Optimization of 2-acylaminocycloalkylthiophene derivatives for activity against Staphylococcus aureus RnpA

Article abstract of DOI:10.3390/antibiotics10040369

Staphylococcus aureus is well-recognized to cause debilitating bacterial infections that are difficult to treat due to the emergence of antibiotic resistance. As such, there is a need to develop new antimicrobials for the therapeutic intervention of S. au

Full text of DOI:10.3390/antibiotics10040369

antibiotics
Article
Optimization of 2-Acylaminocycloalkylthiophene Derivatives
for Activity against Staphylococcus aureus RnpA
Michaelle Chojnacki 1, Xufeng Cao 2, Daniel P. Flaherty 2,3,4,
*
and Paul M. Dunman 1,
*
1
Department of Microbiology and Immunology, University of Rochester Medical Center, 601 Elmwood Ave.,
Rochester, NY 14642, USA; Michaelle_Chojnacki@URMC.rochester.edu
Department of Medicinal Chemistry and Molecular Pharmacology, College of Pharmacy, Purdue University
575 Stadium Mall Dr., West Lafayette, IN 47907, USA; cao309@purdue.edu
Purdue Institute for Drug Discovery, 720 Clinic Dr., West Lafayette, IN 47907, USA
Purdue Institute of Inflammation, Immunology and Infectious Disease, 207 South Martin Jischke Dr.,
West Lafayette, IN 47907, USA
2
3
4
*
Correspondence: dflaher@purdue.edu (D.P.F.); Paul_Dunman@URMC.rochester.edu (P.M.D.)
Abstract: Staphylococcus aureus is well-recognized to cause debilitating bacterial infections that
are difficult to treat due to the emergence of antibiotic resistance. As such, there is a need to
develop new antimicrobials for the therapeutic intervention of S. aureus disease. To that end, S.
aureus RnpA is an essential enzyme that is hypothesized to participate in two required cellular
processes, precursor tRNA (ptRNA) maturation and mRNA degradation. Corresponding high
throughput screening campaigns have identified the phenylcarbamoyl cyclic thiopenes as a chemical
class of RnpA inhibitors that display promising antibacterial effects by reducing RnpA ptRNA
and mRNA degradation activities and low human cell toxicity. Herein, we perform a structure
activity relationship study of the chemical scaffold. Results revealed that the cycloalkane ring size
and trifluoroacetamide moiety are required for antibacterial activity, whereas modifications of the
para and/or meta positions of the pharmacophore’s phenyl group allowed tuning of the scaffold’s
antimicrobial performance and RnpA inhibitory activity. The top performing compounds with
respect to antimicrobial activity also did not exhibit cytotoxicity to human cell lines at concentrations
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Citation: Chojnacki, M.; Cao, X.;
Flaherty, D.P.; Dunman, P.M.
Optimization of
2-acylaminocycloalkylthiophene
Derivatives for Activity against
Staphylococcus aureus RnpA.
Antibiotics 2021, 10, 369. https://
doi.org/10.3390/antibiotics10040369
up to 100 µM, greater than 100-fold the minimum inhibitory concentration (MIC). Focused studies of
one analog, RNP0012, which exhibited the most potent antimicrobial and inhibition of cellular RnpA
activities revealed that the compound reduced bacterial burden in a murine model of S. aureus disease.
Taken together, the results presented are expected to provide an early framework for optimization
of next-generation of RnpA inhibitor analogues that may represent progenitors of a new class of
antimicrobials.
Academic Editor: Valentina Straniero
Received: 8 March 2021
Accepted: 27 March 2021
Published: 31 March 2021
Keywords: Staphylococcus aureus; antibiotic; RnpA; mRNA degradation; ptRNA processing
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
1. Introduction
Staphylococcus aureus is an opportunistic pathogen that resides in the nares of 20–
40% of individuals [1,2]. The organism frequently causes disease by exploiting breaches
in cutaneous and/or mucosal barriers that may be caused by skin conditions, wounds,
or surgical intervention. Resulting, S. aureus infections can range in severity from mild
skin and soft tissue infections to invasive keratitis, endocarditis, chronic osteomyelitis,
pneumonia, and/or bacteremia, resulting in significant morbidity and mortality rates as
high as 50% among certain patient populations [3–7]. S. aureus disease is highly prevalent.
