phospho-β-glycosides

The synthetic substrate

oNP-β-D-

DNA and RNA isolation and manipulation

galactopyranoside-6-phosphate (oNPβGal-6P) was

G. stearothermophilus T-1 genomic DNA was

isolated according to the procedure published by

Marmur (54) as outlined by Johnson (55). Plasmid

DNA was purified using the DNA Clean-Up

System (Promega). DNA was manipulated by

standard procedures (56) Total RNA was isolated

with the RNeasy kit (Qiagen GmbH, Hilden,

Germany) according to the manufacturer’s

protocol.

purchased from Carbosynth (Berkshire, UK). The

phosphorylated

forms

of

pNP-β-D-

glucopyranoside,

oNP-β-D-glucopyranoside,

cellobiose, lactose and gentiobiose were made

enzymatically using β-glucosidase kinase (BglK)

from Klebsiella pneumonia as described previously

with

minor

modifications

(57).

The

phosphorylation reaction contained 12.5 mM

HEPES buffer pH 7.5, 1 mM MgSO₄, 50 mM ATP

(adjusted to pH 7.5), 50 mM substrate and 25

μg/ml BglK. During the 2 hr incubation at room

temperature, the pH of the reaction was maintained

at 7.5 by periodic addition of 40 μl 3 M NH₄OH

solution. Following the incubation, the pH of the

solution was adjusted to 8.2 and barium acetate

was gradually added to a final concentration of 0.6

M. The sample was centrifuged and the soluble

fraction (containing the phosphorylated sugar) was

filtrated, chilled on ice, and incubated at 4 ºC

overnight with 4 volumes of absolute ethanol.

Following centrifugation, the pellet was dried at 37

ºC, resuspended in 4 ml aqueous solution of AG

50W-X2 Resin (Bio-Rad, Hercules, CA, USA),

filtrated via 0.45 μm-pore-size filters (Merck

Millipore, Darmstadt, Germany) and lyophilized.

Real time RT-PCR analysis

Total RNA was isolated from mid-exponential

culture of G. stearothermophilus T-1 grown on

modified basic salt medium (mBSM) supplemented

with 0.5% (wt/vol) of different sugars as the sole

carbon source (53). Cell pellets of about 10⁹cells

were suspended in 1 ml of Tri reagent (Sigma),

sonicated (Sonicator model W-375; Heat System-

Ultrasonics Inc., Plainview, NY), and total RNA

was extracted according to the Tri reagent protocol.

Contaminating genomic DNA was removed by

DNase I treatment (Qiagen, Hilden, Germany)

followed by a clean-up protocol with the RNeasy-

Kit (Qiagen, Hilden, Germany). Reverse

transcription (RT) of RNA (1 µg of total RNA) was

performed with the qScript cDNA Synthesis kit

(Quanta BioSciences, Beverly, MD, USA)

following the manufacturer's instructions. The

primers were designed to generate amplicons

ranging in size from 90 to 200 bp and control

reactions were performed in the absence of reverse

transcriptase. The Reactions were performed using

the Applied Biosystems 7300 Real Time PCR

system and contained (20 µl volume) template

cDNA, reverse and forward primers (10 µM each)

and PerfeCTa SYBR green Fastmix (Quanta

Typically,

a

total yield of 100-150 mg

phosphorylated substrate was obtained in these

reactions. The structure and purity of oNPβGlu-6-

phosphate (oNPβGlu-6P), pNPβGlu-6-phosphate

(pNPβGlu-6P), cellobiose-6-phosphate (Cel-6P),

lactose-6-phosphate (Lac-6P) and Gentiobiose-6-

phosphate (Gen-6P) were confirmed by NMR and

mass spectrometry. ¹H-NMR and ¹³C-NMR

spectroscopy was performed in D₂O on Bruker

Avance AV-III 400 and AV-III 500 spectrometers.

Signal assignments were confirmed by correlation

spectroscopy, total correlation spectroscopy and

heteronuclear correlation experiments. The mass

spectrum was obtained on a Bruker Daltonix Apex

3 mass spectrometer under electrospray ionization

(ESI).

BioSciences, Beverly, MD, USA).

All

measurements were performed in triplicate and

Data analysis was performed with the Applied

Biosystems 7300 system software by using the

housekeeping gene ict (encoding for isocitrate

dehydrogenase) for normalization.

10

Growth of G. stearothermophilus on galactosides & cellobiose

20 °С. Reaction progress was monitored by TLC

Synthesis of galactosyl-glycerol

(ethyl acetate/hexanes, 1:1). When the reaction was

The target glycerol derivative of galactose

(compound 5) was synthesized from the

commercial penta-O-acetyl-β-D-galactopyranoside

1 and D,L-α,β-isopropylideneglycerol 3 in four

chemical steps as illustrated in Scheme 1 (58-60).

First, treatment of 1 with HBr (33% solution in

acetic acid) resulted the α-bromide 2 (60), which

then reacted with the compound 3 in the presence

of Ag₂CO₃to afford selectively the β-glycoside 4.

Sequential two-steps deprotection of 4, removal of

acetate esters by treatment with sodium methoxide

followed by acid treatment to remove the

isopropylidene ketal, resulted the target β-

galactoside 5. The product was characterized by

NMR and MS spectral analysis and the data was

identical to the previously reported (58,59).

complete, the mixture was cooled to 0 °С and

diluted with cold dichloromethane, followed by

addition of cold solution of NaHCO₃(5% in

water). The aqueous layer was washed with 3

portions of cold dichloromethane; the combined

extracts were dried with anhydrous MgSO₄and

concentrated at reduced pressure. Compound 2 was

rapidly decomposed upon the storage and/or on

column chromatography on silica gel. Therefore, it

was used in the following step without additional

purification. R_f0.67 (ethyl acetate/hexanes, 1:1).

MALDI-TOF MS: calculated for C₁₄H₁₉BrO₉m/e

412.20; measured 413.0.

1,2-Isopropylidene-3-O-(β-2’,3’,4’,6’-tetra-O-

acetyl-galactopyranosyl)-rac-glycerol

4.

The

mixture of D,L-α,β-isopropylideneglycerol 3 (2.25

g, 0.017 mol) in anhydrous dichloromethane (40

mL), Ag₂CO₃(4.69 g, 0.017 mol), and fine Drierite

(8.5 g) was stirred in the dark under argon. After

being stirred during 40 min, iodine (0.43 g, 0.0017

mol) was added, followed by dropwise addition of

the bromide 2 (7.0 g, 0.017 mol) in anhydrous

dichloromethane (30 mL) during ~1 h at room

temperature. The reaction mixture was stirred

overnight at room temperature, and then filtered.

