Scaffold hopping: Exploration of acetanilide-containing uracil analogues as potential NNRTIs

Article abstract of DOI:10.1016/j.bmc.2015.01.002

In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives 15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular modeling of the most active compounds 15c and 15i was employed to provide insight on their inhibitory properties and direct future design efforts.

Full text of DOI:10.1016/j.bmc.2015.01.002

Accepted Manuscript
Scaffold hopping: exploration of acetanilide-containing uracil analogues as po-
tential NNRTIs
Denis A. Babkov, Vladimir T. Valuev-Elliston, Maria P. Paramonova,
Alexander A. Ozerov, Alexander V. Ivanov, Alexander O. Chizhov, Anastasia
L. Khandazhinskaya, Sergey N. Kochetkov, Jan Balzarini, Dirk Daelemans,
Christophe Pannecouque, Katherine L. Seley-Radtke, Mikhail S. Novikov
PII:
S0968-0896(15)00005-X
http://dx.doi.org/10.1016/j.bmc.2015.01.002
BMC 12005
DOI:
Reference:
Bioorganic & Medicinal Chemistry
To appear in:
Received Date:
Revised Date:
Accepted Date:
11 November 2014
26 December 2014
4 January 2015
Please cite this article as: Babkov, D.A., Valuev-Elliston, V.T., Paramonova, M.P., Ozerov, A.A., Ivanov, A.V.,
Chizhov, A.O., Khandazhinskaya, A.L., Kochetkov, S.N., Balzarini, J., Daelemans, D., Pannecouque, C., Seley-
Radtke, K.L., Novikov, M.S., Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential
NNRTIs, Bioorganic & Medicinal Chemistry (2015), doi: http://dx.doi.org/10.1016/j.bmc.2015.01.002
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Graphical Abstract
To create your abstract, type over the instructions in the template box below.
Fonts or abstract dimensions should not be changed or altered.
Scaffold hopping: exploration of acetanilide-
containing uracil analogues as potential
NNRTIs
Leave this area blank for abstract info.
Denis A. Babkova, Vladimir T. Valuev-Ellistonb, Maria P. Paramonovaa, Alexander A. Ozerova, Alexander V.
Ivanovb, Alexander O. Chizhovc, Anastasia L. Khandazhinskayab, Sergey N. Kochetkovb, Jan Balzarinid, Dirk
Daelemansd, Christophe Pannecouqued, Katherine L. Seley-Radtkee*, Mikhail S. Novikova
aDepartment of Pharmaceutical & Toxicological Chemistry, Volgograd State Medical University, Pavshikh
Bortsov Sq., 1, Volgograd 400131, Russia;
bEngelhardt Institute of Molecular Biology, Russian Academy of Science, Vavilov Str., 32, Moscow 119991,
Russia;
cZelinsky Institute of Organic Chemistry, Russian Academy of Science, Leninsky pr., 47, Moscow 119991,
Russia;
dRega Institute for Medical Research, KU Leuven, Minderbroedersstraat 10, Leuven B-3000, Belgium;
eDepartment of Chemistry & Biochemistry, University of Maryland, Baltimore County, 1000 Hilltop Circle,
Baltimore, MD 21250, USA

Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com
Scaffold hopping: exploration of acetanilide-containing uracil analogues as potential
NNRTIs
Denis A. Babkova, Vladimir T. Valuev-Ellistonb, Maria P. Paramonovaa, Alexander A. Ozerova, Alexander
V. Ivanovb, Alexander O. Chizhovc, Anastasia L. Khandazhinskayab, Sergey N. Kochetkovb, Jan Balzarinid,
Dirk Daelemansd, Christophe Pannecouqued, Katherine L. Seley-Radtkee*, Mikhail S. Novikova
aDepartment of Pharmaceutical & Toxicological Chemistry, Volgograd State Medical University, Pavshikh Bortsov Sq., 1, Volgograd 400131, Russia;
bEngelhardt Institute of Molecular Biology, Russian Academy of Science, Vavilov Str., 32, Moscow 119991, Russia;
cZelinsky Institute of Organic Chemistry, Russian Academy of Science, Leninsky pr., 47, Moscow 119991, Russia;
dRega Institute for Medical Research, KU Leuven, Minderbroedersstraat 10, Leuven B-3000, Belgium;
eDepartment of Chemistry & Biochemistry, University of Maryland, Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250, USA
ARTICLE INFO
ABSTRACT
Article history:
Received
Received in revised form
Accepted
In order to identify novel nonnucleoside inhibitors of HIV-1 reverse transcriptase two series of
amide-containing uracil derivatives were designed as hybrids of two scaffolds of previously
reported inhibitors. Subsequent biological evaluation confirmed acetamide uracil derivatives
15a-k as selective micromolar NNRTIs with a first generation-like resistance profile. Molecular
modeling of the most active compounds 15c and 15i was employed to provide insight on their
inhibitory properties and direct future design efforts.
Available online
Keywords:
Nonnucleoside reverse transcriptase
2009 Elsevier Ltd. All rights reserved.
inhibitors
NNRTIs
HIV
Uracil
Amide
1. Introduction
properties against HIV-1 reverse transcriptase (RT) and blocked
HIV replication in cell culture. Additionally, a series of 1-(2-
Human immunodeficiency virus (HIV) was identified as the
causative agent of acquired immunodeficiency syndrome (AIDS)
more than 3 decades ago. Since that time numerous successes in
the development of various anti-HIV drugs have been achieved,
in part due to the growing availability of new classes of
inhibitors.1 Despite new enzymatic targets, non-nucleoside
reverse transcriptase inhibitors (NNRTI) remain a key element of
highly active antiretroviral therapy (HAART) regimes. Five
NNRTIs are currently used in the clinic, however, their use
remains somewhat limited due to long-term toxicity2,3 and drug
resistance.4 The latter issue has become even more problematic
since drug-resistant HIV strains are arising more frequently even
in treatment-naïve patients.5,6 As a result, there remains a strong
need for novel NNRTIs with acceptable levels of toxicity and
advanced drug-resistance profiles.
phenoxyethyl)-3-benzyl- (2) and 1-cinnamyl-3-benzyluracil
derivatives8 also showed remarkable antiretroviral activity. The
main drawback of these compounds was the loss of activity
against HIV RTs bearing K103N, V106A or Y181C mutations,
which confer resistance for various NNRTIs.9
In that regard, it was hypothesized that introduction of an
amide moiety might improve binding of the inhibitors to the
mutant RTs due to the formation of additional polar interactions.
Consequently, two novel series of acetamide-containing uracil
derivatives (Fig. 1) were designed in an effort to explore their
anti-HIV activity, particularly against mutant strains. Moreover,
their scaffolds can be regarded as the result of molecular
hybridization between two second generation NNRTIs – the
benzophenone derivatives10 (3) and the biaryl ethers11 (4) – which
have been characterized to possess a high barrier to the
emergence of drug resistance.
In previous papers we have described our efforts to design and
synthesize several series of uracil-based NNRTIs that exhibited
potent
anti-HIV
activity.
In
particular,
1-[2-(2-
benzoylphenoxy)ethyl]uracils7 (1) exhibited strong inhibitory

Figure 1. Design of novel inhibitor series by isosteric replacement of unoptimized fragments (red) with known NNRTIs pharmacophores (green and blue).
These newly designed compounds also share a feature
commonly found in most of the potent NNRTIs – three aromatic
ring systems connected by short linkers.12 The acetamide group
represents a logical replacement to the oxyethyl linker used in
our previous inhibitor series. Specifically, introduction of the
amide functionality should establish a critical H-bond with the
RT backbone at the entrance of the binding pocket and thus
prevent the loss of activity specifically caused by the K103N RT
mutation (Fig. 2).10,13
previous observations for this reaction involving similarly
reactive alkylating agents were quite efficient.8,17 One
explanation for the lower yields may be the steric hindrance
between the bromoacetate reagent and the o-substituent of 7.
Next, an alkyl substituent was introduced in position 3 of the
pyrimidine ring using standard procedures.18,19 Subsequent
hydrolysis of the ester functionality was accomplished in mild
conditions using LiOH,20 which was then converted to the acid
chloride using standard conditions. Interestingly, we were unable
to obtain the 5-bromouracil derivative, most likely due to its
instability in alkaline conditions.21 It should be noted that
electrophilic bromination22 could not be used for the 11a-c since
it lacks stereoselectivity due to the presence of the two electron-
rich aromatic ring systems. Finally, compounds 12a-k were
synthesized in good yields using the appropriate substituted
anilines and pyridine in dry 1,2-dichloroethane.
Uracil is known to be associated with the bioactive
conformation for several series of NNRTIs. In the case of
benzophenone derivatives7 it represents the ring C, while for 1,3-
dibenzyl,14 phenoxyethyl- and cinnamyl- derivatives8 it serves as
the central core (B) for the overall scaffold. Notably however, to
the best of our knowledge, inhibitors featuring the uracil in
position A (i.e. pointed to the bottom of the binding pocket) have
not been previously described. As a result, this provided strong
impetus for the design and development of compounds that
encompass that arrangement (Fig. 1).
The synthetic route to target compounds 15a-l is shown in
Scheme 2. First, condensation of ethyl bromoacetate with 2,4-
bis(trimethylsilyloxy)pyrimidine
(8a)
afforded
1-
(ethoxycarbonylmethyl)uracil 13.23 Next, N3-benzylation in the
presence of solid K2CO3 in DMF, followed by hydrolysis of the
N3 esters, which was accomplished directly without isolation to
give acids 14a-d. Subsequent conversion to the appropriate acid
chlorides using standard conditions as before, followed by
coupling with the appropriate anilines was done in an analogous
manner as was previously used to realize compounds 12a-k.
2. Results and discussion
2.1. Chemistry
Target compounds 12a-k were synthesized as outlined in
Scheme 1. Bromide 7 was obtained using ortho-cresol and ethyl
bromoacetate as building blocks. Use of the Hilbert-Johnson
reaction15,16 between 2,4-bis(trimethylsilyl)pyrimidines 8a-d and
7 afforded compounds 9a-d, however in unexpectedly moderate
yields (51-67%). This was somewhat surprising since our
Figure 2. Proposed binding mode of the acetanilide analogue in the
Scheme 1. Reagents and conditions: (a) BrCH2CO2Et, K2CO3, Me2CO,
56 °С, 76%; (b) NBS, CCl4, 77 °C, 90%; (c) 7, DCE, 85 °С, 51-67%; (d)
(CH3)2SO4, Me2CO; or alkyl halide, K2CO3, DMF, 22 °С, 91-99%; (e)
LiOH, EtOH/H2O, 22 °C, 89-94%; (f) i. SOCl2, DCE, 85 °С; ii. ArNH2,
Py, -10 °С, 10-86%.
HIV-1 NNRTI binding pocket.

Scheme 2. Reagents and conditions: (a) BrCH2CO2Et, DCE, 85 °С, 92%; (b) i. ArCH2Br, K2CO3, DMF, 80 °С; ii. LiOH, EtOH/H2O, 22 °C, 71-87%; (c) i.
SOCl2, DCE, 85 °С; ii. ArNH2, Py, -10 °С, 32-95%; (d) ArNH2, 20 mol% H3BO3, PhMe, 110 °C, 48-50%.
Notably, the final steps of this approach involved handling
moisture-sensitive intermediates and the use of excess base. To
overcome this issue, we decided to try a more "green" approach
to realize compounds 15e and 15h – direct acid-amine coupling
catalyzed by boric acid.24,25 Disappointingly, while this method
proved to be convenient and more environmentally friendly,
conversion of the starting materials never exceeded 50% despite
all attempts to increase the yields. Since the low yield could also
have been associated with the poor solubility of acids 14 in
toluene, we then employed a 5:1 toluene:DMF solvent system.
Unfortunately this did not lead to a substantial increase of the
yield (data not shown).
K103N/Y181C. This was noteworthy since a similar decrease
was described earlier for the previously reported series of
compounds.7,8 In addition, we observed a moderate decrease in
the inhibitory activity towards RT with L100I, and G190A,
which was not the case for the benzophenones7 or the N1,N3-
substituted uracils.8 The largest difference between 15i and the
previously described N1,N3-substituted uracils was noted for
Y181C RT: 15i was only three-fold less active towards this
mutant RT, whereas the previously described inhibitors suffered
a complete loss of activity against this mutant. Nevertheless, the
resistance profile of 15i suggests that these compounds belong to
the first generation types of NNRTIs.
2.2. Biological activities
Table 1. Antiviral activity of compounds 12a-k against HIV-
2.2.1. HIV-1 RT inhibition assay
1.
The antiretroviral activity of the target compounds was
evaluated in vitro against the recombinant HIV-1 reverse
transcriptase. Unfortunately, compounds 12a-k featuring a
terminal uracil moiety were essentially inactive against wild-type
RT (Table 1).
b
d
a
CC50
Ki
EC50
(μM)
SI
Comp. R1
R2
R3
c
(μM)
(μM)
>100
>100
>100
>100
>100
>100
>100
>100
>100
>100
>100
12a
12b
12c
12d
12e
12f
H
H
H
H
H
H
H
H
Me
Me
Me
Me
Me
Me
H
>152.85 152.859.47
<1
2-Me
2-Cl
3-Cl
4-Cl
2,5-Cl2
>151.82 151.8216.02 <1
>140.94 140.940.18 <1
Uracil‟s C-4-carbonyl can be considered as the most
significant structural difference between these derivatives and the
benzophenone NNRTIs patented by GlaxoSmithKline (3, Fig. 1).
Preliminary docking studies predicted an H-bond between the
carbonyl and the pyrrole NH of the Trp229 side chain (data not
shown). However, in light of the experimental data, it seems
more likely that the oxygen lone pairs are instead, forced to face
the Trp229 π-system. Such an unfavorable interaction is in
contradiction to the typical NNRTIs edge-face stacking with
Trp229 provided by an aromatic proton.26
>287.62 287.6210.60 <1
>100.42 100.4267.38 <1
>29.47
>25.36
>30.64
>14.76
>30.28
>9.37
29.471.63
25.361.50
30.640.82
14.768.34
30.281.53
9.370.37
<1
<1
<1
<1
<1
<1
12g
12h
12i
n-Pr 2-Cl
allyl 2-Cl
Me Me
2-Cl
2-Cl
2-Cl
In contrast, anilides 15a-k showed significant inhibitory
properties, except for 15g which proved completely inactive (IC50
> 300 µM). A close correlation between the HIV-1 RT inhibitory
activity and the antiviral activity in MT-4 cells was also observed
(Figure 3).
12j
12k
F
Me
Me
Cl
a50% effective concentration or compound concentration required to inhibit
HIV-induced cytopathogenic effect by 50% in MT-4 cells.
b50% cytotoxic concentration or compound concentration required to reduce
MT-4 viability by 50%.
Anilide 15i proved to be one of the most active compounds,
thus was also evaluated against a panel of recombinant reverse
transcriptases. These contain one or two mutations, the ones most
often observed in the NNRTI-resistant virus strains. It was
revealed that the inhibitory activity of 15i was much lower
against RTs bearing mutations K103N, V106A, or a combination
cselectivity index or ratio CC50/EC50.
dinhibition constant for inhibition of HIV-1 reverse transcriptase.