Indeed, the most recent Antimicrobial Surveillance SENTRY Program report found that S.
aureus was the most common cause of nosocomial bacteremia in North America, and the
Copyright:
© 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
second most common cause of nosocomial bacteremia in Europe [
the most common cause of infective endocarditis in the U.S. [ 10] and a predominant cause
of ventilator associated pneumonia, which is the most common hospital acquired infection
8]. The organism is also
9,
Antibiotics 2021, 10, 369. https://doi.org/10.3390/antibiotics10040369
https://www.mdpi.com/journal/antibiotics

Antibiotics 2021, 10, 369
2 of 17
in intensive care units world-wide [11
–
15]. Moreover, S. aureus is the leading Gram-
positive pathogen responsible for bacterial keratitis, a condition that leads to approximately
2 million cases of corneal blindness annually worldwide [16,17].
In addition to causing infections frequently, the organism has been exceedingly diffi-
cult to treat due to its extraordinary ability to resist the effects of antibiotics, as exemplified
by the well-documented emergence- and dissemination- of methicillin resistant S. aureus
(MRSA) lineages in both healthcare and community settings [18]. More recently, there
has been increased prevalence of strains that display intermediate and/or complete resis-
tance to vancomycin, an antibiotic that was once considered a last-line of defense [19
Resistance to more contemporary antibiotics such as daptomycin, ceftaroline, and cefto-
biprole have also emerged in recent years [21 24]. As a result of its widespread ability to
,20].
–
resist the effects of antibiotics, S. aureus has been designated as one of the six E.S.K.A.P.E.
(Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter bauman-
nii, Pseudomonas aeruginosa, and Enterobacter spp.) bacterial pathogens of immediate U.S.
healthcare concern and for which novel antibiotics are urgently needed [25].
S. aureus RnpA is an essential protein that is hypothesized to participate in two re-
quired cellular processes, translation and mRNA degradation. Indeed, it is well established
that RnpA complexes with the ribozyme rnpB to form RNase P enzymes that catalyze the
removal of 50 leader sequences of precursor tRNA (ptRNA) molecules thereby generating
mature tRNAs needed for translation [26,27]. More recently, S. aureus RnpA has also been
found to catalyze the digestion of messenger RNA (mRNA) in vitro in the absence of
rnpB [28]. Moreover, the protein has been shown to be a component of the organism’s
RNA degradosome holoenzyme complex that is thought to modulate cellular mRNA
turnover [29,30] and the protein has been structurally characterized [31]. Thus, RnpA
may represent a promising novel antimicrobial target that is required for two essential
cellular processes and, hence, may provide opportunity to identify small molecule in-
hibitors of one or both of these essential functions. Accordingly, we previously developed
a whole-cell high-throughput mupirocin synergy-based screening approach to screen and
simultaneously enrich for library members that display RnpA-associated antibacterial
effects [32]. Using this method, several chemical classes of S. aureus RnpA inhibitors
have been identified and/or characterized, including the aminoglycoside neomycin sul-
fate [32], RNPA1000 [28], RNPA2000 [33], and the recently identified JC and JR series of
compounds [34] (Figure 1).
RNP1000
RNP2000
JC1
JR1
S. aureus MIC = 34–69 µM
MIC = 24–48 µM
MIC = 3.4 µM
MIC = 1.25 µM
Figure 1. Previously reported RnpA inhibitors with antimicrobial activity against S. aureus.
With regard to the JR chemical class of phenylcarbamoyl cycloalkylthiopene RnpA
inhibitors, members of this chemical class have been established to display potent RnpA-
dependent anti-staphylococcal activities and limited or no detectable human cell cyto-
toxicity [34]. Early structure-activity relationship (SAR) studies designed to probe the
pharmacophore’s phenyl moiety established that variations in the ring are tolerated for
anti-staphylococcal activity and primarily affected RnpA’s ptRNA processing function.
Herein, we describe results of expanded SAR studies that are designed to further evaluate
the scaffold for RnpA inhibitory and anti-staphylococcal activities.