The filtrate was evaporated and the residue (orange

oil) was washed twice with anhydrous

dichloromethane and the combined fractions were

evaporated to dryness. The crude was purified by

1

The H NMR spectra (including COSY,

DEPT, HSQC and HMBC) were recorded on a

Bruker Avance^TM400 spectrometer or 600

spectrometer, and chemical shifts reported (in ppm)

are relative to internal Me₄Si (d = 0.0) with CDCl₃

as the solvent, and to HOD (d = 4.63) with D₂O as

the solvent. ¹³C NMR spectra were recorded on a

Bruker Avance^TM500 spectrometer or at 125.8

MHz, and the chemical shifts reported (in ppm)

relative to the residual solvent signal for CDCl₃(d

= 77.00), or to external sodium 2,2-dimethyl-2-

silapentane sulfonate (d = 0.0) for D₂O as the

solvent. Mass spectra were obtained either on a

MALDI Micromass spectrometer under electron

spray ionization (ESI). Reactions were monitored

by TLC on Silica Gel 60 F254 (0.25 mm, Merck),

and spots were visualized by charring with a

column

chromatography

on

silica

gel

(EtOAc/hexanes 3:2) to afford 4 (3.75 g, 47%) as a

mixture (1:1) of two diastereomers. R_f0.60 (ethyl

acetate/hexanes, 7:3).

¹H NMR (400 MHz, CDCl₃): δ_H1.31 (s, 3H,

isopropylidene-CH₃), 1.37 (s, 3H, isopropylidene-

CH₃), 1.92 (s, 3H, acetate-CH₃), 1.98 (s, 3H,

acetate-CH₃), 2.00 (s, 3H, acetate-CH₃), 2.09 (s,

3H, acetate-CH₃), 3.55-4.25 m (2 x 8H), 4.48 (d,

1H, J = 7.8 Hz), 4.51 (d, 1H, J=7.8 Hz), 4.95 (d, 2

x 1H, J = 10.2 Hz), 5.13 (t, 2 x 1H, J = 8.2 Hz),

5.32 (s, 2 x 1H). MALDI-TOF MS calculated for

C₂₀H₃₀O₁₂Na ([M+Na]⁺) m/e 485.45; measured

485.02.

.

yellow solution containing (NH₄)Mo₇O₂₄4H₂O

(120 g) and (NH₄)₂Ce(NO₃)₆(5 g) in 10% H₂SO₄

(800 mL). Column chromatography was performed

on a Silica Gel 60 (70-230 mesh). All reactions

were carried out under an argon atmosphere with

anhydrous solvents, unless otherwise noted. Penta-

O-acetyl-β-D-galactopyranoside 1 was purchased

from Tokyo Chemical Industry Co., Ltd (TCI,

Japan) and D,L-α,β-isopropylideneglycerol 3 was

from Sigma‒Aldrich (USA).

3-O-(β-galactopyranosyl)-rac-glycerol 5. To a

solution of compound 4 (4.06 g, 0.009 mol) in

anhydrous methanol (50 mL) at 0 °С was added

sodium methylate (1.9 g, 0.035 mol) and the

reaction progress was monitored by TLC

(methanol/chloroform, 1:4). After about 1 hour at 0

Penta-O-acetyl-β-D-galactopyranoside

bromide

(2). To a solution of compound 1 (15.0 g, 0.038

mol) in 80 mL anhydrous dichloromethane was

added at 0 °С a solution of HBr (9.33 g, 0.12 mol,

33% solution in acetic acid). The reaction was

stirred at 0 °С for 1 h and then an additional 3 h at

11

Growth of G. stearothermophilus on galactosides & cellobiose

°С, the reaction was warmed to room temperature

3’ terminus (Table 4). The primers contained six

histidine codons to provide His₆-fused products

(Table 4). Mutagenesis was performed using the

QuikChange site directed mutagenesis kit

(Stratagene, La Jolla, CA, USA). The mutated

genes were sequenced to confirm that only the

desired mutations were inserted. For protein

production of Gan1D, Cel1A GalP and GalE2, E.

coli BL21(DE3) cultures containing the appropriate

vector (pET9d- Gan1D, - Cel1A, GalP or - GalE2)

were grown overnight in terrific broth (56) with

kanamycin (25 g/ml) 0.5 liter in 2-liter baffled

shake flasks shaken at 230 rpm at 37°C) to a final

turbidity at 600 nm of 15 units. The cultures were

harvested, resuspended in 30 ml of buffer (20 mM

imidazole, 20 mM phosphate buffer, 500 mM

NaCl, pH 7.0), disrupted by two passages through

and stirring was continued until its completion. The

reaction mixture was loaded on silica gel column

and eluted with methanol. Yield: 1.83 g, 71 %, R_f

1

0.52 (methanol/chloroform, 1:4). H NMR (400

MHz, CDCl₃): δ_H1.33 (s, 3H, isopropylidene-

CH₃), 1.38 (s, 3H, isopropylidene-CH₃), 3.56 (m,

1H, H-5’), 3.59 (m, 1H, H-3’), 3.62 (m, 1H, H-2’),

3.82 (br s, 1H, H-6’-methylene), 4.02 (br s, 1H, H-

4’), 4.24 (d, 1H, H-1’, J=7.8 Hz), 4.12-4.25 (m,

4H, 2 methylene groups). MALDI-TOF MS

calculated for C₁₂H₂₂O₈m/e 294.30; measured

295.10.

The observed material from the previous step (1.75

g, 0.006 mol) was stirred in a mixture of acetic

o

acid-water (60 mL, 4:1) at 60 C during 4.5 h. The

reaction progress was monitored by TLC

(methanol/chloroform, 1:4). After completion, the

reaction mixture was evaporated; the residue was

washed 4 times with methanol and the crude was

purified by column chromatography on silica gel

(chloroform/methanol, 1:1) to afford compound 5

as colorless oil. Yield: 1.16 g, 77 %, R_f0.53

homogenizer

(Avestin,

Emulsiflex),

and

centrifuged (14,000 × g for 15 min) to obtain

soluble extracts. The His-tagged, fused proteins

were purified using a 5-ml His-trap column

mounted on a ÄKTA-avant FPLC system (GE

healthcare). In the case of the purified response

regulator GalT2 E. coli BL21(DE3) (pET9d-galT2)

culture was grown in Terrific Broth (TB) with

kanamycin (25 μg ml⁻¹) (1×500 ml in 2-L shake

flasks) at 37°C without induction, until turbidity

reached 3-4 OD₆₀₀. To improve solubility, growth

was then carried out at 18°C in the presence of 0.4

mM IPTG for 16 h to a final turbidity at 600 nm of

about 8 to 11 units. The cultures were harvested,

resuspended in 30 ml of buffer (20 mM imidazole,

20 mM phosphate buffer, 500 mM NaCl, pH 7.0),

disrupted by two passages through homogenizer

(Avestin, Emulsiflex), and centrifuged (14,000 × g

for 15 min) to obtain soluble extracts. The His-

tagged GalT2 was mounted on a ÄKTA-avant

FPLC system (GE healthcare), according to the

manufacturer's instructions, and isolated using a 5-

ml His-trap column (GE healthcare). The purified

response regulator, GalT2, was dialyzed overnight

against 2 liters of buffer containing 50 mM Tris-

HCl (pH 7.0) and 100 mM KCl, followed by the

addition of EDTA and glycerol to final

concentrations of 1 mM and 10 %, respectively.