Table 2. Antiviral activity of compounds 15a-k against HIV-1.
Comp.
15a
15b
15c
R1
R2
X
EC50a (μM)
9.680.58
7.680.79
1.710.45
14.543.58
29.503.04
7.292.84
35.847.61
>190.84
IC50b (μM)
79.286.42
68.771.59
15.682.85
210.96133.01
114.1517.22
62.909.17
>300
CC50c (μM)
241.7248.43
291.7821.54
28.484.12
227.4145.14
167.0075.50
77.4979.70
275.7443.32
190.8428.38
31.096.54
33.144.26
207.4056.07
>15
SId
25
38
17
16
6
3,5-Me2
3,5-Me2
3,5-Me2
3,5-Me2
3,5-Me2
3,5-Me2
3,5-Me2
3,5-Me2
3,5-Cl2
3-Br-5-Me
-
H
NH
NH
NН
NH
NH
NH
NH
NCH2
NH
NH
-
2-Me
2-MeO
2-Cl
3-Cl
4-Cl
2,3-Me2
H
15d
15e
15f
11
8
15g
15h
15i
193.8733.72
12.671.00
12.080.11
44.545.04
1.150.51
<1
10
17
26
>50
>1000
2-Cl
2-Cl
-
3.262.64
2.010.71
7.941.43
0.310.06
0.0060.001
15j
15k
NVP
EFV
-
-
-
-
-
-
0.0220.009
>6
a50% effective concentration or compound concentration required to inhibit HIV-induced cytopathogenic effect by 50%.
bcompound concentration required to inhibit in vitro HIV-1 RT wt activity by 50%.
c50% cytotoxic concentration or compound concentration required to reduce MT-4 viability by 50%.
dselectivity index or ratio CC50/EC50.
2.2.2. Anti-HIV activities evaluation
anti-HIV activity, nor the cytotoxicity of the compound as
compared to 15a. The series of analogues 15d, 15e and 15f
revealed the effect resulting from shifting the chlorine on the
aniline ring from ortho to meta or para position – the para-Cl was
better than the ortho-Cl which was better than the meta-Cl.
Introduction of a second methyl group on molecule 15b, resulting
in 15g, also indicates a possible negative effect of meta-
substitution on the antiviral activity.
To further confirm the anti-HIV potency of the newly
synthesized compounds we also determined their ability to inhibit
the HIV-1 IIIB strain-induced cytopathicity in MT-4 cell cultures.
The cytotoxicity of these compounds was determined in parallel.
Comparisons of the antiviral inhibitory concentration EC50,
cytotoxic concentration CC50, and SI (selectivity, given by the
CC50/EC50 ratio) values are depicted in Tables 1 and 2.
When replacing all three methyl groups in 15b by chlorine
(15i), no pronounced differences in anti-HIV activity arose but
the cytotoxicity increased. Replacing one meta-Me on the benzyl
group in 15d by a bromine, which has almost the same sterics
and size, leads to a more active molecule (15j) with an EC50 in
MT-4 cells close to that of the most active molecule of the series,
compound 15c.
No activity was observed for series 12 in cell cultures, while
compounds 15a-k revealed rather interesting trends. Compounds
15a-k were further evaluated for their antiretroviral activity
against the WT strain IIIB and the NNRTI-resistant double RT
mutant K103N;Y181C in MT-4 cells. The compounds behaved
as typical first generation NNRTI, with a total loss of activity
against the RT double mutant. Overall there was a close
correlation between the anti-HIV-1 activity in MT-4 cells and the
inhibitory activity of the compounds in the RT polymerase assay.
This was shown by way of a linear regression plot with results
for compounds 15a-k (except for 15g and 15h due to lack of
activity in the enzymatic assay and MT-4/MTT assay,
respectively), and the reference compounds nevirapine and
efavirenz, in both assays (Fig. 3). The correlation coefficient (r)
was 0.99.
Table 3. Activity of 15i against mutant forms of HIV-1 RT.
PDB
HIV-1 RT
Ki (μM)
Fold decrease
3DLG
3DOL
3DOK
3DMJ
1JLA
-
WT
4.5
-
L100I
15.9
63.3
67.6
15.4
20
4
K103N
V106A
Y181C
G190A
K103N+Y181C
14
15
3
The parent structure 15a shows moderate activity at the lower
µM-range. Introducing an electron donating methoxy group at
the ortho position of the aniline ring, as in compound 15c, was
the most beneficial modification that led to improved anti-HIV-1
activity over the parent structure 15a, but resulted in a
concomitant increase in cytotoxicity. Other substituents such as
chlorine (compound 15d) and methyl (compound 15b)
introduced at the same position did not markedly influence the
4
2IC3
69.9
16

measured the p24 production to assess the inhibitory activity of
the compounds. As no inhibition of virus production, based on
p24 ELISA, was observed, targets after the RT step can also be
excluded. Finally all active compounds were subjected to an RT
RNaseH assay. None of the compounds 15a-k inhibited the
RNaseH activity, except for compound 15i which exhibited
marginal activity (IC50: 149.2 ± 43.9 µM).
As a result, it is clear that the NNRTI mode of action is the
sole mechanism responsible for the observed HIV-1 inhibitory
activity of the compounds 15a-k in cell culture.
3. Molecular modeling
In order to rationalize the HIV-RT inhibitory properties
observed we employed extensive docking experiments. Crystal
structures of WT and mutant HIV-1 RTs with structurally
relevant bound inhibitors were selected from the RCSB Protein
Data Bank for these studies (Table 3).
The binding conformation predicted for the most active
compound 15c in WT RT represents the typical "seahorse"30
conformation (Fig. 4a). The benzyl moiety is anchored at the
aromatic bottom of the binding pocket by means of π-stacking
interactions with Trp229 and Tyr188, while contacts with Tyr181
are diminished. A key hydrogen bond with Lys103 in the
backbone is formed by the anilide carbonyl, and the aniline and
uracil moieties are sandwiched between Leu100, Val106 and
Pro236 residues of RT. Additional hydrophobic interactions with
the Leu234 side chain were observed as well as weak hydrogen
bonding between H-6 of uracil and a carbonyl of Lys101
backbone.
Figure 3. pIC50 versus pEC50 values for compounds 15a-f;i-k and the
reference compounds nevirapine (NVP) and efavirenz (EFV).
One last modification was done to assess the influence of
lengthening the linker in the aniline moiety, creating the
benzylamine analogue (15h) of the molecule 15a. The elongated
linker of the benzylamine derivative 15h led to complete loss of
activity, so no further modifications of this type were considered.
An additional mechanism of action could be hypothesized,
since similar results were reported for uracil-derived NNRTIs
previously reported by Buckheit et al.27,28 and for thiouracil
derivatives by Mugnaini et al.29 However, based on the strong
correlation between the inhibition of the HIV-1 replication in
vitro and the inhibitory activity in a RT polymerase assay this is
unlikely. To completely exclude other mechanisms of action, we
performed time of addition experiments for all active compounds
using the NNRTI-resistant double mutant virus and
concentrations of compound close to their CC50 values as
determined in the MT-4/MTT assay. No inhibitory effect on virus
production was revealed, excluding inhibition of a process
anterior to reverse transcription. To exclude possible targets after
transcription, in parallel with the evaluation of the activity using
the MT-4/MTT assay where cell viability is the read out, we
The binding modes of 15i were investigated for mutant RT
crystallographic structures and the results demonstrate negligible
differences with RMSD values ranging from 0.25 to 2.37 Å upon
molecular overlay. As a result, possible reorganization of the
binding pockets of the mutated enzymes could serve as
explanation for the observed differences in Ki values. The
chlorine in position 2 of the aniline piece of the scaffold occupies
space nearby several hydrophobic residues. Notably, this chorine
is computed to be at a distance of 2.98 Å from the carbonyl
oxygen of the Lys/Asn103 backbone. Hence, it is feasible that a
halogen bond is likely occuring.26 This finding not only supports
a
b
Figure 4. Predicted binding conformations: a) 15c WT HIV-1 RT (Val106 is omitted for clarity); b) 15i in K103N mutant of HIV-1 RT. Notice close contacts
with Val106 and spacial gap extending to the Asn103 side-chain. Distance for hydrogen and halogen bonds are indicated in angstroms.

