Facile synthesis of acetal over a supported novel Br?nsted and lewis acid ionic liquid catalyst

Article abstract of DOI:10.1166/jnn.2019.16370

A novel Br?nsted and Lewis acid ionic liquid (IL) chlorinated butyrolactam chlorozincinate (CPCl-ZnCl₂) was synthesized by a hydrothermal process and characterized by Fourier transform infrared (FT-IR). The Fe-SBA-15 mesoporous materials with different Si/Fe mole ratios were prepared by direct synthesis method. The supported ionic liquid (IL/Fe-SBA-15) with various IL contents were prepared by a wet impregnation method and characterized by X-ray diffraction (XRD), Transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS) and N₂ physical adsorption. The acidity was measured by FT-IR spectroscopy using pyridine as probes. The catalytic property was tested in acetalization of cyclohexanone with ethylene glycol. The results demonstrated that the IL/Fe-SBA-15 catalysts were of higher catalytic activity compared to Fe-SBA-15. Under optimal conditions, the acetalization could reach to 92.6% cyclohexanone conversion with 99.3% acetal selectivity. After 5 cycles, the cyclohexanone conversion decreased slightly. Also, the catalyst showed good catalytic property in the other acetalization of cyclohexanone and benzyl alcohol.

Full text of DOI:10.1166/jnn.2019.16370

Liu et al. BMC Evolutionary Biology
(2019) 19:78
https://doi.org/10.1186/s12862-019-1407-2
RESEARCH ARTICLE
Open Access
Dictyostelium purpureum var. pseudosessile,
a new variant of dictyostelid from tropical
China
Pu Liu1†, Yue Zou1†, Jiangan Hou1, Steven L. Stephenson2 and Yu Li1*
Abstract
Background: Dictyostelid cellular slime molds (dictyostelids) are microscopic throughout their entire life cycle. The
vegetative phase consists of single-celled amoeboid forms which live in the soil/leaf litter microhabitat of fields and
forests along with animal dung, where they feed upon bacteria and other microbes, grow, and multiply until the
available food supply is exhausted. When this happens, the amoeboid forms aggregate together in large numbers
to form multi-celled pseudoplasmodia, which then give rise to fruiting bodies (sorocarps) that consist of supportive
stalks and unwalled sori containing propagative spores.
Results: Dictyostelium purpureum var. pseudosessile, a new variant of dictyostelid, is described herein, based on
morphological features and molecular data. This new variant was isolated from soil samples collected in two
tropical areas of China. The complete spore-to-spore life cycle of this species, which required 50 h, including spore
germination, myxamoebae, cell aggregation, pseudoplasmodium, and sorocarp formation, was documented.
Descriptions and illustrations are provided for this species based on our collections. Data from ontogeny,
morphology and phylogeny analyses (SSU) of D. purpureum var. pseudosessile confirm that it is a Group 4 species
according to the newly proposed classification of dictyostelids.
Conclusions: Our results suggest that the violet sori, widens at the midpoint of sorophore and simple recurved
sorophore bases represent the prominent features for the new variant D. purpureum var. pseudosessile. The latter is a
Group 4 species now known from two tropical areas of China where dictyostelids remains understudied.
Keywords: Dictyostelids, Taxonomy, Ontogeny, Phylogeny
Background
and resemble animal cells in organization, except for the
Dictyostelid cellular slime molds are key inhabitants of presence of a contractile vacuole [6].
the soil and leaf litter layer of fields and forests, along
Since the first dictyostelid was described by Brefeld
with animal dung, where they feed mostly on bacteria [7], more than 100 species have been reported and clas-
[1–3]. Protists such as dictyostelids are important agents sified into one class, one order, two families and four
in bringing about quantitative changes to the bacterial genera [8]. These species are distinguished morphologic-
microflora of soils and apparently play a role in main- ally largely on the basis of differences in sorophore com-
taining the balance that exists between bacteria and position and branching pattern. However, a phylogenetic
other microbes in the soil [4, 5]. Dictyostelids are mem- analysis based on 18S ribosomal RNA (18S rRNA) and
bers of Amoebozoa, a branch of eukaryotes separate α-tubulin indicated that the traditional morphological
from plants, fungi and animals. Their cells lack cell walls based classification traditionally used for these organ-
isms did not hold up. The genera that had always been
used for dictyostelids were not found to be monophy-
* Correspondence: fungi966@126.com
†Pu Liu and Yue Zou contributed equally to this work.