1

(chloroform-methanol, 1:1). H NMR (600 MHz,

MeOD-d₄): δ_H3.52 (dd, 1H, H-1a, J_1a,2= 3.6 Hz,

J

_1a,1b= 12.0 Hz), 3.77 (dd, 1H, H-1b, J_1b,2= 3.5 Hz,

J_1b,1a= 12.0 Hz), 3.58 (m, 1H, H-2), 3.47 (dd, 1H,

H-3a, J_3a,2= 5.2 Hz, J_3a,3b= 11.0 Hz), 3.69 (dd, 1H,

H-3b, J_3b,2= 5.1 Hz, J_3b,3a=11.0 Hz), 4.23 (d, 1H,

H-1’, J_1’,2’= 7.6 Hz), 3.76 (t, 1H, H-2’, J_2’,3’= 6.4

Hz), 3.55 (dd, H-3’, J_3’,2’= 6.4 Hz, J_3’,4’= 5.5 Hz),

3.68 (dd, 1H, H-4’, J_4’,3’= 5.5 Hz, J_4’,5’= 4.2 Hz),

3.72 (ddd, 1H, H-5’, J_5’,4’= 4.2 Hz, J_5’,6a= 4.7 Hz,

J

_5’,6b= 5.5 Hz), 3.81 (m, 2H, H-6’). ¹³C NMR (600

MHz, MeOD-d₄): δ_C62.51 (C-6’), 64.07 (C-1),

70.31 (C-3), 72.19 (C-2), 72.42 (C-2’), 72.58 (C-

4’), 72.64 (C-3’), 76.75 (C-5’), 105.21 (C-1’).

MALDI-TOF MS calculated for C₉H₁₈O₈Na

([M+Na]⁺) m/e 277.20; measured 277.10.

Production and purification of His₆-tagged

GalP, GanE2, Gan1D, Cel1A and GalT2

The galP, ganE2, gan1D, celA and galT2 open

reading frame were all cloned into pET9d vector

(Novagen). The lipoproteins GalP and and GalE2

were cloned without their 27 and 30 N-terminal

lipoprotein coding sequences, respectively. All the

primers were designed to allow in-frame cloning of

the genes into the T7 polymerase expression vector

using restriction sites at the 5’ terminus and at the

Biochemical characterization of Gan1D

The activity of Gan1D towards aryl-phospho-β-D-

glycosides was determined spectroscopically at 405

12

Growth of G. stearothermophilus on galactosides & cellobiose

nm, following the release of the p-nitrophenyl or o-

least 10 times the molar concentration of the

protein, were added by a 40 μl rotating stirrer-

syringe to a reaction cell containing 200 μl of 0.04

mM protein solution. Separate titrations of the

ligand into the buffer solution determined that the

heat of dilution was negligible. Calorimetric data

analysis was carried out with the Origin 7.0

software (OriginLab).

nitrophenyl. The reactions were performed at 40°C

in 100 mM citric acid-Na₂HPO₄buffer pH 6.5, 1

mg/ml BSA (Bovine Serum Albumin) and 0.13

µg/ml Gan1D. Substrate concentrations were in the

range of 0-5 mM. The reactions were initialized by

adding 20µl of appropriately diluted pre-warmed

substrate to 180 µl pre-warmed enzyme solution in

a 96-well-plate. The absorbance at 405 nm was

measured at 30 sec intervals for 20 min using a

Synergy HT Multi-Mode Microplate Reader (Bio-

Tek Instruments, Winooski, VT, USA). The molar

extinction coefficients of o-nitrophenol and p-

nitrophenol as determined under the described

conditions were Δε=0.63 mM⁻¹cm⁻¹and Δε=3.03

mM⁻¹cm⁻¹, respectively. All measurements were

performed in duplicates and the relative error was

less than 5%. The kinetic studies with natural

substrates were performed by following the release

of glucose. The reactions were performed at 40°C

in 100 mM citric acid-Na₂HPO₄buffer pH 6.5, 1

mg/ml BSA and 0.5 µg/ml Gan1D. Substrate

concentrations were in the range of 0-24 mM. The

reactions were initialized by adding 20 µl of

appropriately diluted pre-warmed substrate to 80 µl

pre-warmed enzyme solution in 1.7 ml tubes. After

10 min the reactions were terminated by the

addition of 25 µl of 0.2 M Na₂CO₃. The amount of

glucose released was measured using a high-

performance-anion-exchange-chromatography

Mobility-shift DNA-binding assays

To map the DNA region to which GalT2 is

bind, fluorescently labeled double-stranded DNA

probes were generated via PCR, using Cy5-labeled

primers (Table 1). Binding was performed in

binding reaction mixture (30-µl total volume)

containing 20 µl of solution comprised of 50 mM

Tris-Cl [pH 7.5], 100 mM KCl, 10% glycerol, 1

mM EDTA, 2 µg of salmon sperm DNA, 0.66 mM

dithiothreitol, 33 µg of bovine serum albumin, 0.1

pmol of labeled probe and N-terminus His6-

GalT2. The binding mixture was incubated for 30

min at 45°C and then separated on a 6.6%

nondenaturing polyacrylamide gel prepared in Tris-

borate-EDTA buffer that run for 1 h. Fluorescence

was detected directly on gel using a Fusion FX

system (Vilber).

Phosphorylation of His₆-GalT2

Phosphorylation

of

His₆-GalT2

was

(HPAEC) system equipped with a PA1 column

(Dionex, Sunnyvale, CA, USA). The elution was

carried out using two buffer eluents, eluent A (150

mM NaOH) and eluent B (150 mM NaOH and 500

mM sodium acetate). The gradient was

programmed as follows: 0–1 min, isocratic elution

using 100% A and 0% B; 1–50 min, linear gradient

to 0% A and 100% B. The elution rate was 1

ml/min, where glucose and galactose (of known

concentrations) were used as standards.

accomplished by following the protocol of Lukat et

al. (37). The GalT2 protein (250 µg) was

incubated for 30 min at RT in 0.2 ml of a buffer

containing 100 mM Tris-HCl (pH 7.0), 8.5 mM

MgCl₂and 50 mM acetyl phosphate (Sigma). The

phosphorylated form of GalT2 (dimer in solution)

was separated by size exclusion using an ÄKTA-

avant system (GE healthcare) equipped with a

Superose 12 HR gel-filtration column (GE

Healthcare Life Sciences) of 24 ml total column

volume. Protein samples (0.2 µl) were applied onto

the column and eluted at room temperature with a

solution consisting of 50 mM Tris-HCl buffer pH

7.0, 100 mM NaCl and 0.02% sodium azide, at a

flow rate of 0.5 ml min⁻¹. Molecular weights were

determined from regression analysis of the log

relative molecular weight (Mr) of protein

Isothermal titration calorimetry (ITC)

ITC measurements were performed at 40°C with a

MicroCal iTC200 titration calorimeter (Malvern

Inst., Worcestershire, UK). Protein solutions were

dialyzed overnight against McIlvaine buffer (100

mM citric acid-Na₂HPO₄, pH 6.5). Ligand

solutions of galactose, glucose, cellobiose, and

lactose were prepared by dilution with the protein

dialysis buffer. Ligand solution aliquots (2-4 μl), at

standards.