the influence of the ortho-chloro substituent seems to be having
on the anti-HIV RT activity, but could also be responsible for the
cis-conformation of the amide bond. This last point is of
particular interest since our previously reported cinnamyl
derivatives comprise a trans-configured double C-C bond.
docking protocols proved effective for elucidating the structural
basis responsible for the observed activity trends. Overall the
results of the present study have added to our understanding of
the impact certain structural modifications have on anti-HIV
activity. This information will allow for further rational design of
more potent and efficacious NNRTIs.
The L100I mutation generally affects binding of NNRTIs
either by destabilizing the hydrogen bond to the backbone of
Lys101 or by introducing unfavorable protein-ligand
interactions.31 Notably 15i remained effective against this mutant
enzyme with the hydrogen bond to Lys103 computed to have
similar lengths in both WT and L100I HIV-RT (3.00 and 2.95 Å,
respectively).
5. Experimental
5.1. General
All reagents were obtained at the highest grade available from
Sigma and Acros Organics and used without further purification
unless otherwise is noted. Anhydrous DMF and isopropanol were
purchased from Sigma-Aldrich Co. Anhydrous acetone, 1,2-
dichloroethane, and ethyl acetate were obtained by distillation
over P2O5. NMR spectra were performed on a Bruker Avance
The K103N mutation confers resistance to a wide variety of
NNRTIs. Despite the prediction that the key stabilizing
interactions for this mutant RT would be retained, the significant
(14-fold) loss of inhibitory activity could be attributed to
unfavorable interactions between the amide functionality of
Asn103 and the uracil ring. It appears to be unable to effectively
accommodate the space generated by the replacement of the
Lys103 side chain (Fig. 4b). Moreover, the central region of 15i
lacks the ability to establish a halogen bond with the Tyr181 RT
backbone, which is known to contribute to improved resistance
profiles for several of the NNRTI families.32,33
1
400 spectrometer (400 MHz for H and 100 MHz for 13C) in
DMSO-d6 with tetramethylsilane as an internal standard. Data are
reported in the following order: multiplicity (br, broad; s, singlet;
d, doublet; dd, doublet of doublets; t, triplet; m, multiplet; q,
quartet; qu, quintet). TLC was performed on Merck TLC Silica
gel 60 F254 plates eluted with ethyl acetate or chloroform/MeOH
(10:1) and developed with UV-lamp VL-6.LC (France). Acros
Organics (Belgium) silica gel (Kieselguhr 60-200 μm, 60A) was
used for column chromatography. Melting points were
determined in glass capillaries on a Mel-Temp 3.0 (Laboratory
Devices Inc., US). Yields refer to spectroscopically (1H and 13C
NMR) homogeneous materials. High resolution mass spectra
were measured on Bruker micrOTOF II instruments using
electrospray ionization (HRESIMS). The measurements were
done in a positive ion mode (interface capillary voltage –4500 V)
in a mass range from m/z 50 to m/z 3000 Da; external or internal
calibration was done with ESI Tuning MixTM (Agilent
Technologies). A syringe injection was used for solutions in
acetonitrile (flow rate 3 µl/min). Nitrogen was applied as a dry
gas; the interface temperature was set at 180 C.
The effects of the V106A mutation in HIV-1 RT on the
binding of NNRTIs has been much less studied, thus there are
only a limited number of crystal structures of this mutant
available, and those that are, feature structurally irrelevant
inhibitors bound in the active site. Nonetheless, inspection of the
predicted conformation of 15i for WT HIV-1 RT demonstrates an
extensive hydrophobic interaction between the side chain of
Val106 and the uracil moiety that is lost upon mutation of
V106A. This is supported by the analogous loss of activity
reported previously for the 1-cinnamyl-3-benzyluracil
derivatives.8 Consequently, the 3-benzyluracil scaffold appears to
be responsible for the failure to adapt to the mutated binding
pocket; however a more satisfactory explanation for the influence
of the V106A mutation on 15i's activity has not been uncovered.
5.2. Synthesis
5.2.1. General procedure for the synthesis of 9a-d
Finally, reduced activity against the Y181C RT mutant has
mostly been attributed to the loss of important π-π interactions
between the tyrosine residue and aryl or allyl groups of many
NNRTIs (e.g., nevirapine, MKC-442, and 9-Cl-TIBO).34 Since
15i makes a much less significant contact with Tyr181, while π-
stacking still occurs with Tyr188, the diminished interaction with
Tyr181 appears to have little impact on the activity of 15i.
Anhydrous K2CO3 (20.09 g, 145.36 mmol) was added to a
solution of o-cresol (10.0 ml, 96.91 mmol) in 70 ml of acetone
followed with ethyl bromoacetate (11.80 ml, 106.60 mmol).
Resulting suspension was refluxed for 24 hr, filtered off and
evaporated. The residue was dissolved in 40 ml of CHCl3,
washed with 50  2 ml of 5% NaOH solution, water and
evaporated. Vacuum distillation afforded 14.33 g of 635,36 as a
clear oil; yield 76%; bp 125-128 °C/5 mm. A mixture of 6 (14.33
g, 73.78 mmol) and NBS (13.80 g, 77.53 mmol) in 100 ml of
CCl4 was refluxed under irradiation of 100 W tungsten lamp for 4
hr, cooled to room temperature, filtered and evaporated. The
residual oil was distilled to afford 18.10 g of bromide 737 as pale
yellow oil; yield 90%; bp 145-148 °C/5 mm.
4. Conclusions
In summary, we have reported the design and synthesis of a
series of acetanilide-containing uracil analogues based on
molecular hybridization of two other NNRTI scaffolds. All
newly synthesized compounds were evaluated for their anti-HIV
activity in MT-4 cells and their inhibitory activity against the
HIV-1 RT polymerase. The compounds bearing the uracil in
position A (12a-k) were revealed to be inactive whereas their
analogues with the uracil in position B (15a-k) displayed in vitro
anti-HIV-1 activities ranging from 1.7 to 35.8 µM in MT-4 cells,
with the exception of the benzylamine analogue that was devoid
of any anti-HIV activity. All of the active compounds owe their
inhibitory activity on HIV-1 replication exclusively to an NNRTI
type mode of action. Unfortunately, the active compounds
behaved like first generation NNRTIs.
A mixture of uracil, thymine, 5-fluorouracil or 5-chlorouracil
(53.53 mmol) and ammonium chloride (0.3 g, 5.60 mmol) in
HMDS (15 mL) was refluxed for 10 hr with exclusion of
moisture until a clear solution was obtained. The excess of
silylating agent was removed under vacuum. The residual clear
oil of 2,4-bis(trimethylsilyloxy)pyrimidines38 8a-d were
dissolved in 100 ml of anhydrous 1,2-dichloroethane and
bromide 7 (14.62 g, 53.53 mmol) was added. Reaction mixture
was heated at reflux for 30 hr, cooled to room temperature and
i
treated with 15 ml of PrOH. Resulting precipitate was collected
and purified by flash chromatography eluting with 1:10
EtOH/1,2-dichloroethane.
In conclusion, we have presented a versatile approach to
construct novel uracil-based small-molecule inhibitors and thus
have expanded the NNRTI chemical space. Simple flexible

1
5.2.1.1. Ethyl 2-(2-((2,4-dioxo-3,4-
Yield 92%; white crystals; mp 123.5-126 °C; H NMR (400
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(9a)
MHz, DMSO-d6)  ppm 1.20 (3 H, br. s., CH3), 3.13 (3 H, br. s. ,
NCH3), 4.16 (2 H, d, J=6.3 Hz, COOCH2), 4.63 - 5.08 (4 H, m,
CH2), 5.65 (1 H, d, J=7.1 Hz, H-5), 6.96 (2 H, d, J=7.3 Hz, H-5‟,
H-6‟), 7.12 - 7.40 (2 H, m, H-3‟, H-4‟), 7.79 (1 H, d, J=6.8 Hz,
H-6); 13C NMR (100 MHz, DMSO-d6)  ppm 14.3, 27.5, 39.4,
39.7, 39.9, 40.1, 40.3, 48.3, 61.1, 65.3, 99.9, 112.4, 121.4, 124.5,
129.6, 130.4, 144.9, 151.6, 155.9, 162.9, 168.9.
1
Yield 58%; white crystals; mp 157-159 °C; H NMR (600
MHz, DMSO-d6)  ppm 1.20 (3 H, t, J=7.1 Hz, CH3), 4.17 (2 H,
q, J=7.1 Hz, COOCH2), 4.84 (4 H, s, CH2), 5.53 (1 H, dd, J=7.9,
1.8 Hz, H-5), 6.91 - 7.02 (2 H, m, H-5‟, H-6‟), 7.19 (1 H, d,
J=7.4 Hz, H-3‟), 7.27 (1 H, t, J=7.7 Hz, H-4‟), 7.74 (1 H, d,
J=7.9 Hz, H-6), 11.25 (1 H, br. s., H-3); 13C NMR (150 MHz,
DMSO-d6)  ppm 18.2, 43.3, 43.4, 43.5, 43.7, 43.8, 43.9, 44.1,
50.9, 65.0, 69.2, 104.8, 116.3, 125.4, 128.6, 133.5, 134.0, 150.5,
155.2, 159.7, 168.0, 172.8.
5.2.2.2. Ethyl 2-(2-((3,5-dimethyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(10d)
1
Yield 99%; white crystals; mp 125-126.5 °C; H NMR (400
5.2.1.2. Ethyl 2-(2-((5-methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(9b)
MHz, DMSO-d6)  ppm 1.22 (2 H, t, J=7.1 Hz, CH3), 1.81 (3 H,
d, J=1.1 Hz, CH3), 3.16 (3 H, s, NCH3), 4.19 (2 H, q, J=7.2 Hz,
COOCH2), 4.85 (2 H, s, OCH2), 4.88 (2 H, s, NCH2), 6.92 - 7.00
(2 H, m, H-5‟, H-6‟), 7.21 (1 H, dd, J=7.5, 1.7 Hz, H-3‟), 7.27 (1
H, td, J=7.9, 1.7 Hz, H-4‟), 7.70 - 7.75 (1 H, m, H-6); 13C NMR
(100 MHz, DMSO-d6)  ppm 12.6, 14.1, 27.5, 39.2, 39.4, 39.6,
39.8, 40.0, 47.6, 60.8, 65.0, 107.3, 112.1, 121.2, 124.5, 129.3,
130.0, 140.6, 151.2, 155.5, 163.4, 168.7.
Yield 51%; white crystals; mp 189.5-191.5 °C; 1H NMR (400
MHz, DMSO-d6)  ppm 1.21 (3 H, t, J=7.2 Hz, CH3), 1.74 (3 H,
d, J=1.0 Hz, CH3), 4.18 (2 H, q, J=7.1 Hz, COOCH2), 4.81 (2 H,
s, OCH2), 4.85 (2 H, s, NCH2), 6.89 - 7.02 (2 H, m, H-5‟, H-6‟),
7.16 (1 H, dd, J=7.5, 1.4 Hz, H-3‟), 7.21 - 7.30 (1 H, m, H-4‟),
7.65 (1 H, d, J=1.3 Hz, H-6), 11.22 (1 H, s, H-3); 13C NMR (100
MHz, DMSO-d6)  ppm 12.2, 14.3, 39.4, 39.6, 39.8, 40.1, 40.3,
46.6, 61.1, 65.3, 108.6, 112.3, 121.5, 125.0, 129.5, 129.9, 142.4,
151.3, 155.7, 164.6, 169.0.
5.2.2.3. Ethyl 2-(2-((5-fluoro-3-methyl-2,4-dioxo-
3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetate (10e)
1
Yield 81%; white crystals; mp 123.5-125°C; H NMR (600
5.2.1.3. Ethyl 2-(2-((5-fluoro-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(9c)
MHz, DMSO-d6)  ppm 1.23 (3 H, t, J=7.2 Hz, CH3), 3.18 (3 H,
s, NCH3), 4.20 (2 H, q, J=7.1 Hz, COOCH2), 4.88 (4 H, s, CH2),
6.91 - 7.05 (2 H, m, H-5‟, H-6‟), 7.23 - 7.35 (2 H, m, H-3‟, H-4‟),
8.23 (1 H, d, J=6.4 Hz, H-6); 13C NMR (100 MHz, DMSO-d6) 
ppm 18.2, 32.1, 43.4, 43.5, 43.7, 43.8, 43.9, 44.1, 44.2, 52.6,
65.0, 69.2, 116.2, 125.3, 128.1, 133.6, 134.5, 154.0, 159.8, 172.8.
1
Yield 67%; white crystals; mp 123.5-125°C; H NMR (400
MHz, DMSO-d6)  ppm 1.20 (3 H, t, J=7.1 Hz, CH3), 4.17 (2 H,
q, J=7.2 Hz, COOCH2), 4.71 - 4.95 (4 H, m, CH2), 6.89 - 7.05 (2
H, m, H-5‟, H-6‟), 7.16 - 7.37 (2 H, m, H-3‟, H-4‟), 8.13 (1 H, d,
J=6.8 Hz, H-6), 11.77 (1 H, d, J=4.5 Hz, NH); 13C NMR (100
MHz, DMSO-d6)  ppm 14.3, 39.4, 39.6, 39.8, 40.0, 40.2, 47.5,
61.1, 65.3, 112.3, 121.4, 124.4, 129.7, 130.3, 131.0, 131.3, 150.0,
155.7, 169.0.
5.2.2.4. Ethyl 2-(2-((5-chloro-3-methyl-2,4-dioxo-
3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetate (10f)
Yield 88%; white crystals; mp °C; 1H NMR (600 MHz,
DMSO-d6)  ppm 1.23 (3 H, t, J=7.1 Hz, CH3), 3.32 (3 H, s,
NCH3), 4.20 (2 H, q, J=7.2 Hz, COOCH2), 4.86 (2 H, s, OCH2),
4.93 (2 H, s, NCH2), 6.93 - 7.02 (2 H, m, H-5‟, H-6‟), 7.25 - 7.34
(2 H, m, H-3‟, H-4‟), 8.28 (1 H, s, H-6); 13C NMR (100 MHz,
DMSO-d6)  ppm 18.2, 32.7, 43.4, 43.5, 43.7, 43.8, 44.0, 44.1,
44.2, 52.8, 65.0, 69.2, 109.6, 116.3, 125.4, 128.0, 133.7, 134.5,
146.2, 159.8, 172.7.
5.2.1.4. Ethyl 2-(2-((5-chloro-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(9d)
1
Yield 55%; white crystals; mp 200-201 °C; H NMR (400
MHz, DMSO-d6)  ppm 1.20 (3 H, t, J=7.1 Hz, CH3), 4.17 (2 H,
q, J=7.1 Hz, COOCH2), 4.85 (4 H, s, CH2), 6.88 - 7.04 (2 H, m,
H-5‟, H-6‟), 7.14 - 7.37 (2 H, m, H-3‟, H-4‟), 8.19 (1 H, s, H-6),
11.79 (1 H, br. s., H-3); 13C NMR (100 MHz, DMSO-d6)  ppm
14.3, 39.4, 39.6, 39.8, 40.0, 40.2, 47.7, 61.1, 65.3, 112.3, 121.5,
124.3, 129.7, 130.3, 143.9, 155.8, 168.9.
5.2.3. General procedure for the synthesis of 10b
and 10c
A suspension of 9a (1.11 g, 3.66 mmol) and K2CO3 (0.6 g,
4.34 mmol) in anhydrous DMF (8 mL) was stirred at 80 °C for 1
hr. After addition of n-propyl iodide (0.37 ml, 3.82 mmol) for
10b or allyl bromide (0.33 ml, 3.82 mmol) for 10c, stirring was
continued at room temperature for 24 hr. The reaction mixture
was filtered, evaporated and the residue treated with water,
filtered off and purified by flash chromatography eluting with
1:10 hexane/ethyl acetate.
5.2.2. General procedure for the synthesis of 10a,
d-f
To a magnetically stirred mixture of 9 (13.97 mmol) and
anhydrous K2CO3 (7.72 g, 55.86 mmol) in 50 ml of acetone,
dimethyl sulfate (2 ml, 21.14 mmol) was added in one portion at
room temperature. After 20 hr, a solution of NaOH (3.5 g) in 100
ml of water was added, and stirring was continued for 0.5 hr. The
mixture was concentrated and the resulting precipitate filtered off
after cooling in a refrigerator. The products 10a-d were
sufficiently pure to be used in the next step without any
additional purification.
5.2.3.1. Ethyl 2-(2-((2,4-dioxo-3-propyl-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(10b)
1
Yield 94%; white crystals; mp 187-188 °C; H NMR (400
MHz, DMSO-d6)  ppm 1.20 (3 H, t, J=7.1 Hz, CH3), 4.17 (2 H,
q, J=7.1 Hz, CH2), 4.84 (4 H, s, ), 5.52 (1 H, dd, J=7.8, 2.3 Hz,
H-5), 6.90 - 7.03 (2 H, m, H-5‟, H-6‟), 7.18 (1 H, dd, J=7.8, 1.8
Hz, H-3‟), 7.27 (1 H, td, J=7.8, 1.5 Hz, H-4‟), 7.73 (1 H, d, J=7.8
Hz, H-6), 11.23 (1 H, br. s., NH); 13C NMR (100 MHz, DMSO-
d6)  ppm 14.3, 39.4, 39.6, 39.9, 40.1, 40.3, 47.0, 61.1, 65.3,
5.2.2.1. Ethyl 2-(2-((3-methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(10a)