Antibiotics 2021, 10, 369
3 of 17
2. Results
2.1. Chemistry
The molecules were all synthesized using a procedure similar to one reported by
Truong et al. [35] As shown in Scheme 1, the first step was to use substituted aniline
reagents to form a set of substituted-cyanoacetamide intermediates 1a–f. These were then
coupled with a cyclic ketone as part of a Knoevenagel condensation reaction to form
intermediates 3a–j. The Knoevenagel products were carried directly into a cyclization
step using octasulfur and morpholine to produce 2-aminothiophene intermediates 4a–j.
The 2-aminothiophenes were finally coupled with either trifluoroacetic anhydride or a
fluoroacetic acid reagent to yield the final compounds RNP0007–RNP0018 to be used in
the antimicrobial and in vitro assays.
a
c
d or e
b
+
+
1a–f
2a, n = 3
2b, n = 4
3a–j
4a–j
RNP0007–0018
Scheme 1. Synthesis of RnpA inhibitor analogs RNP0007-0018. Reagents and conditions: (a) R1-substituted aniline (1 eq),
2-cyanoacetic acid (1 eq), EDC-HCl (1.2 eq), DCM, rt, overnight; (b) 1a–f (1 eq), 2a or b (7 eq), NH4OAc (5 eq), AcOH
(7 eq), Na2SO4 (5 eq), toluene, 100 ◦C, 2 h; (c) 3a–j (1 eq), S8 (2 eq), morpholine (3 eq), EtOH, reflux, 4 h; (d) for analogs
RNP0007–0016: 4a-j (1 eq), trifluoroaceticanhydride (1.2 eq), triethylamine (1.2 eq), DCM, rt, overnight; (e) for analogs
RNP0017–0018: 4a (1 eq), R2-CO2H (1.2 eq), EDC-HCl (1.25 eq), 4-DMAP (0.1 eq), rt, overnight.
2.2. Antimicrobial Structure-Activity Relationship of 2-acylcycloalkylthiophene Analogs
Analogs were first assessed for antimicrobial activity against S. aureus strain UAMS-1
to understand the SAR for the scaffold as it pertains to antimicrobial activity (Table 1). As
previously reported, minimum inhibitory concentration (MIC) testing revealed molecule
JR1 exhibited single-digit micromolar antimicrobial activity (MIC = 1.25
SAR was probed on the phenyl ring at R1. Moving the chlorine atom from the para- to
the meta-position improved antimicrobial activity by approximately threefold to 0.391
for RNP0007. Swapping out the chlorine for a fluorine in RNP0008 provided no change
in activity as the MIC value remained at 0.391 M. The preference for the 3-substituted
µM). [34] First,
µM
µ
halogen was reiterated by the fluorine analogs as the 4-F derivative was slightly less potent.
Switching from a single halogen on the phenyl ring to a methyl (RNP0010) actually
reduced activity by eightfold to an MIC value of 3.215
RNP0008. Interestingly, the activity was restored when the methyl was converted to the
trifluoromethyl derivative in RNP0011 with an MIC value of 0.391 M. To round out the
µM compared to the 3-F counterpart,
µ
SAR study on the phenyl group, the CF3-substituent was moved to the para-position in
RNP0012 and proved to be more potent than the meta-substituted nearest neighbor analog
with an MIC of 0.19 µM.
The next four analogs investigated the role of the cycloalkane ring size on anti-
staphylococcal activity. In these molecules the cycloalkane ring was contracted from
a seven-membered ring to a six-membered ring. Across the board these six-membered ring
analogs displayed a significant reduction of antimicrobial activity compared to the seven-
membered ring matched molecular pairs. For example, the 4-CF3 containing six-membered
cycloalkyl thiophene derivative RNP0015 was fourfold less potent than the corresponding
seven-membered ring counterpart RNP0012. The same reduced activity based on ring size
was more prominent for the fluorophenyl analogs as both the six-membered cycloalkyl ring
containing molecules only exhibited MIC values of 6.25
ring derivatives had MIC values as low as 0.391 M (RNP0008). Thus, it was clear among
this analog set that ring contraction was detrimental to antimicrobial activity regardless
µM, while the seven-membered
µ

Antibiotics 2021, 10, 369
4 of 17
of the substituent at R1. However, the SAR trend observed for the phenyl substitution
with the seven-membered cycloalkyl ring did carry over to the six-membered ring analogs.