The protein standards used were

Thyroglobulin (Mr, 669,000), Ferritin (Mr,

440,000), Aldolase (Mr, 158,000), Conalbumin

13

Growth of G. stearothermophilus on galactosides & cellobiose

(Mr, 75,000) and Ovalbumin (Mr, 44,000) (GH

Healthcare).

Growth of G. stearothermophilus T-1 on lactose,

and galactosyl-glycerol

G. stearothermophilus T-1 was grown on modified

basic salt medium (mBSM) (53) supplemented

with 0.4% (wt/vol) of cellobiose as the sole carbon

source. The cellobiose-induced logarithmic culture

that reached 0.4 OD₆₀₀was washed twice with

mBSM and then diluted 10-fold in 96-well plate

containing mBSM supplemented, for example with

0.05% cellobiose and 0.4% lactose. The plate (200

µl total volume per well) was incubated with

shaking at 60˚C, and monitored for cell growth

(OD₆₀₀) in a microplate spectrophotometer (Epoch,

BioTek).

Data Availability

All data presented are contained in the

manuscript. The 14,067-bp sequence containing

the galactose utilization region, the cellobiose PTS

system, and the galactose PTS system from

G. stearothermophilus T-1 have been deposited in

the GenBank^TMunder accession numbers

KF840174.1,

respectively.

MT424749

and

MT441723,

14

Growth of G. stearothermophilus on galactosides & cellobiose

Acknowledgments

We thank Steve Withers for the Klebsiella pneumonia β-glucosidase kinase (BglK) clone. SL is

grateful to the Azrieli Foundation for the award of an Azrieli Fellowship. YS holds the Erwin and Rosl

Pollak Chair in Biotechnology at the Technion.

Funding and additional information

This work was supported by the United States-Israel Binational Science Foundation (BSF) Jerusalem,

Israel (grant No. 96-178 to YS); the Israel Science Foundation Grants 500/10 and 152/11 (to YS) and

1905/15 (to GS); the Israel Ministry of Science and Technology Grant 3-12484 (to YS and GS); the I-

CORE Program of the Planning and Budgeting Committee; the Ministry of Environmental Protection

and the Grand Technion Energy Program (GTEP), and comprises part of The Leona M. and Harry B.

Helmsley Charitable Trust Reports on Alternative Energy series of the Technion, Israel Institute of

Technology and the Weizmann Institute of Science. YS acknowledges partial support by the Russell

Berrie Nanotechnology Institute and The Lorry I. Lokey Interdisciplinary Center for Life Science and

Engineering, Technion.

Conflict of Interest: The authors declare no conflicts of interest in regards to this manuscript.

References

1.

2.

Shulami, S., Gat, O., Sonenshein, A. L., and Shoham, Y. (1999) The glucuronic acid

utilization gene cluster from Bacillus stearothermophilus T-6. J Bacteriol 181, 3695-

3704

Shulami, S., Raz-Pasteur, A., Tabachnikov, O., Gilead-Gropper, S., Shner, I., and

Shoham, Y. (2011) The L-Arabinan utilization system of Geobacillus

stearothermophilus. J Bacteriol 193, 2838-2850

3.

4.

Tabachnikov, O., and Shoham, Y. (2013) Functional characterization of the galactan

utilization system of Geobacillus stearothermophilus. FEBS J 280, 950-964

Bravman, T., Mechaly, A., Shulami, S., Belakhov, V., Baasov, T., Shoham, G., and

Shoham, Y. (2001) Glutamic acid 160 is the acid-base catalyst of beta-xylosidase from

Bacillus stearothermophilus T-6: a family 39 glycoside hydrolase. FEBS Lett 495,

115-119

5.

6.

Zaide, G., Shallom, D., Shulami, S., Zolotnitsky, G., Golan, G., Baasov, T., Shoham,

G., and Shoham, Y. (2001) Biochemical characterization and identification of catalytic

residues in alpha-glucuronidase from Bacillus stearothermophilus T-6. Eur J Biochem

268, 3006-3016

Shallom, D., Belakhov, V., Solomon, D., Shoham, G., Baasov, T., and Shoham, Y.

(2002) Detailed kinetic analysis and identification of the nucleophile in alpha-L-

arabinofuranosidase from Geobacillus stearothermophilus T-6, a family 51 glycoside

hydrolase. J Biol Chem 277, 43667-43673

7.

8.

Hovel, K., Shallom, D., Niefind, K., Belakhov, V., Shoham, G., Baasov, T., Shoham,

Y., and Schomburg, D. (2003) Crystal structure and snapshots along the reaction

pathway of a family 51 alpha-L-arabinofuranosidase. EMBO J 22, 4922-4932

Golan, G., Shallom, D., Teplitsky, A., Zaide, G., Shulami, S., Baasov, T., Stojanoff,

V., Thompson, A., Shoham, Y., and Shoham, G. (2004) Crystal structures of

15

Growth of G. stearothermophilus on galactosides & cellobiose

Geobacillus stearothermophilus alpha-glucuronidase complexed with its substrate and

products: mechanistic implications. J Biol Chem 279, 3014-3024

9.

Shulami, S., Zaide, G., Zolotnitsky, G., Langut, Y., Feld, G., Sonenshein, A. L., and

Shoham, Y. (2007) A two-component system regulates the expression of an ABC

transporter for xylo-oligosaccharides in Geobacillus stearothermophilus. Appl Environ

Microbiol 73, 874-884

10.

Teplitsky, A., Mechaly, A., Stojanoff, V., Sainz, G., Golan, G., Feinberg, H., Gilboa,

R., Reiland, V., Zolotnitsky, G., Shallom, D., Thompson, A., Shoham, Y., and

Shoham, G. (2004) Structure determination of the extracellular xylanase from

Geobacillus stearothermophilus by selenomethionyl MAD phasing. Acta Crystallogr

D Biol Crystallogr 60, 836-848

11.

12.

13.

Czjzek, M., Ben David, A., Bravman, T., Shoham, G., Henrissat, B., and Shoham, Y.

(2005) Enzyme-substrate complex structures of a GH39 beta-xylosidase from

Geobacillus stearothermophilus. J Mol Biol 353, 838-846

Solomon, V., Teplitsky, A., Shulami, S., Zolotnitsky, G., Shoham, Y., and Shoham, G.