5.2.4.4. 2-(2-((3,5-Dimethyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetic
acid (11d)
100.9, 112.4, 121.5, 124.8, 129.5, 130.0, 146.5, 151.3, 155.8,
164.1, 168.9.
5.2.3.2. Ethyl 2-(2-((3-allyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetate
(10c)
Yield 94%; white crystals; mp 233.5-234.5 °C; 1H NMR (400
MHz, DMSO-d6)  ppm 1.80 (3 H, d, J=1.1 Hz, CH3), 3.16 (3 H,
s, NCH3), 4.75 (2 H, s, OCH2), 4.86 (2 H, s, NCH2), 6.91 - 6.98
(2 H, m, H-5‟, H-6‟), 7.21 - 7.29 (2 H, m, H-3‟, H-4‟), 7.78 (1 H,
d, J=1.3 Hz, H-6); 13C NMR (100 MHz, DMSO-d6)  ppm 12.5,
27.4, 39.1, 39.3, 39.5, 39.7, 39.9, 47.5, 64.8, 107.2, 111.9, 120.9,
124.3, 129.2, 130.1, 140.6, 151.1, 155.6, 163.3, 170.0.
1
Yield 91%; white crystals; mp 86.5-87.5 °C; H NMR (400
MHz, DMSO-d6)  ppm 1.21 (3 H, t, J=7.2 Hz, CH3), 4.18 (2 H,
q, J=7.2 Hz, CH2), 4.38 (2 H, d, J=5.2 Hz, CH2), 4.84 (2 H, s,
CH2), 4.91 (2 H, s, CH2), 5.00 - 5.11 (2 H, m, =CH2), 5.68 (1 H,
d, J=7.9 Hz, H-5), 5.80 (1 H, ddt, J=17.2, 10.5, 5.3, 5.3 Hz, -
CH=), 6.93 - 7.01 (2 H, m, H-5‟, H-6‟), 7.23 (1 H, dd, J=7.4, 1.2
Hz, H-3‟), 7.25 - 7.31 (1 H, m, H-4‟), 7.80 (1 H, d, J=7.9 Hz, H-
6); 13C NMR (100 MHz, DMSO-d6)  ppm 13.9, 39.3, 39.5, 39.7,
42.2, 47.9, 60.7, 65.0, 99.7, 112.0, 116.4, 121.1, 124.2, 129.3,
129.9, 132.4, 144.8, 150.8, 155.5, 162.0, 168.5.
5.2.4.5. 2-(2-((5-Fluoro-3-methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetic
acid (11e)
Yield 71%; white crystals; mp 220.5-222.5 °C; 1H NMR (600
MHz, DMSO-d6)  ppm 3.15 (3 H, s, NCH3), 4.74 (2 H, s,
NCH2), 4.85 (2 H, s, OCH2), 6.89 - 7.01 (2 H, m, H-5‟, H-6‟),
7.21 - 7.35 (2 H, m, H-3‟, H-4‟), 8.25 (1 H, d, J=6.3 Hz, H-6);
13C NMR (100 MHz, DMSO-d6)  ppm 32.1, 43.1, 43.2, 43.4,
43.5, 43.6, 43.8, 43.9, 44.0, 52.7, 68.9, 116.0, 125.1, 127.9,
133.6, 133.7, 133.8, 134.8, 154.0, 159.9, 174.4.
5.2.4. General procedure for the synthesis of 11a-f
To a magnetically stirred mixture of ester 10 (21.52 mmol) in
50 ml of THF and 30 ml of water LiOH∙H2O (0.95 g, 22.64
mmol) was added. After 5 hr at room temperature, the resulting
clear solution was acidified with dilute HCl to precipitate the
product. After filtration the product was obtained as a white
crystalline solid, which was used in subsequent steps without
further purification. An analytically pure sample was
recrystallized from i-PrOH/hexane mixture.
5.2.4.6. 2-(2-((5-Chloro-3-methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetic
acid (11f)
1
Yield 64%; white crystals; mp 209-210.5 °C; H NMR (600
5.2.4.1. 2-(2-((3-Methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetic
acid (11a)
MHz, DMSO-d6)  ppm 3.20 (3 H, s, NCH3), 4.76 (2 H, s,
NCH2), 4.92 (2 H, s, OCH2), 6.92 - 7.02 (2 H, m, H-5‟, H-6‟),
7.25 - 7.34 (2 H, m, H-3‟, H-4‟), 8.33 (1 H, s, H-6); 13C NMR
(100 MHz, DMSO-d6)  ppm 32.7, 43.4, 43.5, 43.6, 43.8, 43.9,
44.1, 44.2, 44.3, 52.8, 69.0, 109.6, 116.2, 125.2, 128.0, 133.7,
134.7, 146.3, 154.5, 159.9, 163.2.
Yield 89%; white crystals; mp 220.5-221.5 °C; 1H NMR (400
MHz, DMSO-d6)  ppm 3.13 (3 H, s, NCH3), 4.75 (2 H, s,
OCH2), 4.89 (2 H, s, NCH2), 5.64 (1 H, d, J=7.8 Hz, H-5), 6.89 -
7.02 (2 H, m, H-5‟, H-6‟), 7.17 - 7.33 (2 H, m, H-3‟, H-4‟), 7.84
(1 H, d, J=8.1 Hz, H-6); 13C NMR (100 MHz, DMSO-d6)  ppm
27.3, 39.1, 39.3, 39.5, 39.7, 39.9, 48.1, 64.8, 99.6, 112.0, 121.0,
124.2, 129.3, 130.1, 144.7, 151.3, 155.7, 162.7, 170.1.
5.2.5. General procedure for the synthesis of 12a-k
A mixture of 11 (5.68 mmol) and thionyl chloride (0.42 ml,
5.76 mmol) in 10 ml of anhydrous 1,2-dichloroethane was
refluxed for 2 hr. with the exclusion of moisture. The volatile
materials were evaporated under reduced pressure, and the
residue dissolved in 10 ml of anhydrous 1,2-dichloroethane and
cooled to -15 °C. To the magnetically stirred solution, the
appropriate aniline (5.71 mmol) was added in one portion,
followed by 3 ml of pyridine after 5 min. The reaction mixture
was stirred for 2 hr. and left to warm to room temperature
overnight. The reaction mixture was washed portions of dilute
HCl, 2% aqueous NaOH solution, then water, and evaporated.
The residual solid was purified by flash chromatography eluting
with 1:10 EtOH/1,2-dichloroethane.
5.2.4.2. 2-(2-((2,4-Dioxo-3-propyl-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetic
acid (11b)
1
Yield 94%; white crystals; mp 187-188 °C; H NMR (600
MHz, DMSO-d6)  ppm 0.83 (3 H, t, J=7.5 Hz, CH3), 1.51 (2 H,
sxt, J=7.5 Hz, CH2), 3.74 (2 H, t, J=7.5 Hz, NCH2), 4.76 (2 H, s,
OCH2), 4.91 (2 H, s, NCH2), 5.64 (1 H, d, J=7.8 Hz, H-5), 6.92 -
7.00 (2 H, m, H-5‟, H-6‟), 7.21 (1 H, d, J=7.4 Hz, H-3‟), 7.25 -
7.31 (1 H, m, H-4‟), 7.82 (1 H, d, J=7.9 Hz, H-6); 13C NMR (100
MHz, DMSO-d6)  ppm 15.3, 24.6, 43.4, 43.5, 43.6, 43.8, 43.9,
44.0, 44.2, 46.0, 52.0, 69.1, 104.0, 116.2, 125.2, 128.5, 133.5,
134.1, 148.9, 159.9, 166.6, 174.2.
5.2.5.1. 2-(2-((3-Methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)-N-
phenylacetamide (12a)
5.2.4.3. 2-(2-((3-Allyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)acetic
acid (11c)
1
Yield 73%; white crystals; mp 145-146.5 °C; H NMR (400
MHz, DMSO-d6)  ppm 3.14 (3 H, s, NCH3), 4.78 (2 H, s,
OCH2), 5.00 (2 H, s, NCH2), 5.68 (1 H, d, J=7.8 Hz, H-5), 6.94 -
7.04 (2 H, m, H-5‟, H-6‟), 7.06 - 7.12 (1 H, m, H-4‟‟), 7.24 - 7.30
(1 H, m, H-3‟), 7.30 - 7.37 (3 H, m, H-4‟, H-3‟‟, H-5‟‟), 7.66 (2
H, d, J=7.6 Hz, H-2‟‟, H-6‟‟), 7.83 (1 H, d, J=7.8 Hz, H-6), 10.08
(1 H, s, NH); 13C NMR (100 MHz, DMSO-d6)  ppm 27.3, 39.1,
39.3, 39.5, 39.7, 39.9, 47.6, 67.3, 100.0, 112.1, 119.7, 121.2,
123.8, 124.3, 128.8, 129.5, 130.1, 138.3, 144.4, 151.5, 155.7,
162.6, 166.3. HRESIMS m/z: calculated for C20H19N3O4 [M+H]+
366.1448, found 366.1448; calculated for C16H12Cl2N2O4
[M+Na]+ 388.1268, found 388.1263.
1
Yield 90%; white crystals; mp 183.5-185°C; H NMR (400
MHz, DMSO-d6)  ppm 4.37 (2 H, dt, J=5.3, 1.5 Hz, NCH2),
4.74 (2 H, s, OCH2), 4.90 (2 H, s, NCH2), 4.99 - 5.11 (2 H, m,
=CH2), 5.65 (1 H, d, J=7.9 Hz, H-5), 5.79 (1 H, ddt, J=17.1, 10.4,
5.3, 5.3 Hz, -CH=), 6.90 - 7.00 (2 H, m, H-5‟, H-6‟), 7.20 (1 H,
dd, J=7.8, 1.6 Hz, H-3‟), 7.28 (1 H, td, J=7.8, 1.7 Hz, H-4‟), 7.83
(1 H, d, J=7.9 Hz, H-6); 13C NMR (100 MHz, DMSO-d6)  ppm
39.2, 39.4, 39.6, 39.8, 40.0, 42.3, 48.0, 64.9, 99.8, 112.1, 116.5,
121.0, 124.2, 129.4, 129.9, 132.5, 145.0, 155.8, 170.1.