1Engineering Research Center of Chinese Ministry of Education for Edible
and Medicinal Fungi, Jilin Agricultural University, Changchun 130118,
People’s Republic of China
letic, and the various species were separated first into
four groups [9] and then into eight groups [10], respect-
ively. Furthermore, a new classification, based on unique
18S rRNA sequence signatures, was proposed, and this
Full list of author information is available at the end of the article
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 2 of 9
provided an additional new insight into the taxonomy of studies of the nuclear SSU rDNA showed that the new
the dictyostelids. As a result of this new classification, variant is a member of Group 4 (Fig. 1), based on the
two families, nine genera and 92 new combinations were concepts of Schaap et al. [9], Romeralo et al. [10], and
recognized at the level of species and variety [11].
Sheikh et al. [11].
The Hainan Province and Xishuangbanna region of
Yunnan Province are both located south of Tropic of Description of the new variant
Cancer and are characterized by a tropical monsoon cli- Dictyostelium purpureum var. pseudosessile Li Y., P.
mate. However, studies of dictyostelids in this region are Liu, Y. Zou, S.L. Stephenson et J. Hou, sp. nov. (Fig. 2).
exceedingly limited and consist of only a single previous
report of two species of dictyostelids from the Hainan
MycoBank: MB825215.
Province [12]. To fill in this gap, focus of the present Holotype
study was directed towards the morphology, ontogeny, China. Hainan Province, Qixianling Hot Springs Na-
and phylogeny of a new variant of dictyostelids recov- tional Forestry Park (109°41′E and 18°42′N), located at
ered from soil samples collected at these two sites.
an elevation of approximately 350 m, from a soil sample
collected within a broadleaf rainforest, 13 January 2015,
HMJAU MR279 (4446).
Results
After being processed, two isolates representing one new
tropical variant of dictyostelids were yielded, with one
Diagnosis
isolate obtained from the Xishuangbanna Tropical Bo- Sorocarps with several sessile droplets of water on one
tanical Garden and a second isolate from the Qixianling sorophore, gregarious, erect or semi-erect, unbranched,
Hot Springs National Forestry Park. It required 50 h for 4.3–7.3 mm high. Sorophore sinuous, white or violet,
this species to complete its life cycle. Phylogenetic prostrate on the agar, widens at the midpoint of the
Fig. 1 Phylogenetic tree of dictyostelids based on SSU rRNA and portions of the SSU rRNA gene alignment, showing the molecular signatures of
Dictyostelium purpureum var. pseudosessile

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 3 of 9
Fig. 2 Morphological features of Dictyostelium purpureum var. pseudosessile. a–e Sorocarps. f,g Sorophore tip. h–j Mid-point of the sorophore. k,l
Sorophore base. m Spores. Scale bars: a: 200 μm, b,e: 1 mm, c: 0.5 mm, d: 0.5 mm; f–l: 20 μm, m: 10 μm
whole sorophore, bases recurve, tips capitate. Sori violet, on the agar. The erect or semi-erect portion of the soro-
globose. Spores oblong to elliptical, without obvious polar phore widens (Fig. 2–h–j) at the base and general con-
granules, 5.0–10 × 2.5–5 μm. Aggregation streamed.
sists of several tiers of cells, but the base (Fig. 2–k, l) of
the prostrate portion of the sorophore recurves and usu-
ally consists of one or two tiers of cells (10–37.5 μm
Etymology
From the Latin pseudosessile, referring to the several ses- diam, average 18.5 μm). Tips (Fig. 2–f, g) capitate and
sile droplets of water occurring on one sorophore.
consisting of one or two tiers of cells (5–10 μm diam,
average 7.5 μm). Sori violet, globose to lemon-type,
commonly 135–325 μm diam (average 236 μm). Spores
Description
When cultured at 23 C on non-nutrient agar with E. coli, (Fig. 2–m) oblong to elliptical, 5.0–10 × 2.5–5 μm, with-
sorocarps (Fig. 2–a–e) generally gregarious, erect or out obvious polar granules. Aggregations (0.7–4 mm)
semi-erect, unbranched, commonly 4.3–7.3 mm high generally with asymmetrical streams. Early sorogens fu-
(average 5.7 mm) with a variable number of sessile drop- siform to coniform, migrate with stalk formation.