(2007) Structure-specificity relationships of an intracellular xylanase from Geobacillus

stearothermophilus. Acta Crystallogr D Biol Crystallogr 63, 845-859

Alalouf, O., Balazs, Y., Volkinshtein, M., Grimpel, Y., Shoham, G., and Shoham, Y.

(2011) A new family of carbohydrate esterases is represented by a GDSL

hydrolase/acetylxylan esterase from Geobacillus stearothermophilus. J Biol Chem

286, 41993-42001

14.

15.

Salama, R., Alalouf, O., Tabachnikov, O., Zolotnitsky, G., Shoham, G., and Shoham,

Y. (2012) The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 beta-

L-arabinopyranosidase. FEBS Lett 586, 2436-2442

Lansky, S., Salama, R., Solomon, H. V., Feinberg, H., Belrhali, H., Shoham, Y., and

Shoham, G. (2014) Structure-specificity relationships in Abp, a GH27 beta-L-

arabinopyranosidase from Geobacillus stearothermophilus T6. Acta Crystallogr D

Biol Crystallogr 70, 2994-3012

16.

17.

Solomon, H. V., Tabachnikov, O., Lansky, S., Salama, R., Feinberg, H., Shoham, Y.,

and Shoham, G. (2015) Structure-function relationships in Gan42B, an intracellular

GH42 beta-galactosidase from Geobacillus stearothermophilus. Acta Crystallogr D

Biol Crystallogr 71, 2433-2448

Cuskin, F., Lowe, E. C., Temple, M. J., Zhu, Y., Cameron, E., Pudlo, N. A., Porter, N.

T., Urs, K., Thompson, A. J., Cartmell, A., Rogowski, A., Hamilton, B. S., Chen, R.,

Tolbert, T. J., Piens, K., Bracke, D., Vervecken, W., Hakki, Z., Speciale, G., Munoz-

Munoz, J. L., Day, A., Pena, M. J., McLean, R., Suits, M. D., Boraston, A. B., Atherly,

T., Ziemer, C. J., Williams, S. J., Davies, G. J., Abbott, D. W., Martens, E. C., and

Gilbert, H. J. (2015) Human gut Bacteroidetes can utilize yeast mannan through a

selfish mechanism. Nature 517, 165-169

18.

19.

Saier, M. H., Jr. (2015) The Bacterial Phosphotransferase System: New Frontiers 50

Years after Its Discovery. J Mol Microbiol Biotechnol 25, 73-78

Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., and Henrissat, B.

(2014) The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res

42, D490-495

20.

Yu, W. L., Jiang, Y. L., Pikis, A., Cheng, W., Bai, X. H., Ren, Y. M., Thompson, J.,

Zhou, C. Z., and Chen, Y. (2013) Structural insights into the substrate specificity of a

16

Growth of G. stearothermophilus on galactosides & cellobiose

6-phospho-beta-glucosidase BglA-2 from Streptococcus pneumoniae TIGR4. J Biol

Chem 288, 14949-14958

21.

Shallom, D., Leon, M., Bravman, T., Ben-David, A., Zaide, G., Belakhov, V.,

Shoham, G., Schomburg, D., Baasov, T., and Shoham, Y. (2005) Biochemical

characterization and identification of the catalytic residues of a family 43 beta-D-

xylosidase from Geobacillus stearothermophilus T-6. Biochemistry 44, 387-397

West, A. H., and Stock, A. M. (2001) Histidine kinases and response regulator proteins

in two-component signaling systems. Trends Biochem Sci 26, 369-376

Gallegos, M. T., Schleif, R., Bairoch, A., Hofmann, K., and Ramos, J. L. (1997)

Arac/XylS family of transcriptional regulators. Microbiol Mol Biol Rev 61, 393-410

Jarmer, H., Larsen, T. S., Krogh, A., Saxild, H. H., Brunak, S., and Knudsen, S. (2001)

Sigma A recognition sites in the Bacillus subtilis genome. Microbiology 147, 2417-

2424

22.

23.

24.

25.

26.

Rhodius, V. A., and Busby, S. J. (1998) Positive activation of gene expression. Curr

Opin Microbiol 1, 152-159

Barnard, A., Wolfe, A., and Busby, S. (2004) Regulation at complex bacterial

promoters: how bacteria use different promoter organizations to produce different

regulatory outcomes. Curr Opin Microbiol 7, 102-108

27.

Buschiazzo, A., and Trajtenberg, F. (2019) Two-Component Sensing and Regulation:

How Do Histidine Kinases Talk with Response Regulators at the Molecular Level?

Annu Rev Microbiol 73, 507-528

28.

29.

Kenney, L. J. (2000) Response-regulator phosphorylation and activation: a two-way

street? response. Trends Microbiol 8, 155-156

Bogel, G., Schrempf, H., and Ortiz de Orue Lucana, D. (2007) DNA-binding

characteristics of the regulator SenR in response to phosphorylation by the sensor

histidine autokinase SenS from Streptomyces reticuli. FEBS J 274, 3900-3913

Lansky, S., Zehavi, A., Belrhali, H., Shoham, Y., and Shoham, G. (2017) Structural

basis for enzyme bifunctionality - the case of Gan1D from Geobacillus

stearothermophilus. FEBS J 284, 3931-3953

Schulte, D., and Hengstenberg, W. (2000) Engineering the active center of the 6-

phospho-beta-galactosidase from Lactococcus lactis. Protein Eng 13, 515-518

Sastry, P. S. (1974) Glycosyl glycerides. Adv Lipid Res 12, 251-310

Gounaris, K., and Barber, J. (1983) Monogalactosyldiacylglycerol: The most abundant

polar lipid in nature. Trends in Biochemical Sciences 8, 378-381

Aleksandrzak-Piekarczyk, T., Kok, J., Renault, P., and Bardowski, J. (2005)

Alternative lactose catabolic pathway in Lactococcus lactis IL1403. Appl Environ

Microbiol 71, 6060-6069

30.

31.

32.

33.

34.

35.

Knezevic, I., Bachem, S., Sickmann, A., Meyer, H. E., Stulke, J., and Hengstenberg,

W. (2000) Regulation of the glucose-specific phosphotransferase system (PTS) of

Staphylococcus carnosus by the antiterminator protein GlcT. Microbiology 146 ( Pt

9), 2333-2342

36.

Himmel, S., Grosse, C., Wolff, S., Schwiegk, C., and Becker, S. (2012) Structure of

the RBD-PRDI fragment of the antiterminator protein GlcT. Acta Crystallogr Sect F

Struct Biol Cryst Commun 68, 751-756

17

Growth of G. stearothermophilus on galactosides & cellobiose

37.

38.

39.

40.

41.

Lukat, G. S., McCleary, W. R., Stock, A. M., and Stock, J. B. (1992) Phosphorylation

of bacterial response regulator proteins by low molecular weight phospho-donors.