Yield 50%; white crystals; mp 162.5-164.5 °C; 1H NMR (400
MHz, DMSO-d6)  ppm 3.12 (3 H, s, NCH3), 4.88 (2 H, s,
OCH2), 5.01 (2 H, s, NCH2), 5.68 (1 H, d, J=8.1 Hz, H-5), 6.98
(1 H, t, J=7.5 Hz, H-5‟), 7.04 (1 H, d, J=8.3 Hz, H-6‟), 7.18 -
7.25 (1 H, m, H-3‟), 7.25 - 7.34 (2 H, m, H-4‟, H-4‟‟), 7.55 (1 H,
d, J=8.8 Hz, H-3‟‟), 7.79 (1 H, d, J=7.8 Hz, H-6), 7.98 (1 H, d,
J=2.3 Hz, H-6‟‟), 9.69 (1 H, s, NH); 13C NMR (100 MHz,
DMSO-d6)  ppm 27.6, 39.5, 39.7, 39.9, 40.1, 40.3, 47.9, 67.5,
100.3, 112.5, 121.7, 124.7, 124.9, 126.5, 129.7, 129.9, 131.2,
132.0, 135.7, 144.6, 151.7, 155.6, 162.9, 167.3. HRESIMS m/z:
5.2.5.2. 2-(2-((3-Methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)-N-(o-
tolyl)acetamide (12b)
1
Yield 10%; white crystals; mp 160-161.5 °C; H NMR (400
MHz, DMSO-d6)  ppm 2.17 (3 H, s, CH3), 3.11 (3 H, s, NCH3),
4.80 (2 H, s, OCH2), 5.02 (2 H, s, NCH2), 5.68 (1 H, d, J=7.8 Hz,
H-5), 6.98 (1 H, t, J=7.3 Hz, H-5‟), 7.03 (1 H, d, J=8.3 Hz, H-6‟),
7.08 - 7.15 (1 H, m, H-4‟‟), 7.18 (1 H, d, J=7.8 Hz, H-3‟‟), 7.23
(2 H, d, J=7.6 Hz, H-3‟, H-5‟‟), 7.32 (1 H, t, J=7.7 Hz, H-4‟),
7.41 (1 H, d, J=7.3 Hz, H-6‟‟), 7.79 (1 H, d, J=7.8 Hz, H-6), 9.43
(1 H, s, NH); 13C NMR (100 MHz, DMSO-d6)  ppm 18.0, 27.6,
39.2, 39.5, 39.7, 39.9, 40.1, 40.3, 40.5, 47.8, 67.6, 100.3, 112.3,
121.5, 124.7, 125.7, 126.1, 126.4, 129.7, 130.0, 130.7, 135.8,
144.6, 151.8, 155.8, 162.9, 166.7. HRESIMS m/z: calculated for
C21H21N3O4 [M+H]+ 380.1605, found 380.1601; calculated for
C21H21N3O4 [M+Na]+ 402.1424, found 402.1420.
calculated for C20H17Cl2N3O4 [M+H]+
434.0669, found
434.0658; calculated for C20H17Cl2N3O4 [M+Na]+ 456.0488,
found 456.0484.
5.2.5.7. N-(2-Chlorophenyl)-2-(2-((2,4-dioxo-3-
propyl-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12g)
Yield 72%; white crystals; mp 135.5-137.5 °C; 1H NMR (600
MHz, DMSO-d6)  ppm 0.79 (3 H, t, J=7.5 Hz, CH3), 1.49 (2 H,
sxt, J=7.4 Hz, CH2), 3.72 (2 H, dd, J=7.9, 6.8 Hz, CH2), 4.87 (2
H, s, OCH2), 5.04 (2 H, s, NCH2), 5.69 (1 H, dd, J=7.9, 0.9 Hz,
H-5), 7.01 (1 H, t, J=7.5 Hz, H-5‟), 7.08 (1 H, d, J=8.3 Hz, H-6‟),
7.21 - 7.26 (2 H, m, H-3‟, H-5“), 7.34 (1 H, t, J=7.8 Hz, H-4‟),
7.37 (1 H, t, J=7.7 Hz, H-4“), 7.53 (1 H, d, J=8.0 Hz, H-3”), 7.80
(1 H, d, J=7.9 Hz, H-6), 7.83 (1 H, d, J=8.1 Hz, H-6”), 9.62 (1 H,
s, NH); 13C NMR (150 MHz, DMSO-d6)  ppm 15.3, 24.6, 43.4,
43.5, 43.7, 43.8, 43.9, 44.1, 44.2, 46.0, 51.6, 71.5, 104.5, 116.5,
125.6, 128.6, 130.9, 131.8, 133.6, 133.7, 133.8, 148.5, 166.5.
HRESIMS m/z: calculated for C22H22ClN3O4 [M+H]+ 428.1372,
found 428.1364; calculated for C22H22ClN3O4 [M+Na]+
450.1191, found 450.1183.
5.2.5.3. N-(2-Chlorophenyl)-2-(2-((3-methyl-2,4-
dioxo-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12c)
1
Yield 70%; white crystals; mp 139-140.5 °C; H NMR (400
MHz, DMSO-d6)  ppm 3.13 (3 H, s, NCH3) 4.78 (2 H, s, CH2)
5.00 (2 H, s, CH2) 5.67 (1 H, d, J=7.8 Hz, H-5) 6.95 - 7.03 (2 H,
m) 7.24 - 7.34 (2 H, m) 7.36 - 7.43 (2 H, m) 7.66 - 7.73 (2 H, m)
7.82 (1 H, d, J=7.8 Hz, H-6) 10.20 (1 H, s, NH). 13C NMR (100
MHz, DMSO-d6)  ppm 27.35, 39.10, 39.31, 39.52, 39.73, 39.94,
47.58, 67.32, 100.01, 112.12, 121.21, 121.28, 124.35, 127.41,
128.73, 129.47, 130.05, 137.29, 144.34, 151.46, 155.67, 162.58,
166.50.
5.2.5.4. N-(3-Chlorophenyl)-2-(2-((3-methyl-2,4-
dioxo-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12d)
5.2.5.8. 2-(2-((3-Allyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)-N-(2-
chlorophenyl)acetamide (12h)
1
Yield 80%; white crystals; mp 172.5-174 °C; H NMR (400
MHz, DMSO-d6)  ppm 3.14 (3 H, s, NCH3), 4.79 (2 H, s,
OCH2), 5.00 (2 H, s, NCH2), 5.68 (1 H, d, J=7.8 Hz, H-5), 6.95 -
7.04 (2 H, m, H-5‟, H-6‟), 7.12 - 7.18 (1 H, m, H-4‟‟), 7.25 - 7.33
(2 H, m, H-3‟, H-4‟), 7.36 (1 H, t, J=8.1 Hz, H-5‟‟), 7.54 - 7.60
(1 H, m, H-6‟‟), 7.81 (1 H, d, J=8.1 Hz, H-6), 7.86 (1 H, t, J=1.9
Hz, H-2‟‟), 10.25 (1 H, s, NH); 13C NMR (100 MHz, DMSO-d6)
 ppm 27.3, 39.1, 39.3, 39.5, 39.7, 39.9, 47.6, 67.3, 100.0, 112.1,
118.1, 119.2, 121.2, 123.5, 124.4, 129.5, 130.1, 130.5, 133.1,
139.8, 144.3, 151.5, 155.6, 162.6, 166.8. HRESIMS m/z:
calculated for C20H18ClN3O4 [M+H]+ 400.1059, found 400.1056;
calculated for C20H18ClN3O4 [M+Na]+ 422.0878, found
422.0877.
1
Yield 86%; white crystals; mp 102-103 °C; H NMR (400
MHz, DMSO-d6)  ppm 4.38 (2 H, d, J=5.2 Hz, NCH2), 4.78 (2
H, s, OCH2), 4.97 - 5.09 (2 H, m, =CH2), 5.02 (2 H, s, NCH2),
5.70 (1 H, d, J=7.9 Hz, H-5), 5.79 (1 H, ddt, J=17.1, 10.4, 5.3,
5.3 Hz, -CH=), 6.99 (2 H, m, J=7.8, 7.8 Hz,H-4”, H-5”), 7.15 (1
H, ddd, J=8.0, 2.1, 0.9 Hz, H-6‟), 7.26 - 7.30 (1 H, m, H-5‟), 7.31
(1 H, t, J=7.0 Hz, H-4‟), 7.36 (1 H, t, J=8.1 Hz, H-3”), 7.57 (1 H,
dt, J=7.3, 1.0 Hz, H-3‟), 7.81 (1 H, d, J=7.9 Hz, H-6), 7.86 (1 H,
t, J=2.1 Hz, H-6”), 10.19 (1 H, s, NH); 13C NMR (100 MHz,
DMSO-d6)  ppm 39.4, 39.6, 39.8, 42.4, 47.5, 67.4, 100.3, 112.3,
116.5, 118.2, 119.3, 121.3, 123.6, 124.4, 129.6, 130.1, 130.5,
132.4, 139.8, 144.6, 155.7, 166.7. HRESIMS m/z: calculated for
C22H20ClN3O4 [M+H]+ 426.1215, found 426.1204; calculated for
C22H20ClN3O4 [M+Na]+ 448.1035, found 448.1024.
5.2.5.5. N-(4-Chlorophenyl)-2-(2-((3-methyl-2,4-
dioxo-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12e)
5.2.5.9. N-(2-Chlorophenyl)-2-(2-((3,5-dimethyl-
2,4-dioxo-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12i)
1
Yield 70%; white crystals; mp 209-210.5 °C; H NMR (400
MHz, DMSO-d6)  ppm 3.13 (3 H, s, NCH3), 4.77 (2 H, s,
OCH2), 4.99 (2 H, s, NCH2), 5.66 (1 H, d, J=7.8 Hz, H-5), 6.90 -
7.05 (2 H, m, H-5‟, H-6‟), 7.21 - 7.34 (2 H, m, H-3‟, H-4‟), 7.38
(2 H, d, J=8.8 Hz, H-3‟‟, H-5‟‟), 7.68 (2 H, d, J=8.8 Hz, H-2‟‟,
H-6‟‟), 7.80 (1 H, d, J=7.8 Hz, H-6), 10.17 (1 H, s, NH); 13C
NMR (100 MHz, DMSO-d6)  ppm 27.6, 39.2, 39.5, 39.7, 39.9,
40.1, 40.3, 40.5, 47.9, 67.7, 100.3, 112.4, 121.5, 121.6, 124.7,
127.7, 129.0, 129.8, 130.3, 137.6, 144.6, 151.8, 156.0, 162.9,
166.8. HRESIMS m/z: calculated for C20H18ClN3O4 [M+H]+
400.1059, found 400.1049; calculated for C20H18ClN3O4
[M+Na]+ 422.0878, found 422.0871.
1
Yield 82%; white crystals; mp 139-140.5 °C; H NMR (400
MHz, DMSO-d6)  ppm 1.79 (3 H, d, J=0.8 Hz, CH3), 3.15 (3 H,
s, NCH3), 4.87 (2 H, s, OCH2), 5.01 (2 H, s, NCH2), 6.99 (1 H, t,
J=7.4 Hz, H-5‟), 7.06 (1 H, d, J=8.3 Hz, H-6‟), 7.19 - 7.26 (2 H,
m, H-3‟, H-4‟), 7.31 (1 H, td, J=7.8, 1.4 Hz, H-4‟‟), 7.37 (1 H, td,
J=7.8, 1.4 Hz, H-5‟‟), 7.52 (1 H, dd, J=7.9, 1.4 Hz, H-3‟‟), 7.71
(1 H, d, J=1.0 Hz, H-6), 7.85 (1 H, dd, J=8.0, 1.5 Hz, H-6‟‟),
9.61 (1 H, s, NH); 13C NMR (100 MHz, DMSO-d6)  ppm 12.5,
27.5, 39.1, 39.3, 39.5, 39.7, 39.9, 47.0, 67.2, 107.7, 112.1, 121.3,
124.5, 125.6, 126.6, 127.5, 129.2, 129.5, 134.0, 140.1, 151.2,
155.2, 163.2, 166.6. HRESIMS m/z: calculated for C21H20ClN3O4
[M+H]+ 414.1215, found 414.1209; calculated for C21H20ClN3O4
[M+Na]+ 436.1035, found 436.1026.
5.2.5.6. N-(2,5-Dichlorophenyl)-2-(2-((3-methyl-
2,4-dioxo-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12f)