lets of water occuring on one sorophore. Sorophore
sinuous, white or violet, nearly half of the lower portion
Other specimens examined
of the sorophore prostrate on the surface of the agar, the China. Yunnan Province, Chinese Academy of Sciences,
other upper portion of the sorophore erect or semi-erect Xishuangbanna Tropical Botanical Garden (101°25′ E

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 4 of 9
and 21°41′ N), located at an elevation of approximately point with a prominent stream of cells (Fig. 3–c). After
570 m, from a soil sample collected from beneath Hyd- the aggregating of more and more myxamoebae, all
nocarpus annamensis (Gagnep.) M. Lescot et Sleum, 20 myxamoebae aggregate at one central point, the promin-
January 2015, HMJAU MR273 (4637).
ent central point rises up and with fewer streams 35.5 h
after the spores have been inoculated on agar (Fig. 3–d).
One and a half hours later, the central cell aggregations
Life cycle of D. purpureum var. pseudosessile
Spores become larger when germination occurs; the lat- rise up and begin to form pseudoplasmodia with indis-
ter begins with the appearance of a minute pore dis- tinct sorophores (Fig. 3–e). Two and a half hours later,
solved in the spore wall, and several myxamoebae are the sorophores begin to form (Fig. 3–f). Sorophores
released from different spores in concert (Fig. 3–a). grow longer (Fig. 3–g, h), which gives them the appear-
Myxamoebae are colorless, transparent, and irregular. A ance of a fruiting sorophore (Fig. 3–i) at 42 h, pseudo-
mass of myxamoebae aggregates to form a young aggre- plasmodia form and undergo a very short period of
gation center 32.5 h after the spores have been inocu- movement. The sorophore is slightly curved, half of
lated on agar (Fig. 3–b). Two hours later, the central which is prostrate on the surface of the agar. After the
portion of the aggregation begins to form a small central formation of the sorophore, the sori begin to grow
Fig. 3 Life cycle of Dictyostelium purpureum var. pseudosessile. a Myxamoebae. b–d Aggregations. e–i Formation of pseudoplasmodia. j–k Young
sorocarp. l–p Fruiting of sorocarp. Scale bars: a: 20 μm, b–e,k,l,p: 1 mm, f–j,m–o: 500 μm

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 5 of 9
gradually (Fig. 3–j, k) to form globose sori at 47 h (Fig. other species new to science or already described species
3–l), the color changes from white (Fig. 3–j), pale yellow which are not yet known to occur in China.
(Fig. 3–k), pale violet (Fig. 3–l), to violet (Fig. 3–m).
Forty-eight h after inoculating the spores on the agar, Conclusions
colorless sessile droplets of water begin to form on the Reported herein are two isolates, each from a different
sorophore, these are oblong (Fig. 3–n) at first but grad- area of tropical China, which represented a new variant
ually change from oblong to globose (Fig. 3–o), and the of Dictyostelium purpureum. Our discovery of this new
sorocarps finally fruit at 50 h (Fig. 3–p). Sorocarps are variant (D. purpureum var. pseudosessile) from tropical
solitary, erect or semi-erect and lack of branches.
areas of China expands the biogeographical range of dic-
tyostelids. Molecular phylogenetic analyses of the two
isolates revealed that they do not belong to any previ-
ously described species. We propose that the two new
Discussion
Morphologically, Dictyostelium purpureum var. pseudo- isolates belong to the same species, which is character-
sessile is a variant of D. purpureum Olive characterized ized by violet sori, widens at the midpoint of sorophore
particularly by its colorless sessile droplets of water and simple recurved sorophore bases. This new variant
(Fig. 4) borne at intervals along the upright sorophores required 50 h to complete its entire life cycle, incuding
and simple recurved sorophore bases. Although D. pur- spore germination, aggregation formation, pseudoplas-
pureum var. pseudosessile forms a clade with D. purpur- modium formation, and sorocarp formation.