Proc Natl Acad Sci U S A 89, 718-722

Blanco, A. G., Sola, M., Gomis-Ruth, F. X., and Coll, M. (2002) Tandem DNA

recognition by PhoB, a two-component signal transduction transcriptional activator.

Structure 10, 701-713

Bordi, C., Ansaldi, M., Gon, S., Jourlin-Castelli, C., Iobbi-Nivol, C., and Méjean, V.

(2004) Genes Regulated by TorR, the Trimethylamine Oxide Response Regulator of

Shewanella oneidensis. Journal of Bacteriology 186, 4502-4509

Sun, Z., Chen, Y., Yang, C., Yang, S., Gu, Y., and Jiang, W. (2015) A novel three-

component system-based regulatory model for D-xylose sensing and transport in

Clostridium beijerinckii. Mol Microbiol 95, 576-589

Sand, A., Holwerda, E. K., Ruppertsberger, N. M., Maloney, M., Olson, D. G., Nataf,

Y., Borovok, I., Sonenshein, A. L., Bayer, E. A., Lamed, R., Lynd, L. R., and Shoham,

Y. (2015) Three cellulosomal xylanase genes in Clostridium thermocellum are

regulated by both vegetative SigA (sigma(A)) and alternative SigI6 (sigma(I6))

factors. FEBS Lett 589, 3133-3140

42.

Nataf, Y., Bahari, L., Kahel-Raifer, H., Borovok, I., Lamed, R., Bayer, E. A.,

Sonenshein, A. L., and Shoham, Y. (2010) Clostridium thermocellum cellulosomal

genes are regulated by extracytoplasmic polysaccharides via alternative sigma factors.

Proc Natl Acad Sci U S A 107, 18646-18651

43.

44.

45.

46.

Frey, P. A. (1996) The Leloir pathway: a mechanistic imperative for three enzymes to

change the stereochemical configuration of a single carbon in galactose. FASEB J 10,

461-470

Rosey, E. L., Oskouian, B., and Stewart, G. C. (1991) Lactose metabolism by

Staphylococcus aureus: characterization of lacABCD, the structural genes of the

tagatose 6-phosphate pathway. J Bacteriol 173, 5992-5998

Jagusztyn-Krynicka, E. K., Hansen, J. B., Crow, V. L., Thomas, T. D., Honeyman, A.

L., and Curtiss, R., 3rd. (1992) Streptococcus mutans serotype c tagatose 6-phosphate

pathway gene cluster. J Bacteriol 174, 6152-6158

Van der Heiden, E., Delmarcelle, M., Lebrun, S., Freichels, R., Brans, A.,

Vastenavond, C. M., Galleni, M., and Joris, B. (2013) A pathway closely related to the

(D)-tagatose pathway of gram-negative enterobacteria identified in the gram-positive

bacterium Bacillus licheniformis. Appl Environ Microbiol 79, 3511-3515

Mokhtari, A., Blancato, V. S., Repizo, G. D., Henry, C., Pikis, A., Bourand, A., de

Fatima Alvarez, M., Immel, S., Mechakra-Maza, A., Hartke, A., Thompson, J., Magni,

C., and Deutscher, J. (2013) Enterococcus faecalis utilizes maltose by connecting two

incompatible metabolic routes via a novel maltose 6'-phosphate phosphatase (MapP).

Mol Microbiol 88, 234-253

47.

48.

49.

50.

Saier, M. H., Jr., and Crasnier, M. (1996) Inducer exclusion and the regulation of sugar

transport. Res Microbiol 147, 482-489

Deutscher, J. (2008) The mechanisms of carbon catabolite repression in bacteria. Curr

Opin Microbiol 11, 87-93

Gorke, B., and Stulke, J. (2008) Carbon catabolite repression in bacteria: many ways

to make the most out of nutrients. Nat Rev Microbiol 6, 613-624

18

Growth of G. stearothermophilus on galactosides & cellobiose

51.

Honeyman, A. L., and Curtiss, R., 3rd. (1993) Isolation, characterization and

nucleotide sequence of the Streptococcus mutans lactose-specific enzyme II (lacE)

gene of the PTS and the phospho-beta-galactosidase (lacG) gene. J Gen Microbiol

139, 2685-2694

52.

53.

Danchin, A. (2009) Cells need safety valves. Bioessays 31, 769-773

Shulami, S., Shenker, O., Langut, Y., Lavid, N., Gat, O., Zaide, G., Zehavi, A.,

Sonenshein, A. L., and Shoham, Y. (2014) Multiple regulatory mechanisms control the

expression of the Geobacillus stearothermophilus gene for extracellular xylanase. J

Biol Chem 289, 25957-25975

54.

55.

Marmur, J. (1961) A procedure for the isolation of deoxyribonucleic acid from micro-

organisms. J Mol Biol 3, 208–218

Johnson, J. L. (1981) Manual of Methods for General Bacteriology in

(Gerhardt, P., CostilowR.G.E., E.W., N., Wood W.A., N.R., Krieg, R., and Philips, G.

B. eds.), AmericanSocietyforMicrobiology,Washington,D.C. . pp 450–472

Sambrook, J., and Russell, D. W. (2001) Molecular cloning: a laboratory manual, 3rd

ed. ed., Cold Spring Harbor,, NY.

Thompson, J., Lichtenthaler, F. W., Peters, S., and Pikis, A. (2002) Beta-glucoside

kinase (BglK) from Klebsiella pneumoniae. Purification, properties, and preparative

synthesis of 6-phospho-beta-D-glucosides. J Biol Chem 277, 34310-34321

Cateni, F., Bonivento, P., Procida, G., Zacchigna, M., Scialino, G., and Banfi, E.

(2007) Chemoenzymatic synthesis and in vitro studies on the hydrolysis of

antimicrobial monoglycosyl diglycerides by pancreatic lipase. Bioorg Med Chem Lett

17, 1971-1978

56.

57.

58.

59.

60.

Janwitayanuchit, W., Suwanborirux, K., Patarapanich, C., Pummangura, S., Lipipun,

V., and Vilaivan, T. (2003) Synthesis and anti-herpes simplex viral activity of

monoglycosyl diglycerides. Phytochemistry 64, 1253-1264

Mechaly A., Belakhov V., Shoham Y., and Baasov T. (1997) An Efficient Chemical-

Enzymatic Synthesis of 4-Nitrophenyl β-Xylobioside - a Chromogenic Substrate for

Xylanases. Carbohydrate Research 304, 111-115

19

Growth of G. stearothermophilus on galactosides & cellobiose

Table 1. Michaelis–Menten catalytic constants for the hydrolysis of synthetic and natural substrates

by Cel1A.

k_cat

K_m

(mM)

k_cat/K_m

Substrate

(s^-1)

(s^-1·M^-1)

oNP-β-D-glucopyranoside-6-p (oNPβGlc6P)

oNP-β-D-galactopyranoside-6-p (oNPβGal6P)

Cellobiose-6-phosphate

106

0.22

ND

5.1

4.8 x 10⁵

ND

60

1.2 x 10⁴

ND

Lactose-6-phosphate

ND

oNP-β-D-glucopyranoside (oNPβGlc)

ND

The reactions were performed at 40°C, in 100 mM citric acid-Na₂HPO₄buffer pH 7.