5.2.5.10. N-(2-Chlorophenyl)-2-(2-((5-fluoro-3-
methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-
yl)methyl)phenoxy)acetamide (12j)
acids were obtained as white crystalline solids, which were used
in subsequent steps without further purification. Analytical
samples were recrystallized from i-PrOH/hexane mixture.
1
5.2.7.1. 2-(3-(3,5-Dimethylbenzyl)-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)acetic acid (14a)
Yield 56%; white crystals; mp 156-158 °C; H NMR (600
MHz, DMSO-d6)  ppm 3.15 (3 H, s, NCH3), 4.86 (2 H, s,
OCH2), 4.98 (2 H, s, NCH2), 6.98 (1 H, t, J=7.5 Hz, H-5‟), 7.04
(1 H, d, J=8.2 Hz, H-6‟), 7.22 (1 H, t, J=7.7 Hz, H-4”), 7.28 (1 H,
d, J=7.5 Hz, H-3‟), 7.32 (1 H, t, J=7.8 Hz, H-4‟), 7.35 (1 H, t,
J=7.8 Hz, H-5”), 7.50 (1 H, dd, J=8.0, 1.3 Hz, H-3”), 7.80 (1 H,
d, J=8.0 Hz, H-6), 8.23 (1 H, d, J=6.4 Hz, H-6”), 9.66 (1 H, s,
NH); 13C NMR (100 MHz, DMSO-d6)  ppm 32.2, 43.1, 43.3,
43.4, 43.5, 43.7, 43.8, 43.9, 52.2, 71.3, 116.2, 125.5, 128.1,
130.0, 131.0, 131.8, 133.7, 134.2, 138.2, 154.1, 159.6, 171.0.
HRESIMS m/z: calculated for C20H17ClFN3O4 [M+H]+ 418.0964,
found 418.0956; calculated for C20H17ClFN3O4 [M+Na]+
440.0784, found 440.0776.
Yield 78%, white crystals; mp: 211-212 °C, Rf 0.51 (iPrOH/
1
EtOAc/NH4OHaq. 9:6:5); H NMR (400 MHz, DMSO-d6) δ ppm
2.21 (6 H, s, CH3), 4.50 (2 H, s, NCH2), 4.91 (2 H, s, NCH2),
5.79 (1 H, d, J=7.8 Hz, H-5), 6.85 (3 H, s, H-2’,4’,6’), 7.71 (1 H,
d, J=7.9 Hz, H-6); 13C NMR (100 MHz, DMSO-d6) δ ppm 20.9,
39.0, 39.2, 39.5, 39.7, 39.9, 43.3, 49.8, 100.2, 125.2, 128.6,
136.9, 137.3, 144.8, 151.3, 162.4, 169.5.
5.2.7.2. 2-(3-(3,5-Dichlorobenzyl)-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)acetic acid (14b)
Yield 71%; white crystals; mp 226-228 °C; Rf 0.55 (iPrOH/
EtOAc/NH4OHaq. 9:6:5); 1H NMR (400 MHz, DMSO-d6)  ppm
4.49 (2 H, s, NCH2), 4.96 (2 H, s, NCH2), 5.80 (1 H, d, J=7.8 Hz,
H-5), 7.25 (2 H, d, J=1.7 Hz, H-2‟, H-6‟), 7.46 (1 H, d, J=1.7 Hz,
H-4‟), 7.71 (1 H, d, J=7.8 Hz, H-6); 13C NMR (100 MHz,
DMSO-d6) δ ppm 39.2, 39.4, 39.6, 39.8, 40.0, 42.9, 50.2, 100.5,
126.5, 127.3, 134.3, 141.4, 145.5, 162.7, 169.7.
5.2.5.11. 2-(2-((5-Chloro-3-methyl-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)methyl)phenoxy)-N-(2-
chlorophenyl)acetamide (12k)
1
Yield 58%; white crystals; mp 169-171 °C; H NMR (600
MHz, DMSO-d6)  ppm 3.20 (3 H, s, NCH3), 4.88 (2 H, s,
OCH2), 5.06 (2 H, s, NCH2), 7.00 (1 H, t, J=7.5 Hz, H-5‟), 7.07
(1 H, d, J=8.3 Hz, H-6‟), 7.24 (1 H, t, J=7.8 Hz, H-4”), 7.29 (1 H,
d, J=7.3 Hz, H-3‟), 7.34 (1 H, t, J=7.8 Hz, H-4‟), 7.38 (1 H, t,
J=7.7 Hz, H-5”), 7.53 (1 H, dd, J=8.0, 1.1 Hz, H-3”), 7.86 (1 H,
d, J=8.2 Hz, H-6”), 8.30 (1 H, s, H-6), 9.62 (1 H, s, NH); 13C
NMR (100 MHz, DMSO-d6)  ppm 32.8, 43.4, 43.5, 43.7, 43.8,
43.9, 44.1, 44.2, 52.3, 71.5, 110.0, 116.4, 125.6, 128.3, 129.9,
130.9, 131.8, 133.7, 133.7, 133.9, 138.3, 145.9, 154.6, 163.2,
170.9. HRESIMS m/z: calculated for C20H17Cl2N3O4 [M+H]+
434.0669, found 434.0658; calculated for C20H17Cl2N3O4
[M+Na]+ 456.0488, found 456.0483.
5.2.7.3. 2-(3-(3-Bromo-5-methylbenzyl)-2,4-dioxo-
3,4-dihydropyrimidin-1(2H)-yl)acetic acid (14c)
Yield 87%; white crystals; mp 227-229°C; Rf 0.52 (iPrOH/
EtOAc/NH4OHaq. 9:6:5); 1H NMR (400 MHz, DMSO-d6)  ppm
2.24 (3 H, s, CH3), 4.48 (2 H, s, NCH2), 4.92 (2 H, s, NCH2),
5.79 (1 H, d, J=7.8 Hz, H-5), 7.04 (1 H, s, H-6‟), 7.19 (1 H, s, H-
2‟), 7.27 (1 H, s, H-4‟), 7.70 (1 H, d, J=8.1 Hz, H-6); 13C NMR
(100 MHz, DMSO-d6) δ ppm 20.9, 39.2, 39.4, 39.6, 39.8, 40.1,
43.1, 50.2, 100.5, 121.7, 127.5, 130.8, 139.7, 140.7, 145.4, 169.7.
5.2.7.4. 2-(3-(Naphthalen-1-ylmethyl)-2,4-dioxo-
3,4-dihydropyrimidin-1(2H)-yl)acetic acid (14d)
5.2.6. Ethyl 2-(2,4-dioxo-3,4-dihydropyrimidin-
1(2H)-yl)acetate (13)
Yield 72%; white crystals; mp 200-203 °C; Rf 0.56 (iPrOH/
EtOAc/NH4OHaq. 9:6:5); 1H NMR (400 MHz, DMSO-d6)  ppm
4.52 (2 H, s, NCH2), 5.47 (2 H, s, NCH2), 5.87 (1 H, d, J=7.8 Hz,
H-5), 7.00 (1 H, d, J=7.1 Hz, H-2‟), 7.39 (1 H, t, J=7.7 Hz, H-3‟),
7.51 - 7.64 (2 H, m, H-6‟,7‟), 7.79 (1 H, d, J=7.8 Hz, H-6), 7.82
(1 H, d, J=8.3 Hz, H-4‟), 7.95 (1 H, d, J=8.3 Hz, H-5‟), 8.19 (1
H, d, J=8.3 Hz, H-8‟); 13C NMR (100 MHz, DMSO-d6) δ ppm
39.2, 39.4, 39.6, 39.9, 40.1, 40.3, 41.6, 50.2, 100.5, 122.3, 123.4,
125.6, 126.3, 126.7, 127.6, 128.9, 132.1, 145.4, 169.7.
A mixture of uracil (6.00 g, 53.53 mmol) and ammonium
chloride (0.3 g, 5.60 mmol) in HMDS (15 mL) was refluxed for
10 hr with the exclusion of moisture until a clear solution was
obtained. The excess of silylating agent was removed under
vacuum.
The
residual
clear
oil
of
2,4-
bis(trimethylsilyloxy)pyrimidine was dissolved in 25 ml of
anhydrous 1,2-dichloroethane, and ethyl bromoacetate (5.92 ml,
53.53 mmol) was added. The reaction mixture was heated at
reflux for 20 hr, cooled to room temperature and treated with 15
i
ml of PrOH. The resulting precipitate was collected and purified
5.2.8. General procedure for the synthesis of 15a-d,
f, g, i-k
by flash chromatography eluting with 1:10 EtOH/1,2-
dichloroethane to give 13 (9.45 g, 92%) as white crystals, mp °C,
1
Rf (); H NMR (400 MHz, DMSO-d6) δ ppm 1.21 (3 H, t, J=7.1
A mixture of 14 (5.68 mmol) and thionyl chloride (0.42 ml,
5.76 mmol) in 10 ml of anhydrous 1,2-dichloroethane was
refluxed for 2 hr with the exclusion of moisture. The volatile
materials were evaporated under reduced pressure and the residue
dissolved in 10 ml of anhydrous 1,2-dichloroethane and cooled to
-15 °C. To the magnetically stirred solution the appropriate
aniline (5.71 mmol) was added in one portion, followed by 3 ml
of pyridine after 5 min. The reaction mixture was stirred for 2 hr
and left to warm to room temperature overnight. The reaction
mixture was then washed with dilute HCl, 2% aqueous NaOH
solution, water and then evaporated. The product was purified by
flash chromatography eluting with 1:10 EtOH/1,2-
dichloroethane.
Hz, CH3), 4.15 (2 H, q, J=7.1 Hz, CH2), 4.51 (2 H, s, NCH2),
5.62 (1 H, d, J=7.8 Hz, H-5), 7.62 (1 H, d, J=7.8 Hz, H-6), 11.40
(1 H, br. s., H-3); 13C NMR (100 MHz, DMSO-d6) δ ppm 14.0,
39.1, 39.3, 39.5, 39.7, 39.9, 48.6, 61.2, 101.1, 145.9, 151.0,
163.8, 168.2.
5.2.7. General procedure for the synthesis of 14a-d
A suspension of 13 (0.85 g, 3.66 mmol) and K2CO3 (0.6 g,
4.34 mmol) in anhydrous DMF (8 mL) was stirred at 80 °C for 1
hr. A solution of the appropriate benzyl bromide (3.82 mmol) in
5 ml of DMF was added and the mixture stirred at room
temperature for 24 hr. The reaction mixture was filtered and the
filtrate evaporated. The residual oil was dissolved in 50 ml of
EtOH, then 30 ml of water and LiOH.H2O (0.95 g, 22.64 mmol)
was added. The mixture was magnetically stirred for 5 hr at room
temperature and the resulting clear solution was acidified with
dilute HCl to precipitate the product. After filtration the resulting
5.2.8.1. 2-(3-(3,5-Dimethylbenzyl)-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)-N-phenylacetamide
(15a)

Yield 78%; white crystals; mp 201-202 °C; Rf 0.59 (EtOAc);
1H NMR (400 MHz, DMSO-d6) δ ppm 2.22 (6 H, s, CH3), 4.63
(2 H, s, NCH2), 4.92 (2 H, s, NCH2), 5.81 (1 H, d, J=7.8 Hz, H-
5), 6.87 (3 H, br. s. , H-2’,4’,6’), 7.07 (1 H, t, J=7.3 Hz, H-4”),
7.32 (2 H, t, J=7.8 Hz, H-3”,5”), 7.59 (2 H, d, J=7.9 Hz, H-
2”,6”), 7.73 (1 H, d, J=7.8 Hz, H-6), 10.33 (1 H, s, NH); 13C
NMR (100 MHz, DMSO-d6) δ ppm 20.9, 38.9, 39.1, 39.3, 39.5,
39.7, 39.9, 40.1, 43.3, 51.4, 99.9, 119.1, 123.6, 125.3, 128.6,
128.9, 136.9, 137.3, 138.6, 145.5, 162.6, 165.5. HRESIMS m/z:
calculated for C21H21N3O3 [M+Na]+ 386.1475, found 386.1468.
J=8.9 Hz, H-3”, 5”), 7.61 (2 H, d, J=8.9 Hz, H-2”, 6”), 7.71 (1 H,
d, J=7.8 Hz, H-6), 10.44 (1 H, s, NH); 13C NMR (100 MHz,
DMSO-d6) δ ppm 20.8, 39.1, 39.3, 39.5, 39.7, 39.9, 43.2, 51.4,
99.9, 120.6, 125.2, 127.1, 128.5, 128.7, 136.8, 137.2, 137.5,
145.3, 151.3, 162.4, 165.6. HRESIMS m/z: calculated for
C21H20ClN3O3 [M+Na]+ 420.1085, found 420.1078.
5.2.8.6. 2-(3-(3,5-Dimethylbenzyl)-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)-N-(2,3-
dimethylphenyl)acetamide (15g)
Yield 34%; white crystals; mp 222-224 °C; Rf 0.51 (EtOAc);
1H NMR (400 MHz, DMSO-d6)  ppm 2.07 (3 H, s, CH3), 2.20
(6 H, s, CH3), 2.23 (3 H, s, CH3), 4.63 (2 H, s, NCH2), 4.91 (2 H,
s, NCH2), 5.77 (1 H, d, J=7.8 Hz, H-5), 6.86 (3 H, br. s. , H-
2’,4’,6’), 7.03 (2 H, q, J=7.7 Hz, H-4”,H-5”), 7.11 (1 H, d, J=7.3
Hz, H-6”), 7.71 (1 H, d, J=7.8 Hz, H-6), 9.74 (1 H, s, NH); 13C
NMR (100 MHz, DMSO-d6) δ ppm 14.3, 20.4, 21.2, 39.2, 39.4,
39.7, 39.9, 40.1, 43.6, 51.6, 100.2, 123.6, 125.6, 127.5, 128.9,
137.2, 137.4, 137.6, 145.8, 162.9, 166.1. HRESIMS m/z:
calculated for C23H25N3O3 [M+H]+ 392.1969, found 392.1964;
calculated for C23H25N3O3 [M+Na]+ 414.1788, found 414.1780.
5.2.8.2. 2-(3-(3,5-Dimethylbenzyl)-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)-N-(o-tolyl)acetamide
(15b)
Yield 69%; white crystals; mp 231.5-233 °C; Rf 0.59
(EtOAc); 1H NMR (400 MHz, DMSO-d6)  ppm 2.20 (9 H, br. s.,
CH3), 4.64 (2 H, br. s., NCH2), 4.91 (2 H, br. s., NCH2), 5.77 (1
H, dt, J=7.8, 2.0 Hz, H-5), 6.86 (3 H, br. s. , H-2’,4’,6’), 7.03 -
7.26 (3 H, m, H-3”,4”,5”), 7.37 (1 H, d, J=7.1 Hz, H-6”), 7.70 (1
H, dd, J=5.3, 2.3 Hz, H-6), 9.64 (1 H, br. s., NH); 13C NMR (100
MHz, DMSO-d6) 18.1, 21.2, 39.2, 39.5, 39.7, 39.9, 40.1, 40.3,
43.6, 51.6, 100.2, 125.2, 125.6, 125.8, 126.3, 128.9, 130.7, 132.1,
135.9, 137.2, 137.6, 145.8, 151.7, 162.9, 166.0. HRESIMS m/z:
calculated for C22H23N3O3 [M+Na]+ 400.1632, found 400.1623;
calculated for C22H23N3O3 [M+K]+ 416.1371, found 416.1366.
5.2.8.7. N-(2-Chlorophenyl)-2-(3-(3,5-
dichlorobenzyl)-2,4-dioxo-3,4-dihydropyrimidin-
1(2H)-yl)acetamide (15i)
Yield 68%; white crystals; mp 214-216 °C; Rf 0.68 (EtOAc);
1H NMR (400 MHz, DMSO-d6)  ppm 4.72 (2 H, br. s., NCH2),
4.98 (2 H, s, NCH2), 5.81 (1 H, d, J=8.1 Hz, H-5), 7.18 (1 H, t,
J=7.8 Hz, H-4”), 7.28 (2 H, s, H-2‟,6‟), 7.31 (1 H, t, J=7.7 Hz, H-
5”), 7.45 (1 H, s, H-4‟), 7.48 (1 H, d, J=8.1 Hz, H-2”), 7.73 (1 H,
d, J=8.1 Hz, H-6), 7.75 (1 H, br. d, J=7.8 Hz, H-6”), 9.94 (1 H, s,
NH); 13C NMR (100 MHz, DMSO-d6) 39.3, 39.5, 39.7, 39.9,
40.1, 43.0, 51.7, 100.3, 126.0, 126.6, 126.8, 127.3, 127.8, 129.9,
134.3, 134.6, 141.5, 146.1, 151.7, 162.8. HRESIMS m/z:
calculated for C19H14Cl3N3O3 [M+ Na]+ 459.9993, found
459.9979.
5.2.8.3. 2-(3-(3,5-Dimethylbenzyl)-2,4-dioxo-3,4-
dihydropyrimidin-1(2H)-yl)-N-(2-
methoxyphenyl)acetamide (15c)
Yield 62%; white crystals; mp 197-199 °C; Rf 0.63 (EtOAc);
1H NMR (400 MHz, DMSO-d6) δ ppm 2.22 (6 H, s, CH3), 3.39
(3 H, s, OCH3), 4.73 (2 H, s, NCH2), 4.92 (2 H, s, NCH2), 5.80 (1
H, d, J=7.8 Hz, H-5), 6.84 - 6.95 (4 H, m, H-2’,4’,6’, 3”), 7.02 -
7.15 (2 H, m, H-4”, 6”), 7.73 (1 H, d, J=7.9 Hz, H-6), 7.98 (1 H,
d, J=7.7 Hz, H-5”), 9.64 (1 H, s, NH); 13C NMR (100 MHz,
DMSO-d6) δ ppm 20.9, 39.1, 39.3, 39.5, 39.7, 39.9, 43.3, 51.5,
55.7, 99.9, 111.2, 120.3, 121.5, 124.6, 125.3, 126.9, 128.6, 136.9,
137.3, 145.5, 151.4, 162.6, 165.8. HRESIMS m/z: calculated for
C22H23N3O4 [M+H]+ 394.1761, found 394.1765; calculated for
C22H23N3O4 [M+Na]+ 416.1581, found 416.1575.
5.2.8.8. 2-(3-(3-Bromo-5-methylbenzyl)-2,4-dioxo-
3,4-dihydropyrimidin-1(2H)-yl)-N-(2-
chlorophenyl)acetamide (15j)
Yield 32%; white crystals; mp 216-217.5 °C; Rf 0.71
(EtOAc); H NMR (400 MHz, DMSO-d6)  ppm 2.24 (3 H, s,
5.2.8.4. N-(2-Chlorophenyl)-2-(3-(3,5-
dimethylbenzyl)-2,4-dioxo-3,4-dihydropyrimidin-
1(2H)-yl)acetamide (15d)
1
CH3), 4.71 (2 H, br. s., NCH2), 4.93 (2 H, s, NCH2), 5.80 (1 H, d,
J=7.8 Hz, H-5), 7.07 (1 H, s, H-6„), 7.19 (1 H, t, J=7.7 Hz, H-4“),
7.22 (1 H, br. s. , H-2„), 7.27 (1 H, s, H-4„), 7.31 (1 H, t, J=7.7
Hz, H-5“), 7.49 (1 H, d, J=7.8 Hz, H-3“), 7.73 (1 H, d, J=7.8 Hz,
H-6), 7.73 (1 H, d, J=7.8 Hz, H-6“), 9.94 (1 H, s, NH); 13C NMR
(100 MHz, DMSO-d6) δ ppm 20.9, 39.0, 39.3, 39.5, 39.7, 39.9,
40.1, 40.3, 43.2, 51.6, 100.3, 121.7, 126.0, 126.8, 127.6, 127.8,
129.9, 130.8, 134.6, 139.7, 140.7, 145.9, 151.7, 162.9, 166.5.
HRESIMS m/z: calculated for C20H17BrClN3O3 [M+ H]+
462.0215, found 462.0221.
Yield 44%; white crystals; mp 222.5-224 °C; Rf 0.50
(EtOAc); 1H NMR (400 MHz, DMSO-d6) δ ppm 2.22 (6 H, s,
CH3), 4.74 (2 H, s, NCH2), 4.92 (2 H, s, NCH2), 5.81 (1 H, d,
J=7.8 Hz, H-5), 6.82 - 6.92 (3 H, m, H-2’,4’,6’), 7.20 (1 H, td,
J=7.8, 1.5 Hz, H-3“), 7.33 (1 H, td, J=7.8, 1.5 Hz, H-4“), 7.51 (1
H, dd, J=8.0, 1.4 Hz, H-“6), 7.75 (1 H, d, J=7.8 Hz, H-6), 7.76 (1
H, br. dd, J=7.8, 1.5 Hz, H-5“), 9.95 (1 H, s, NH); 13C NMR (100
MHz, DMSO-d6) δ ppm 20.9, 39.1, 39.3, 39.5, 39.7, 40.0, 43.3,
51.3, 100.0, 125.3, 125.7, 126.4, 127.5, 128.6, 129.6, 134.4,
136.9, 137.3, 145.4, 151.4, 162.5, 166.3. HRESIMS m/z:
calculated for C21H20ClN3O3 [M+H]+ 398.1266, found 398.1256;
calculated for C21H20ClN3O3 [M+Na]+ 420.1085, found
420.1080.
5.2.8.9. N-(2-Chlorophenyl)-2-(3-(naphthalen-1-
ylmethyl)-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-
yl)acetamide (15k)
Yield 74%; white crystals; mp 225-227 °C; Rf 0.68 (EtOAc);
1H NMR (400 MHz, DMSO-d6)  ppm 4.75 (2 H, s, NCH2), 5.48
(2 H, s, NCH2), 5.88 (1 H, d, J=7.8 Hz, H-5), 7.02 (1 H, d, J=7.1
Hz, H-2‟), 7.14 - 7.25 (1 H, m, H-3”), 7.32 (1 H, t, J=7.7 Hz, H-
4”), 7.40 (1 H, t, J=7.7 Hz, H-3‟), 7.49 (1 H, d, J=8.1 Hz, H-6”),
7.52 - 7.64 (2 H, m, H-6‟,H-7‟), 7.72 (1 H, d, J=7.8 Hz, H-5”),
7.81 (1 H, d, J=8.1 Hz, H-4‟), 7.82 (1 H, d, J=7.8 Hz, H-6), 7.95
(1 H, d, J=7.8 Hz, H-5‟), 8.19 (1 H, d, J=8.1 Hz, H-8‟), 9.96 (1
H, s, NH); 13C NMR (100 MHz, DMSO-d6) δ ppm 39.0, 39.2,
5.2.8.5. N-(4-Chlorophenyl)-2-(3-(3,5-
dimethylbenzyl)-2,4-dioxo-3,4-dihydropyrimidin-
1(2H)-yl)acetamide (15f)
Yield 88%; white crystals; mp 247-248.5 °C; Rf 0.51
(EtOAc); 1H NMR (400 MHz, DMSO-d6) δ ppm 2.21 (6 H, br. s,
CH3), 4.62 (2 H, s, NCH2), 4.91 (2 H, s, NCH2), 5.80 (1 H, d,
J=7.9 Hz, H-5), 6.82 - 6.89 (3 H, m, H-2’,4’,6’), 7.37 (2 H, d,