eum (Fig. 1), D. purpureum [5, 11] has sorophores with
basal disks, whereas the new variant somewhat widens Methods
at the midpoint of sorophore but no basal disks. In order Study site ecology
to discriminate D. purpureum var. pseudosessile with D. Soil Samples used for the isolation of dictyostelids
purpureum deeply, we mixed these strains on one agar were collected in two tropical areas of China in Janu-
plate according to the method of Sathe et al. [13], we ary 2015. These were the Xishuangbanna Tropical Bo-
found the aggregations and pesudoplasmodia have dif- tanical Garden of the Chinese Academy of Sciences
ferent tips, then finally form both sorocarps of D. pur- located in Yunnan Province and Qixianling Hot
pureum var. pseudosessile and D. purpureum on one Springs National Forestry Park located in Hainan
plate (Additional file 1: Fig. S1). The SSU sequences of Province. The Xishuangbanna Tropical Botanical Gar-
D. purpureum var. pseudosessile and D. purpureum have den is situated in the southwestern portion of China,
97% identity (Additional file 1: Fig. S2). From the obser- whereas the Qixianling Hot Springs National Forestry
vations of the life cycle of D. purpureum, no sessile Park occurs in the southernmost portion of China.
droplets of water on the sorophore were found during Both of these two localities are located south of the
this process (Additional file 1: Fig. S3). Therefore, D. Tropic of Cancer and are characterized by a tropical
purpureum var. pseudosessile is different with D. purpur- monsoon climate, with an annual temperatures of
eum in both morphology and phylogeny.
21.4 C and 23.0 C, respectively.
Dictyostelium purpureum var. pseudosessile is rare but
is known to occur in two regions of tropical China. The Sampling
morphological and molecular features of D. purpureum Samples, each consisting of approximately 30–50 g of
var. pseudosessile are considerably different compared to material, were collected and placed in sterile
D. purpureum mentioned above, with the most promin- whirl-pack plastic bags. In most instances, at least five
ent features of the new variant being the prostrate soro- samples were collected from each vegetation type at
phore, widens at the midpoint of sorophore and simple each locality. Afterwards, these samples were returned
recurved sorophore bases. The entire life cycle of D. to the laboratory as soon as possible, following the
purpureum var. pseudosessile extends over 3 d (50 h). recommendations of Cavender and Raper [3]. Each
The spores germinated and released myxamoebae, and sample bag was numbered and the sample itself pre-
aggregations formed 32.5 h after inoculation. Pseudo- served at 4 C in the herbarium of the Mycological In-
plasmodium formation required 42 h. Following this, the stitute of Jilin Agricultural University (HMJAU),
sorophores and sori begin to grow in an orderly manner Changchun, China.
and finally formed fruiting sorocarps after 50 h.
The most important contribution of this paper is that Isolation and cultivation
it extends our knowledge of the distribution and ecology The isolation methods used followed those described
of dictyostelids in a region of the world where these or- by Cavender and Raper [3]. Each sample was weighed
ganisms remain understudied. It seems likely that add- and diluted for an initial dilution of 1:10 by adding
itional sampling in tropical areas of China will yield ddH2O. This solution was shaken to disperse the

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 6 of 9
Fig. 4 Dictyostelium purpureum var. pseudosessile. a–g Fruiting process of sorocarps, each from them were photographed in one hour. h, i Other
sorocarps. Scale bars: a–g: 500 μm, h, i: 1 mm
material and to suspend the amoebae and spores of these plates were frozen in HL 5 media [14] and
dictyostelids present. Afterwards, a 0.5 mL aliquot of stored at − 80 C in HMJAU.
the solution was added to each of five duplicate cul-
ture plates prepared with hay infusion agar [5]. Ap-
proximately 0.4 mL of a heavy suspension of the
bacterium Escherichia coli was added to each culture
plate as a food source. The plates were incubated at a
temperature of 23 C, with a 12 h light and dark cycle.
Each plate was examined at least once a day for two
weeks after the appearance of initial aggregations.