This is illustrated by the fact that the 4-CF3 version at R1 was the most potent among each
cohort lending further confidence the observed SAR was indeed tractable.
Table 1. Antimicrobial activity of analogs against S. aureus.
Compound
RNPA2000
JR1 a
R1
-
R2
-
n
-
MIC (µM)
44
MIC (µg/mL)
15
4-Cl
3-Cl
3-F
CF3
CF3
CF3
CF3
CF3
CF3
CF3
CF3
CF3
CF3
CF3
CHF2
CH2F
4
4
4
4
4
4
4
3
3
3
3
4
4
1.25
0.52
RNP0007
RNP0008
RNP0009
RNP0010
RNP0011
RNP0012
RNP0013
RNP0014
RNP0015
RNP0016
RNP0017
RNP0018
0.391
0.391
0.78
0.16
0.16
4-F
0.32
3-CH3
3-CF3
4-CF3
3-F
3.125
0.391
0.19
1.24
0.18
0.086
2.4
6.25
4-F
6.25
2.4
4-CF3
3-CF3
3-Cl
3-Cl
0.78
0.34
3.125
>500
>500
1.36
>200
>200
All minimum inhibitory concentration (MIC) values determined using S. aureus strain UAMS-1, a Values reported
by Colquhoun et al. [34].
Finally, modifications to the trifluoroacetamide moiety on the 2-amine of the thiophene
were explored. The trifluoroacetamide is actually a common protective group for amine
functional groups and can be labile under both low and high pH conditions. However, the
stability at the low pH condition, i.e., pH
≤
1, requires high heat to cleave the amide bond.
Thus, even though it has been reported that the trifluoracetamide to be stable under normal
physiological conditions [35] we sought to assess analogs that systematically removed
fluorine atoms. To this end we found that any modification to the trifluoroacetamide
functional group, both the di- and mono-fluoroderivatives (RNP0017 and RNP0018 respec-
tively), were completely inactive against S. aureus at concentrations up to 500 µM. This
result is consistent with analogs from our previous manuscript on the scaffold in which the
trifluoroacetamide was replaced with either an acetamide or the 2-aminothiophene was
left unsubstituted and both analogs also displayed significantly reduced activity against
S. aureus [34]. Combined these analogs all highlight that the trifluoroacetamide appears to
be critical to the antimicrobial activity observed for the scaffold.
To summarize, for single halogen substitution at R1 the molecules preferred 3-substition
for enhanced antimicrobial activity over the 4-position. However, this trend was flipped
when the larger trifluoromethyl moiety was appended to R1 as the 4-position was preferred.

Antibiotics 2021, 10, 369
5 of 17
Cycloalkyl ring size off the thiophene also heavily affected antimicrobial activity with
the seven-membered ring being the most effective. Finally, the trifluoroacetamide was
shown to be critical for antimicrobial activity consistent with our previous findings. The
most potent analog of the set was RNP0012 with an MIC = 0.19 µM, which contained
a seven-membered cycloalkyl ring and R1 = 4-CF3. This molecule represents a 6.6-fold
improvement over the previous best in this class JR1. It also is more effective than the
previously reported RNPA2000, [33
RnpA inhibitors.
,36] which represents a different chemical series of
2.3. In Vitro RNA Metabolism Activity for Analogs
To assess whether improvements and/or reductions in each analog’s antibacterial
performance were associated with RnpA inhibitor activity, in vitro RnpA mRNA degra-
dation assays were performed in the presence and absence of each analog, as previously
described [33,34].