39.5, 39.7, 39.9, 40.1, 40.3, 41.7, 51.6, 100.3, 122.3, 123.4,
125.7, 126.1, 126.3, 126.7, 127.6, 127.8, 128.9, 129.9, 130.7,
132.1, 133.5, 134.6, 146.0, 163.0, 166.5. HRESIMS m/z:
calculated for C23H18ClN3O3 [M+H]+ 420.1109, found 420.1101;
calculated for C23H18ClN3O3 [M+Na]+ 442.0929 found 442.0920.
MgCl2, 13 mM DTT, 100 µM dTTP, pH 8.1). Five µl of RT
enzyme solution, diluted to a suitable concentration in enzyme
dilution buffer (50 mM Tris-HCl, 20% glycerol, 2 mM DTT, pH
7.6), is added. The reactions are incubated at 25°C for 40 minutes
and then stopped by the addition of EDTA (15 mM fc).
Heteroduplexes are then detected by addition of PicoGreen.
Signals are read using an excitation wavelength of 490 nm and
emission detection at 523 nm using a spectrofluorometer
(Safire2, Tecan). To test the activity of compounds against RT, 1
µl of compound in DMSO is added to each well before the
addition of RT enzyme solution. Control wells without
compound contain the same amount of DMSO. Results are
expressed as relative fluorescence i.e. the fluorescence signal of
the reaction mix with compound divided by the signal of the
same reaction mix without compound.
5.2.9. General procedure for the synthesis of 15e, h
To a mixture of 14a (1.64 g, 5.68 mmol) and boric acid (0.07
g, 1.13 mmol) in 50 ml of toluene, the appropriate amine (5.71
mmol) was added in one portion. Heating at reflux was continued
for 20 hr with water being azeotropically removed using a Dean-
Stark trap. After cooling, the reaction mixture was concentrated,
taken up in 1,2-dichloroethane, washed with dilute HCl, 2%
aqueous NaOH solution, water and evaporated. The product was
purified by flash chromatography eluting with 1:10 EtOH/1,2-
dichloroethane.
Inhibitory activity of the compound 15i towards a panel of
RTs bearing the mutations L100I, K103N, V106A, Y181C,
Y188Lor G190A or the double mutant K103N/Y181C was
studied using radioactively-labeled [α-32P]ATP substrate and an
activated DNA as a template-primer complex according to the
previously published procedures.7
5.2.9.1. N-(3-Chlorophenyl)-2-(3-(3,5-
dimethylbenzyl)-2,4-dioxo-3,4-dihydropyrimidin-
1(2H)-yl)acetamide (15e)
Yield 48%; white crystals; mp 214-215.5 °C; Rf 0.69
1
(EtOAc); H NMR (600 MHz, DMSO-d6) δ ppm 2.22 (6 H, s,
CH3), 4.64 (2 H, s, NCH2), 4.92 (2 H, s, NCH2), 5.81 (1 H, d,
J=7.8 Hz, H-5), 6.87 (3 H, s, H-2’,4’,6’), 7.14 (1 H, d, J=7.9 Hz,
H-4”), 7.36 (1 H, t, J=8.0 Hz, H-5”), 7.44 (1 H, d, J=8.0 Hz, H-
6”), 7.73 (1 H, d, J=7.9 Hz, H-6), 7.81 (1 H, s, H-2”), 10.52 (1 H,
s, NH); 13C NMR (100 MHz, DMSO-d6) δ ppm 25.1, 43.4, 43.5,
43.7, 43.8, 43.9, 44.1, 44.2, 47.5, 55.7, 104.2, 121.7, 122.9,
127.5, 129.5, 132.8, 134.8, 137.4, 141.1, 141.4, 144.2, 149.6,
155.6, 166.7, 170.2. HRESIMS m/z: calculated for C22H23N3O3
[M+H]+ 378.1812, found 378.1812; calculated for C22H23N3O3
[M+Na]+ 400.1632, found 400.1624.
5.4. Time-of-addition Experiments
Time-of-addition experiments were adapted from Pauwels et
al.41 and Daelemans et al.42 Briefly, MT-4 cells were infected
with HIV-1(IIIB) or the RT double mutant virus (K103N;Y181C)
at an m.o.i. of 0.5. Following a 1 hour adsorption period cells
were distributed in a 96-well tray at 45,000 cells/well and
incubated at 37 °C. Test compounds were added at different
times (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 24, and 25h) after infection. HIV-
1 production was determined at 31 hr postinfection via a p24
enzyme-linked immunosorbent assay (Perkin Elmer, Brussels,
Belgium). Dextran sulfate was used at 12.5 µM, AZT at 1.9 µM,
nevirapine at 7.5 µM, Compounds 15a-k, except for the inactive
compound 15h were added at their CC50 concentration obtained
in the MT-4/MTT assay.
5.2.9.2. N-Benzyl-2-(3-(3,5-dimethylbenzyl)-2,4-
dioxo-3,4-dihydropyrimidin-1(2H)-yl)acetamide
(15h)
Yield 50%; white crystals; mp 184-185 °C; Rf 0.69 (EtOAc);
1H NMR (400 MHz, DMSO-d6) δ ppm 2.20 (6 H, s, CH3), 4.32
(2 H, d, J=5.6 Hz, CH2), 4.47 (2 H, s, NCH2), 4.90 (2 H, s,
NCH2), 5.76 (1 H, dd, J=7.9, 1.8 Hz, H-5), 6.79 - 6.94 (3 H, m,
H-2’,4’,6’), 7.17 - 7.39 (5 H, m, H-2”, 3”, 4”, 5”, 6”), 7.68 (1 H,
d, J=7.8 Hz, H-6), 8.70 (1 H, t, J=5.4 Hz, NH); 13C NMR (100
MHz, DMSO-d6) δ ppm 21.2, 39.4, 39.6, 39.8, 40.0, 40.3, 42.6,
43.6, 51.2, 100.2, 125.7, 127.2, 127.6, 128.6, 128.9, 137.3, 137.5,
139.3, 145.8, 151.7, 162.9, 167.1. HRESIMS m/z: calculated for
C22H23N3O3 [M+H]+ 378.1812, found 378.1812; calculated for
C22H23N3O3 [M+Na]+ 400.1632, found 400.1624.
5.5. RnaseH assay
The RNaseH assay was developed also employing the dsDNA
quantitation reagent PicoGreen. A RNA/DNA heteroduplex is
formed by annealing a 40 bases long RNA oligonucleotide (5‟-
CCAGCAGGAAACAGCUAUGACGAUCUGAGCCUGGGAG
CU-3‟) and 120 bases long DNA oligonucleotide (5‟-
AGCTCCCAGGCTCAGATCGTCATAGCTGTTTCCTGCTGG
CAGCTCCCAGGCTCAGATCGTCATAGCTGTTTCCTGCTG
GCAGCTCCCAGGCTCAGATCGTCATAGCTGTTTCCTGCT
GGC-3‟) in a 4:1 molar ratio.
5.3. Reverse transcriptase assay
An amount of 76 ng of the annealed complex is brought into
each well of a 96-well plate in a volume of 20 µl RNaseH buffer
(60 mM Tris-HCl, 60 mM KCl, 8 mM MgCl2, 13 mM DTT, pH
8.1) and 5 µl of suitably diluted RT solution is added. Reactions
are stopped after 60 min. at 25 °C by the addition of EDTA (15
mM fc). PicoGreen is then added to measure the amount of
heteroduplexes and thus the decrease in signal upon RNA
hydrolysis in the presence of enzyme activity and signals are read
as described for the reverse transcriptase assay. The results are
expressed relative to the amount of heteroduplexes measured in a
negative control sample without RT enzyme, after subtraction of
the background signal obtained with only ssDNA.
Recombinant wild type p66/p51 HIV-1 RT was expressed and
purified as described by Auwerx et al.39 The RT assay is
performed with the EnzCheck Reverse Transcriptase Assay kit
(Molecular Probes, Invitrogen), as described by the
manufacturer. The assay is based on the dsDNA quantitation
reagent PicoGreen. This reagent shows a pronounced increase in
fluorescence signal upon binding to dsDNA or RNA-DNA
heteroduplexes. Single-stranded nucleic acids generate only
minor fluorescence signal enhancement when a sufficiently high
dye:base pair ratio is applied.40 This condition is met in this
assay.
A poly(rA) template of approximately 350 bases long, and an
oligo(dT)16 primer, are annealed in a molar ratio of 1:1.2 (60
min. at room temperature). Fifty-two ng of the RNA/DNA is
brought into each well of a 96-well plate in a volume of 20 µl
polymerization buffer (60 mM Tris-HCl, 60 mM KCl, 8 mM
To test compounds for activity against RNaseH, 1 µl of
compound in DMSO is added to each well before the addition of
RT enzyme solution. Control wells without compound contain
the same amount of DMSO. Positive compounds were tested for
autofluorescence in a separate test.