Each isolate was purified and cultivated for taxonomic
studies and preservation on non-nutrient water agar
plates with E. coli pregrown for 12–24 h. Spores from
Morphological features and life cycle observations
Dictyostelid isolates were identified with the use of the
descriptions provided by Raper [5], whose nomenclature
also was followed except for those species recently
assigned to new genera in the system of classification
proposed by Sheikh et al. [11]. In the primary isolation
plates, the location of each early aggregating clone and
developing sorocarp was marked. The characteristic
stages in the life cycle, including cell aggregation and the
formation of pseudoplasmodia and ultimately sorocarps,

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 7 of 9
were observed under a Zeiss dissecting microscope objectives. Photographs were taken with a Zeiss Axio-
(Axio Zoom V16) with a 1.5× objective and a 10× ocu- cam 506 color microscope camera.
lar. Slides of sorocarps were prepared with water as the
Observation of spore germination. Hanging drop cul-
mounting medium. Characteristics of spores, soro- tures, as described by Keller and Schoknecht [15], were
phores, and sorocarps were observed and measured on prepared for observation of spore germination. Spores
the slides by using a Zeiss light microscope (Axio Imager obtained from a sorus were mixed with a droplet of ster-
A2), with a 10× ocular and 10, 40, and 100× (oil) ile water on the undersurface of a 22-mm square cover
Table 1 Species of dictyostelids included in the present study. Information is provided on the samples considered and the GenBank
accession number for SSU sequences
Species
Voucher specimen
HN1B1
FG12
GenBank accession number (SSU)
HQ141511.1
AM168111.1
AM168113.1
AM168110.1
AM168093.1
AM168087.1
HQ141522.1
AM168056.1
HQ141488.1
AM168031.1
AM168037.1
AM168060.1
MH280023a
Acytostelium amazonicum Cavender & Vadell
A. leptosomum Raper
A. serpentarium Cavender et al.
SAB3A
LB1
A. subglobosum Cavender
Cavenderia delicata (H. Hagiw.) S. Baldauf, S. Sheikh & Thulin
C. fasciculata (F. Traub et al.) S. Baldauf, S. Sheikh & Thulin
C. myxobasis (Cavender et al.) S. Baldauf, S. Sheikh & Thulin
Coremiostelium polycephalum (Raper) S. Baldauf, S. Sheikh, Thulin & Spiegel
C. polycephalum
TNS-C-226
SH3
NT2A
MY1–1
Landolt #1130 SS3B
WS700
93HO-33
C143
Dictyostelium brunneum Kawabe
D. crassicaule H.Hagiw.
D. purpureum Olive
D. purpureum var. pseudosessile Li Y, P Liu, Y Zou SL Stephenson et JG Hou
D. purpureum var. pseudosessile
4446
4637
MH280022a
D. pseudobrefeldianum H.Hagiw.
91HO-8
TNS-C-219
M45
AM168059.1
AM168064.1
AM168065.1
AM168067.1
AM168036.1
HQ141494.1
AM168062.1
AM168096.1
HQ141505.1
AM168100.1
HQ141497.1
AM168046.1
HQ141486.1
AM168078.1
AM168052.1
AM168069.1
AM168094.1
AM168112.1
AM168057.1
AM168058.1
AM168045.1
AM168073.1
D. robustum H.Hagiw.
D. rosarium Raper & Cavender
D. septentrionale Cavender
AK2
Hagiwaraea coeruleostipes (Raper & Fennell) S. Baldauf, S. Sheikh & Thulin
H. radiculata (Cavender et al.) S. Baldauf, S. Sheikh & Thulin
H. vinaceofusca (Raper & Fennell) S. Baldauf, S. Sheikh & Thulin
Heterostelium anisocaule (Cavender et al.) S. Baldauf, S. Sheikh & Thulin
H. colligatum (Vadell & Cavender) S. Baldauf, S. Sheikh & Thulin
H. filamentosum (F.Traub et al.) S. Baldauf, S.Sheikh & Thulin
H. oculare (Cavender et al.) S. Baldauf, S. Sheikh & Thulin
Polysphondylium laterosorum (Cavender) S. Baldauf, S. Sheikh & Thulin
P. violaceum Bref.
CRLC53B
ML5A
CC4
NZ47B
HN13C1
SU-1
–
AE4
209
Raperostelium gracile (H.Hagiw.) S. Baldauf, S. Sheikh & Thulin
R. monochasioides (H.Hagiw.) S. Baldauf, S. Sheikh & Thulin
R. potamoides (Cavender et al.) S. Baldauf, S. Sheikh & Thulin
R. tenue (Cavender et al.) S. Baldauf, S. Sheikh & Thulin
Rostrostelium ellipticum (Cavender) S. Baldauf, S. Sheikh & Thulin
Synstelium polycarpum (F.Traub et al.) S. Baldauf, S. Sheikh & Thulin
S. polycarpum
TNS-C-183
HAG653
FP1A
PJ6
AE2
VE1b
OhioWILDS
–
Tieghemostelium lacteum (Tiegh.) S. Baldauf, S. Sheikh & Thulin
T. menorah (Vadell & Cavender) S. Baldauf, S. Sheikh & Thulin
asamples and sequences obtained in the present study
M1

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 8 of 9
glass. The cover glass was then inverted over a depres- Additional file
sion slide. Vaseline was used to ring the edges of the
Additional file 1: Fig. S1. Mixed culture of Dictyostelium purpureum var.
pseudosessile with D. purpureum. A–C Aggregations. D Pseudoplasmodia.