ND= Non-detectable.

Table 2. Thermodynamic parameters for the binding of potential substrates to

GalE2 and GalP.

K_D

(µM)

ΔH_B

TΔS_B

ΔG_B

Protein Ligand

n

(kcal·mol^-1)

(kcal·mol^-1) (kcal·mol^-1)

Galactose 1.12 1.4

Glucose 1.04 3.1

Galactose 0.65 6.1

Glucose 0.71 4.2

-5.8± 0.3

-7.0 ± 0.4

-10± 0.6

0.3

0.8

-2.6

-1.3

-6.1

-7.8

-12.6

-10.2

GalE2

GalP

-9.0 ± 0.2

Table 3. Michaelis-Menten catalytic constants for the hydrolysis

of synthetic and natural substrates by Gan1D^a.

Substrate

k_cat(s^-1)

K_m(mM)

k_cat/K_m(s^-1·M^-1)

oNPβGal-6P

oNPβGlc-6P

pNPβGlc-6P

Cel-6P

Lac-6P

Gen-6P

148

143

114

74

0.32

0.17

0.12

0.86

1.1

2.9

ND

4.9 x 10⁵

8.4 x 10⁵

9.3 x 10⁵

8.6 x 10⁴

2.3 x 10⁴

4.1 x 10³

ND

25

12

oNPβGal

oNPβGlc

ND^b

ND

^aThe reactions were performed at 40°C, in 100 mM citric acid-

b

Na₂HPO₄buffer pH 6.5. ND- Non-detectable. All measurements

were performed in duplicate and the relative error was less than 5%.

20

Growth of G. stearothermophilus on galactosides & cellobiose

Table 4. Oligonucleotides used in this study

Primer

gan1D N-ter

gan1D C-ter

celA N-ter

celA C-ter

galP N-ter

galP C-ter

galT2 N-ter

galT2 C-ter

galE2 N-ter

galE2 C-ter

Fwr gan1D

Rev gan1D

Fwr galE2

Rev galE2

Fwr galP

Rev galP

Fwr ptsA

Sequence (5’-3’) a,b

Application

5'-TATAGTCATGATACATCACCACCACCACCATGAGCATCGTCATCTTAAAC-3’

5'-TATACGGATCCCTACAGCTCGGCACCGTTC-3'

5'-TATACCCATGGGGCATCATCATCACCACCACAAACGATTGAAAATG-3’

5'-ATGCGAGATCTTTAGTTTCCAGCTACTGTTTTG-3’

5'-TATACCCATGGGGCACCATCATCATCATCATGCTTGGAACGTGTATGCGTATCC -3’

5'-TATCAGGATCC TCATGGCGTGTTGACCTCATAATTGC-3’

5'-ATATATCCATGGTGCATCATCATCATCATCATAAAGTGGCGATCGTCGAT-3’

5'-TATATAGGATCCTCAGCGCGCCTGTACTTTTTT-3’

5'-TATCGCCATGGGGCATCATCATCATCATCAT GATGACGCCAAACAA-3'

5'-ATGCGAGATCTTACTTCTTCAGTTCTG-3’

5'-GTTCCCGCCTGAGTTTTT-3’

Cloning into pET9d

5'-CCTTTTCCATCTTCGTTCCA-3’

5’- CTCTTCTTCGTCCGATGA-3’

5’- GTCCACCAGCTGAAAATCT-3’

5'-CGGCAGGCGAATATTGATG-3’

5'-CAAATTCCGCTTCCGTCAAC-3’

5’-GTTTGGCAACGCCTTGAAA-3’

Rev ptsA

5’-GCCTGCTTGCTCCATCACAT-3’

Fwr ptsD

Rev ptsD

Fwr mltE

Fwr citC

5’-CGCTCAAAGAGGAAGGAAA-3’

5’-CCGATGACGACTTGAAACTG-3’

5’-ACGAGACGTTTGCGAAGCT-3’

5’-ATTTTGCCGCCCGTATAG-3’

Real Time RT PCR

5’-GACTTGCGGCCGTGTTC-3

Rev citC

5’- GAAGACATCTACGCTGGCATT-3

Fwr celB

5'-ACAAGCTTGCTAGTGACGAA-3'

Rev celB

5'-GTGGGCCAATAAGAATGAC-3'

Fwr celC

5'-GATTCAAGAAGCAGAGCAAG-3'

Rev celC

5'-TGACATGACATGGTCTTCC-3'

Fwr celD

5'-CTAAGCAAAGTTCTCGTTCC-3'

Rev celD

5'-TTTCACTCATCACCTTGTCC-3'

Fwr celA

5'-GGTTTACCCACAATGAACC-3'

Rev celA

5'-CATCGTATGGTAAGCCACTT-3'

Fwr celR

5'-CACCGGTGTACCACTTAATC-3'

Rev celR

5'-GAGTTCGTGAGTGATGTAACG-3'

Fwr galE2

Cy5 Rev galE2

5'-CATAAAAGCGAAATGGCAGTC-3'

DNA-binding assays

5'-CTTATCAATCGGCGGCTTG-3'

^aBoldface bases indicate engineered restriction sites. ^bCy5 - Cyanine 5’end-labeled primers

21

Growth of G. stearothermophilus on galactosides & cellobiose

Figures

Figure 1. Schematic representation of the cellobiose PTS system and mRNA expression levels

of the related genes. (A) The gene cluster encodes for the cellobiose PTS enzyme system, celBCD,

a GH1 6-phospho-glucosidase, celA, and a GntR family transcriptional regulator, celR. The letter P

indicates the proposed promoter site, and Ω indicates the position of the putative rho-independent

transcription termination site. (B) Real-time RT PCR analysis of the cellobiose utilization gene

cluster. Total RNA was extracted from mid-logarithmic phase cultures of G. stearothermophilus

grown in minimal medium supplemented with either 0.5% cellobiose, xylose or glucose as the sole

carbon source. Normalization was performed using the housekeeping gene ict, which encodes for

isocitrate dehydrogenase. The error bars (in bar charts) are SD values.

22

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 2. Effect of temperature and pH in a 20 minutes reaction on Cel1A activity toward

oNPβGlc6P. (A) Relative activity at pH 7 at different temperatures. (B) Thermostability of Cel1A

at pH 7. Residual activity was measured after 10 min incubation at the indicated temperatures. (C)

Initial rate activity at different pHs. The reactions were performed at 40°C in either sodium

phosphate-citric acid buffer (pH3-7.8) or Atkins&Pantin buffer (pH 7.5-9.5).