2.3.1. In Vitro mRNA Degradation Activity
As shown in Figure 2A for representative analogs, a time course study revealed that
while RnpA efficiently degraded the RNA substrate in reactions performed in presence of
DMSO (squares) reactions performed in the presence of 50 µM of either of the compounds
RNP0007, 8, 12, or 14 displayed varying degrees of RNA degradation inhibition. Subse-
quent dose-response assays for each analog to determine the IC50 value provided further
resolution of the inhibitory effects of each compound (Table 2). Results revealed that com-
pounds RNP0007, 8, 9, and 10, which displayed excellent anti-staphylococcal activity, were
the least effective at inhibiting RnpA-mediated RNA degradation, raising the possibility
that their antibacterial effects could be modulated by the inhibition of RnpA-depended
ptRNA processing or by affecting another cellular target(s). In contrast, RNP0014 which
exhibited reduced antibacterial activity in comparison to the parent (JR1), displayed the
lowest IC50 and was the strongest inhibitor of RNA degradation. Compounds RNP0017
and 18 exhibited excellent in vitro RnpA RNA degradation activity (IC50 values of 43
and 33 M, respectively), despite having no detectable antibacterial activity, suggesting
perhaps an inability of the compounds to gain entry to the cell. The remaining compounds
had generally good inhibitory activity, with IC50 values ranging from 43 to 68 M, yet the
µM
µ
µ
overarching trend from these studies was that while alterations of the three regions of the
scaffold affect the series antimicrobial activity the changes do not correlate strongly with
an inhibition of RnpA in vitro RNA degradation function.
Figure 2. Representative RNP analog inhibition of in vitro RnpA-mediated RNA degradation (
A
) or ptRNATyr processing
µM of compound was incubated with RnpA in the presence of the FRET RNA substrate
(
B
). Panel A. DMSO (ꢀꢁ) or 50
◦
for 30 min at 37 C. Fluorescence measurements (RFUs) were collected every 2 min at excitation 490 nm, emission 520 nm.
The negative control (
#
) with no protein ensures the absence of contaminating nucleases. Panel B. 0, 50, 250, or 500
µ
M
RNP0012 was incubated with 10 pmol RNase P and ptRNATyr for 30 min at 37 C and conversion of ptRNA to tRNA was
evaluated by urea-PAGE; migration of tRNATyr and ptRNATyr are shown.
◦

Antibiotics 2021, 10, 369
6 of 17
Table 2. MIC and in vitro inhibition values for RNA metabolism.
Compound
RNPA2000
JR1 a
MIC (µM)
44
mRNA IC50 (µM)
ptRNA IC50 (µM)
130
50
130
7
1.25
RNP0007
RNP0008
RNP0009
RNP0010
RNP0011
RNP0012
RNP0013
RNP0014
RNP0015
RNP0016
RNP0017
RNP0018
0.391
0.391
0.78
175
245
>250
224
59
98
78
79
3.125
0.391
0.19
70
57
68
66
6.25
50
95
6.25
6.4
43
138
46
0.78
3.125
>500
>500
45
52
43
>250
58
33
a
Values reported by Colquhoun et al. [34].
2.3.2. In Vitro RnpA ptRNA Processing Activity of Analogs
Next, we evaluated each analog’s ability to limit the RnpA’s in vitro precursor tRNA
processing activity, as previously described [33]. To do so, RNase P (RnpA + rnpB) was
reconstituted and combined with ptRNATyr and the proteins ability to facilitate the conver-
sion of precursor tRNATyr to mature tRNATyr was measured in the absence and presence
of increasing concentrations of each compound. Figure 2B shows representative data of
the performance of RNP0012 in which increasing concentrations of the analog reduced
conversion of precursor tRNA to mature tRNA in a dose dependent manner. All analogs
were tested at least twice and their average IC50 values were recorded (Table 2). Compound
RNP0015, which displayed improved antibacterial performance in comparison to JR1,
exhibited the greatest inhibitory activity (IC50 value), whereas compounds RNP007, 14, and
17, all displayed weaker ptRNA processing inhibition in the range of >95 µM. Compound
RNP0017, which did not appear to display any inhibition of ptRNA processing also did
not exhibit any antibacterial activity. Likewise, RNP0014, which also displayed reduced
antibacterial activity in comparison to JR1, exhibited weak effects on RnpA-mediated
ptRNA processing despite having excellent inhibition of mRNA degradation activity. The
remaining compounds RNP0008, 9, 10, 11, 12, 16 and 18 had moderate inhibitory effects
in vitro, ranging in IC50 values between 52 and 79 µM.