F Sorocarps. Scale bars: A,B,D: 1 mm, C: 500 μm, E: 2 mm. Fig. S2. Blast of
SSU sequences of Dictyostelium purpureum var. pseudosessile with D.
purpureum which have 97% identity. Fig. S3. Life cycle of Dictyostelium
purpureum. The time of each stage showed on the top right corner. A–D
Aggregations. E,F Pseudoplasmodia. G–L Sorocarps. Scale bars: A–H: 2
mm, I–L: 1 mm. (DOCX 344 kb)
cover glass. Spores were freely suspended in the water
droplet. Characteristics of the myxamoebae were ob-
served and photographed with a Zeiss light microscope
(Axio Imager A2), using the 10× ocular and 10, 40, and
100× (oil) objectives.
Nomenclature
Acknowledgements
According to the International Code of Nomenclature
used for algae, fungi, and plants, the electronic version
of this article in Portable Document Format (PDF) will
represent a published work. In addition, new names con-
tained in this study have been submitted to MycoBank
and each will be allocated a unique MycoBank number
which will be accessible through MycoBank, Index Fun-
gorum, GBIF and other international biodiversity initia-
tives, where they will be made available to the Global
Names Index.
We wish to express our appreciation to the editor and the reviewers for their
comments and valuable reviews of this manuscript.
Funding
This research was supported by the National Natural Science Foundation of
China (No. 31870015, 31300016), the Science and Technology Development
Program of Jilin Province (No. 20180101273JC), the Program of Creation and
Utilization of Germplasm of Mushroom Crop of the “111” Project (No.
D17014), and the Science and Technology Research Programs of the
Education Department of Jilin Province in the Thirteenth Five–Year Plan (No.
JJKH20180671KJ).
Availability of data and materials
Sequence data are available in GenBank. The nomenclature of the new
variant in the present study is available in MycoBank.
DNA isolation, PCR amplification and sequencing
Authors’ contributions
After amoebae had cleared E. coli on the water agar
media, the spores of the particular dictyostelid isolate
being studied were collected with a sterile tip, mixed
with the lysed buffer of the MiniBEST Universal Gen-
omic DNA Extraction Kit Ver.5.0 (Takara, Japan) follow-
ing the manufacturer’s protocol. The genomic DNA was
used directly for the 18S PCR amplification using the
primers 18SF-A (AACCTGGTTGATCCTGCCAG) and
18SR-B (TGATCCTTCTGCAGGTTCAC) [16] along
with D542F (ACAATTGGAGGGCAAGTCTG3) and
D1340R (TCGAGGTCTCGTCCGTTATC) [9]. PCR
YZ, PL and JH carried out the research, PL wrote the manuscript, YL
designed the research, SLS revised the manuscript. All authors read and
approved the final version of the manuscript.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
products were sent to Sangon Biotech Co., Ltd. (Shang- Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
hai, China) for sequencing. Sequences obtained were de-
posited at GenBank database. The isolates and the NCBI
GenBank accession numbers of SSU DNA sequences
used in present study are listed in Table 1.
Author details
1Engineering Research Center of Chinese Ministry of Education for Edible
and Medicinal Fungi, Jilin Agricultural University, Changchun 130118,
People’s Republic of China. 2Department of Biological Sciences, University of
Arkansas, Fayetteville, AR 72701, USA.
Phylogenetic analysis
Received: 9 May 2018 Accepted: 4 March 2019
The newly-generated sequences were checked and
then submitted to GenBank. The ITS and SSU se-
quences were aligned and compared separately using
the program MUSCLE v.3.6 [17, 18] and then manu-
ally adjusted in MEGA 7.0 [19]. Maximum likelihood
(ML) analyses were performed using RAxML v7 [20].