23

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 3. Schematic representation of the 12.5 kb cluster containing galactose utilization

genes. The cluster contains a Tn31 transposon between gan4C and galP. The letter P indicates the

proposed promoter site, and Ω indicates the position of the putative rho-independent transcription

termination site.

24

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 4. Presentation of four putative PTS systems in strain T-1 and the expression of

galactose related genes in the presence of galactose. (A) Schematic gene organization of the PTS

systems for cellobiose, galactose, trehalose and mannitol. Cellobiose PTS enzyme II complex is

encoded by celB, celC, and celD; ptsABC ORFs encode for a PTS transporter for galactose; ptsD

encodes for trehalose PTS EIIBC; and mltE encodes for manitol PTS EIIBC. The celR and gntR

genes encode for transcriptional regulators; glcT and blgG encode for anti-terminator proteins; celA

encodes for 6-phospho-β-glucosidase; amyA encodes for trehalose-6-phosphate hydrolase and mltD

encodes for mannitol-1-phosphate 5-dehydrogenase (B) Real-time RT PCR analysis of the galactose

related gene cluster in G. stearothermophilus T-1. (C) Real-time RT PCR analysis of the four

putative PTS systems in strain T-1. Total RNA was extracted from mid-logarithmic phase cultures

of G. stearothermophilus grown in minimal medium supplemented with different sugars (0.5%) as

the sole carbon source. Normalization was performed using the housekeeping gene for isocitrate

dehydrogenase, ict. The error bars (in bar charts) are SD values

25

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 5. Calorimetric titration of GalE2 and GalP galactose and glucose. The top half of each

experiment shows the raw data for calorimetric titration of the protein with the ligand, and the lower

half displays the integrated injection heats from the upper panel. The solid line is the curve of best fit

to a single binding site (n=1) model that was used to derive the binding parameters. Experiments were

performed at 40°C.

26

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 6. Gel shift assays demonstrating binding of unphosphorylated and phosphorylated His₆-

GalT2 to the galE2 promoter. (A) The promoter region of galE2. The horizontal arrows indicate

repeat binding sites for the response regulator GalT2. The -35 and -10 regions, the ribosome-binding

site (RBS), and the ATG initiating codon are in bold. The sequences of the primers used to synthesize

a PCR product of 113-bp DNA fragment the for the gel shift assay are underlined. (B) Fluorescently

labeled 113-bp DNA fragment containing the galE2 promoter was incubated with increasing amounts

of His₆-GalT2. (C) Size-exclusion chromatograms (overlaid) of unphosphorylated His₆-GalT2 (solid

black line) and phosphorylated His₆-GalT2 (solid gray line). The inset shows the linear regression of

the protein standards used for Mr determination (filled circles) and the position of the dimeric and

monomeric forms of GalT2 on this curve are marked with arrows. (D) The fluorescently labeled 113-

bp DNA fragment was incubated with increasing amounts of phosphorylated His₆-GalT2.

27

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 7. Growth of G. stearothermophilus strain T-1 and T-6 on lactose or galactosyl-glycerol in

the presence of cellobiose. Cellobiose-induced logarithmic culture at 0.4 OD₆₀₀was washed twice

with mBSM and then diluted 10-fold in 96-well plate containing (A) mBSM supplemented with 0.4

% lactose and varoius concentrations of cellobiose. Cellobiose concentrations were: () 0.01%, ()

0.02%, () 0.04%, () 0.05%, () 0.1 %, () 0.2% cellobiose. mBSM supplemented only with

0.1% cellobiose or 0.4% lactose as a sole carbon source is shown in () and (◊), respectively. (B)

mBSM supplemented with 0.4 % galactosyl-glycerol and varoius concentrations of cellobiose.

Cellobiose concentrations were: () 0.05%, () 0.1 %, () 0.2%. (C) Growth of G.

stearothermophilus T-6 (lacks the gan1D gene) on mBSM supplemented with 0.4 % lactose and

varoius concentrations of cellobiose Concentrations of cellobiose were as follow: () 0.01%, ()

0.02%, () 0.04%, () 0.1 %, () 0.2%. The path length in the wells was 0.6 cm. The inserts show

the growth rate (dx/dt) on lactose or galactosyl-glycerol as function of final cell mass grown on

cellobiose.

28

Growth of G. stearothermophilus on galactosides & cellobiose

Figure 8. Proposed pathways for the utilization of galactan, galactose, cellobiose, and β-

galactosides in G. stearothermophilus T-1. The extracellular β-1,4-galactanase Gan53A cleaves

galactan and generates short galacto-oligosaccharides which enter the cell via a specific ABC transport

system (GanEFG), and further degraded by the intracellular β-galactosidase Gan42B into galactose

(3 ). Galactose is metabolized via the Leloir pathway involving the galKETR operon encoding for

galactokinase (galK), UDP-glucose 4-epimerase (galE), galactose-1-phosphate uridyltransferase

(galT), and a transcriptional regulator (galR). Extracellular galactose binds the high affinity sugar-

binding protein, GalP, which presents the sugar to the sensor histidine kinase (GalS). GalS

phosphorylates the response regulator (GalT2), which in turn binds to the galE2 promoter and

activates the expression of the ABC transport system for galactose (GalE2F2G2). In addition,

galactose can be imported by a specific PTS for galactose (PtsABC). Inside the cell, the

phosphorylated galactose (galactose-6-phosphate) is further metabolized via the tagatose-6-phosphate

pathway, to dihydroxyacetone phosphate (DHAP) and glyceraldehyde 3-phosphate (GAP) or

29

Growth of G. stearothermophilus on galactosides & cellobiose

alternatively, hydrolyzed by a phosphatase to galactose and Pi. Strain T-1 encodes for homologous

tagatose pathway genes including, galactose-6-phosphate isomerase (galA), tagatose-6P kinase (galB)

and tagatose 1,6-bisphosphate aldolase (galC). Cellobiose is imported to the cell by a dedicated PTS

(celBCD) and is further hydrolyzed inside the cell by 6-phospho-β-glucosidase (Cel1A) to glucose-6-

phoshate and glucose. Other galacto-moiety di-saccharides including lactose, and galactosyl-glycerol

can be also imported by the PTS for cellobiose. Lactose and galactosyl-glycerol are further hydrolyzed

by Gan1D to galactose-6-phosphate and glucose or glycerol, respectively. The letter P on the genetic

map indicate proposed promoter sites, and Ω indicates the position of a hypothetical rho-independent

transcription termination sites.

30

Article Doi

Cross-utilization of b-galactosides and cellobiose in Geobacillus stearothermophilus

DOI: 10.1074/jbc.ra120.014029

Source and publish data:

Authors:

Article abstract of DOI:10.1074/jbc.ra120.014029

Full text of DOI:10.1074/jbc.ra120.014029

Products guided by the article

R&D Labs maybe for 55196-70-8

Relevant to this article

Hot Product