13. Sweeney, Z. K.; Kennedy-Smith, J. J.; Wu, J.; Arora, N.;
Billedeau, J. R.; Davidson, J. P.; Fretland, J.; Hang, J. Q.; Heilek,
G. M.; Harris, S. F.; Hirschfeld, D.; Inbar, P.; Javanbakht, H.;
Jernelius, J. A.; Jin, Q.; Li, Y.; Liang, W.; Roetz, R.; Sarma, K.;
Smith, M.; Stefanidis, D.; Su, G.; Suh, J. M.; Villaseñor, A. G.;
Welch, M.; Zhang, F.-J.; Klumpp, K. ChemMedChem 2009, 4,
88–99.
14. Isono, Y.; Sakakibara, N.; Ordonez, P.; Hamasaki, T.; Baba, M.;
Ikejiri, M.; Maruyama, T. Antivir. Chem. Chemother. 2011, 22,
57–65.
15. Novikov, M. S.; Ozerov, A. A. Chem. Heterocycl. Compd. 2005,
41, 905–908.
16. Kelley, J. L.; Baker, B. R. J. Med. Chem. 1982, 25, 600–603.
17. See also synthesis of compound 13.
18. Yamashita, J.; Yamawaki, I.; Ueda, S.; Yasumoto, M.; Unemi, N.;
Hashimoto, S. Chem. Pharm. Bull.. 1982, 30, 4258–67.
19. Yamamoto, I.; Kimura, T.; Tateoka, Y.; Watanabe, K.; Ho, I. K. J.
Med. Chem. 1987, 30, 2227–2231.
20. Farr, R. A.; Bey, P.; Sunkara, P. S.; Lippert, B. J. J. Med. Chem.
1989, 32, 1879–1885.
5.6. Molecular Modeling
All protein structures followed similar preparation procedure
with minimal user intervention. Cognate ligands, co-crystalized
ions and solvent molecules were deleted. All hydrogen atoms
were added. After computing Gasteiger charges non-polar
hydrogen atoms were merged and all atoms were AutoDock-
typed to prepare Vina PDBQT input file. Ligand structures were
processed automatically. Docking simulations were performed
with AutoDock Vina 1.1.2.43 Cubic grid box centered on cognate
ligand was adjusted for each complex to include the entire
concave region around the ligand and the solvent accessible
entrance of the pocket. Only top-score binding poses were used
in subsequent analysis.
Acknowledgments
21. Wang, Y. I. J. Am. Chem. Soc. 1952, 81, 3786–3789.
22. Hutzenlaub, W.; Pfleiderer, W. Liebigs Ann. der Chemie 1979,
1979, 1847–1854.
23. Singh, H.; Aggarwal, P.; Kumar, S. Synthesis. 1990, 520–522.
24. Mylavarapu, R. K.; GCM, K.; Kolla, N.; Veeramalla, R.;
Koilkonda, P.; Bhattacharya, A.; Bandichhor, R. Org. Process
Res. Dev. 2007, 11, 1065–1068.
25. Tang, P. Org. Synth. 2005, 81, 262–272.
26. Bissantz, C.; Kuhn, B.; Stahl, M. J. Med. Chem. 2010, 53, 5061–
84.
27. Buckheit, R.; Watson, K.; Fliakas-Boltz, V.; Russell, J.; Loftus, T.
L.; Osterling, M. C.; Turpin, J. A.; Pallansch, L. A.; White, E. L.;
Lee, J. W.; Lee, S. H.; Oh, J. W.; Kwon, H. S.; Chung, S. G.; Cho,
E. H. Antimicrob. agents Chemother. 2001, 45, 393–400.
28. Buckheit, R. W.; Hartman, T. L.; Watson, K. M.; Kwon, H. S.;
Lee, S. H.; Lee, J. W.; Kang, D. W.; Chung, S. G.; Cho, E. H.
Antivir. Chem. Chemother. 2007, 18, 259–75.
This work was supported by grant of Russian Foundation for
Basic Research (13-04-01391а) and by the KU Leuven
(GOA/15/019/TBA). The technical assistance of Mr. Kris
Uyttersprot, Mrs. Kristien Erven, Mrs. Cindy Heens and Mrs.
Leen Ingels for the HIV experiments and Mrs. Lizette van
Berckelaer for the cytostatic experiments is gratefully
acknowledged.
References and notes
1. Broder, S. Antivir. Res. 2010, 85, 1–18.
2. Rivero, A.; Mira, J. A.; Pineda, J. A. J. Antimicrob. Chemother.
2007, 59, 342–6.
3. Kontorinis, N.; Dieterich, D. T. Semin. Liver Dis. 2003, 23, 173–
82.
29. Mugnaini, C.; Manetti, F.; Esté, J. A.; Clotet-Codina, I.; Maga, G.;
Cancio, R.; Botta, M.; Corelli, F. Bioorg. Med. Chem. Lett. 2006,
16, 3541–4.
30. Das, K.; Clark, A. D.; Lewi, P. J.; Heeres, J.; De Jonge, M. R.;
Koymans, L. M. H.; Vinkers, H. M.; Daeyaert, F.; Ludovici, D.
W.; Kukla, M. J.; De Corte, B.; Kavash, R. W.; Ho, C. Y.; Ye, H.;
Lichtenstein, M. A.; Andries, K.; Pauwels, R.; De Béthune, M.-P.;
Boyer, P. L.; Clark, P.; Hughes, S. H.; Janssen, P. A. J.; Arnold, E.
J. Med. Chem. 2004, 47, 2550–60.
31. Wang, D.-P.; Rizzo, R. C.; Tirado-Rives, J.; Jorgensen, W. L.
Bioorg. Med. Chem. Lett. 2001, 11, 2799–2802.
32. Himmel, D. M.; Das, K.; Clark, A. D.; Hughes, S. H.; Benjahad,
A.; Oumouch, S.; Guillemont, J.; Coupa, S.; Poncelet, A.; Csoka,
I.; Meyer, C.; Andries, K.; Nguyen, C. H.; Grierson, D. S.;
Arnold, E. J. Med. Chem. 2005, 48, 7582–91.
4. Martinez-Picado, J.; DePasquale, M. P.; Kartsonis, N.; Hanna, G.
J.; Wong, J.; Finzi, D.; Rosenberg, E.; Gunthard, H. F.; Sutton, L.;
Savara, A.; Petropoulos, C. J.; Hellmann, N.; Walker, B. D.;
Richman, D. D.; Siliciano, R.; D‟Aquila, R. T. Proc. Natl. Acad.
Sci. 2000, 97, 10948–10953.
5. Wensing, A. M. J.; van de Vijver, D. A.; Angarano, G.; Asjö, B.;
Balotta, C.; Boeri, E.; Camacho, R.; Chaix, M.-L.; Costagliola, D.;
De Luca, A.; Derdelinckx, I.; Grossman, Z.; Hamouda, O.;
Hatzakis, A.; Hemmer, R.; Hoepelman, A.; Horban, A.; Korn, K.;
Kücherer, C.; Leitner, T.; Loveday, C.; MacRae, E.; Maljkovic, I.;
de Mendoza, C.; Meyer, L.; Nielsen, C.; Op de Coul, E. L.;
Ormaasen, V.; Paraskevis, D.; Perrin, L.; Puchhammer-Stöckl, E.;
Ruiz, L.; Salminen, M.; Schmit, J.-C.; Schneider, F.; Schuurman,
R.; Soriano, V.; Stanczak, G.; Stanojevic, M.; Vandamme, A.-M.;
Van Laethem, K.; Violin, M.; Wilbe, K.; Yerly, S.; Zazzi, M.;
Boucher, C. A. J. Infect. Dis. 2005, 192, 958–66.
33. Jorgensen, W. L.; Schyman, P. J. Chem. Theory Comput. 2012, 8,
3895–3901.
34. Rizzo, R. C.; Wang, D.-P.; Tirado-Rives, J.; Jorgensen, W. L. J.
Am. Chem. Soc. 2000, 122, 12898–12900.
6. Durant, J.; Clevenbergh, P.; Schmit, J. C.; Cottalorda, J.; Schapiro,
J. M.; Clavel, F.; Dam, E.; Boulme, R.; Beyou, A.; Dellamonica,
P.; Cua, E. HIV Clin. Trials 2002, 3, 36–44.
35. Woltering, M.; Bischoff, H.; Dittrich-Wengenroth, E.; Heckroth,
H.; Otteneder, M. Indole-phenylsulfonamide derivatives used as
ppar-delta activating compounds. US 2007/0149514 A1, 2007.
36. Sathisha, K. R.; Khanum, S. A.; Chandra, J. N. N. S.; Ayisha, F.;
Balaji, S.; Marathe, G. K.; Gopal, S.; Rangappa, K. S. Bioorg.
Med. Chem. 2011, 19, 211–20.
37. Iizuka, K.; Akahane, K.; Momose, D.; Nakazawa, M.; Tanouchi,
T.; Kawamura, M.; Ohyama, I.; Kajiwara, I.; Iguchi, Y. J. Med.
Chem. 1981, 24, 1139–1148.
7. Novikov, M. S.; Ivanova, O. N.; Ivanov, A. V; Ozerov, A. A;
Valuev-Elliston, V. T.; Temburnikar, K.; Gurskaya, G. V;
Kochetkov, S. N.; Pannecouque, C.; Balzarini, J.; Seley-Radtke,
K. L. Bioorg. Med. Chem. 2011, 19, 5794–802.
8. Novikov, M. S.; Valuev-Elliston, V. T.; Babkov, D. A.;
Paramonova, M. P.; Ivanov, A. V.; Gavryushov, S. A.;
Khandazhinskaya, A. L.; Kochetkov, S. N.; Pannecouque, C.;
Andrei, G.; Snoeck, R.; Balzarini, J.; Seley-Radtke, K. L. Bioorg.
Med. Chem. 2013, 21, 1150–1158.
38. Robins, M. J.; Hatfield, P. W. Can. J. Chem. 1982, 60, 547–553.
39. Auwerx, J. Mol. Pharmacol. 2002, 61, 400–406.
40. Singer, V. L.; Jones, L. J.; Yue, S. T.; Haugland, R. P. Anal.
Biochem. 1997, 249, 228–38.
41. Pauwels, R.; Andries, K.; Desmyter, J.; Schols, D.; Kukla, M. J.;
Breslin, H. J.; Raeymaeckers, A.; Van Gelder, J.; Woestenborghs,
R.; Heykants, J. Nature 1990, 343, 470–4.
42. Daelemans, D.; Pauwels, R.; De Clercq, E.; Pannecouque, C. Nat.
Protoc. 2011, 6, 925–33.
43. Trott, O.; Olson, A. J. J. Comput. Chem. 2010, 31, 455–61.
9. Deeks, S. G. J. Acquir. Immune Defic. Syndr. 2001, 26 Suppl 1,
S25–33.
10. Ren, J.; Chamberlain, P. P.; Stamp, A.; Short, S. A.; Weaver, K.
L.; Romines, K. R.; Hazen, R.; Freeman, A.; Ferris, R. G.;
Andrews, C. W.; Boone, L.; Chan, J. H.; Stammers, D. K. J. Med.
Chem. 2008, 51, 5000–8.
11. Gomez, R.; Jolly, S.; Williams, T.; Tucker, T.; Tynebor, R.;
Vacca, J.; McGaughey, G.; Lai, M.-T.; Felock, P.; Munshi, V.;
DeStefano, D.; Touch, S.; Miller, M.; Yan, Y.; Sanchez, R.;
Liang, Y.; Paton, B.; Wan, B.-L.; Anthony, N. Bioorg. Med.
Chem. Lett. 2011, 21, 7344–50.
12. Zhan, P.; Chen, X.; Li, D.; Fang, Z.; De Clercq, E.; Liu, X. Med.
Res. Rev. 2011.

Supplementary Material
Supplementary data (NMR spectra for all of the synthesized
compounds) associated with this article can be found online.