In the ML analyses, the best-fit substitution models
were estimated using GTR submission model and a
gamma correction for rate variation among sites
(GTRGAMMA), using the CIPRES server. The statis-
tical support of clades was assessed with 1000
rapid-bootstrap (BS) replications.
References
1. Singh BN. Studies on soil Acrasieae. 1. Distribution of species of
Dictyostelium in soils of Great Britain and the effects of bacteria on their
development. J. Gen. Microbiol. 1947. https://doi.org/10.1099/00221287-1-1-
11.
2. Cavender JC, Raper KB. The Acrasieae in nature. I. Isolation. Am J Bot. 1965.
https://doi.org/10.2307/2439943.
3. Cavender JC, Raper KB. The Acrasieae in nature. II. Forest soil as a primary
habitat. Am J Bot. 1965b. https://doi.org/10.2307/2439944.
4. Raper KB. Acrasiomycetes. In: Ainsworth GC, Sparrow FK, Sussman AS,
editors. The Fungi. United States: Academic Press; 1973. p. 9–36.
5. Raper KB. The Dictyostelids. New Jersey: Princeton University Press,
Princeton; 1984. p. 1–453

Liu et al. BMC Evolutionary Biology
(2019) 19:78
Page 9 of 9
6. Fets L, Kay R, Velazquez F. Dictyostelium Current Biology. 2010. https://doi.
org/10.1016/j.cub.2010.09.051.
7. Brefeld O. Dictyostelium mucoroides. Ein neuer Organismus aus der
Verwandschaft der Myxomyceten. Abh Seckenburg Naturforsch Ges. 1869;7:
85–107.
8. Kirk PM, Cannon PF, Minter DW, Stalpers JA. Dictionary of the fungi. 10th
ed: CABI; 2008. p. 1–640.
9. Schaap P, Winckler T, Nelson M, Alvarez-Curto E, Elgie B, Hagiwara H,
Cavender JC, Milano-Curto A, Rozen DE, Dingermann T, Mutzel R, Baldauf
SL. Molecular phylogeny and evolution of morphology in the social
amoebas. Science. 2006. https://doi.org/10.1126/science.1130670.
10. Romeralo M, Cavender JC, Landolt JC, Stephenson SL, Baldauf SL. An
expanded phylogeny of social amoebas (Dictyostelia) shows increasing
diversity and new morphological patterns. BMC Evol Biol. 2011. https://doi.
org/10.1186/1471-2148-11-84.
11. Sheikh S, Thulin M, Cavender JC, Hernández RE, Kawakami SI, Lado C,
Landolt JC, Nanjundiah V, Queller D, Shaap P, Strassmann J, Spiegel F,
Stephenson SL, Vadell EM, Baldauf SL. A new classification of the
dictyostelids. Protist. 2018. https://doi.org/10.1016/j.protis.2017.11.001.
12. Liu P, Li Y. New records of dictyostelids from China. Nova Hedwigia. 2012.
https://doi.org/10.1127/0029-5035/2012/0010.
13. Sathe S, Khetan N, Nanjundiah V. Interspecies and intraspecies interactions
in social amoebae. J Evol Biol. 2014. https://doi.org/10.1111/jeb.12298.
14. Cocucci SM, Sussman M. RNA in cytoplasmic and nuclear fractions of
cellular slime mold amebas. J Cell Biol. 1970. https://doi.org/10.1083/jcb.45.2.
399.
15. Keller HW, Schoknecht JD. Life cycle of a new annulate-spored species of
Didymium. Mycologia. 1989. https://doi.org/10.2307/3759707.
16. Medlin L, Elwood HJ, Stickel S, Sogin M. The characterization of
enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene.
1988. https://doi.org/10.1016/0378-1119(88)90066-2.
17. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and
high throughput. Nucleic Acids Res. 2004. https://doi.org/10.1093/nar/
gkh340.
18. Edgar RC. MUSCLE: a multiple sequence alignment method with reduced
time and space complexity. BMC Bioinformatics. 2004. https://doi.org/10.
1186/1471-2105-5-113.
19. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics
Analysis Version 7.0 for Bigger Datasets. Molecular Biology & Evolution.
2016; https://doi.org/10.1093/molbev/msw054.
20. Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics. 2006.
https://doi.org/10.1093/bioinformatics/btl446.