Taken together results of in vitro mRNA degradation and ptRNA processing revealed
that analogs RNP0011, 12, 13, 15, 16, and 18 all had good inhibitory properties of both
functions and RNP0007 weakly inhibited both activities. RNP0008, 9, and 10 only inhibited
the ptRNA processing function, whereas 13, 14, and 17 had weak or no inhibitory activity
towards RnpA-mediated ptRNA processing. RNP0017 and 18 exhibited inhibitory activity
of RnpA mRNA activity in vitro but had no detectable antibacterial activity in the whole
cell MIC testing, suggesting that the trifluoroacetamide moiety may be important for cell
entry or inhibition of a second unknown target. Ultimately, for this class there was limited
correlation between either in vitro assay or the antimicrobial activity.
2.4. Activity of RnpA Inhibitors on RNA Metabolism in Cellular Environment
Given that there was limited correlation between the in vitro RNA processing experi-
ments and the antimicrobial properties of the molecules we reasoned that there may be
disparities between how the in vitro assays represent the in cellulo properties of enzymes

Antibiotics 2021, 10, 369
7 of 17
as they relate to the chemical class. To investigate this possibility we performed bacterial
cell-based assays of RnpA mediated mRNA degradation and ptRNA processing for each
analog, as previously described [34].
2.4.1. Mupirocin Synergy Activity of Each Analog
As a first step toward evaluating the cellular RnpA inhibitory activity of each analog,
we returned to our mupirocin synergy screening assay to assess whether each compound
displays synergy with mupirocin. The premise for this assay is that antimicrobial com-
pounds, such as sulfonamides and trimethoprim, that inhibit independent steps in an
essential pathway often display improved antibacterial activity in combination [37,38]. In
that regard, the antibiotic mupirocin inhibits isoleucyl tRNA synthetase upstream of RnpA-
dependent RNase P in the translation pathway and previous studies have revealed that
RnpA inhibitors are additive/synergistic in combination with mupirocin [32,34]. Fractional
inhibitory concentration (FIC) testing revealed that, as expected, most analogs exhibited
either additive (RNP0007-13 and 16) or synergistic (RNP0014) antimicrobial effects, with
FIC index values falling between 0.5 and 1 (Table 3), suggesting the antimicrobial effects
observed may be RnpA dependent. Importantly, none of the analogs exhibited synergistic
activity in combination with antibiotics targeting other cellular pathways (data not shown).
Table 3. Fractional inhibitory concentration (FIC) testing of analogs with mupirocin against S. aureus
UAMS-1.
Dosed-Individually
Cpd MIC a Mup MIC a
0.391 0.5
Dosed-Combination
Cpd MIC a Mup MIC a
0.098 0.25
FIC Index b
RNP0007
RNP0008
RNP0009
RNP0010
RNP0011
RNP0012
RNP0013
RNP0014
RNP0015
RNP0016
RNP0017
0.75
1
0.391
0.78
0.5
0.5
0.5
0.5
0.5
0.5
0.5
0.5
0.5
0.5
0.5
0.196
0.196
0.78
0.098
0.048
1.56
1.56
0.78
1.56
-
0.25
0.25
0.25
0.25
0.25
0.25
0.125
0.25
0.25
-
0.75
0.75
0.75
0.75
0.75
0.5
1.5
1
3.125
0.391
0.19
6.25
6.25
0.78
3.125
>500
>500
-
RNP0018
-
-
-
a
MIC values shown in
µ
M. b FIC was calculated based on the formula summarized in the materials and methods.
FIC
≤
0.5 indicates synergistic activity, a value of 0.5 < FIC
≤
1 indicates additive effect, a value between 1 and 4
indicated neutral effect and FIC greater than 4 indicated antagonism. .
2.4.2. Inhibition of Intracellular mRNA Turnover
As a more direct measure of whether the antimicrobial effects were RnpA-dependent,
studies were performed to measure their inhibition of cellular RnpA-mediated mRNA
turnover of spa mRNA. The spa mRNA is a natural substrate of RnpA mRNA degradation,
as previously described [28,33,34], and can be utilized for an intracellular readout of
inhibition for RnpA-mediated mRNA turnover. To do so, S. aureus cells were treated with a
sub-inhibitory concentration of compound (0.5X MIC) then challenged with the antibiotic
rifampicin to arrest de novo RNA synthesis. Quantitative RT-PCR was used to measure the
cellular titers of spa mRNA at 0 and 5 min post-transcriptional arrest. As shown in Figure 3
(left) cells treated with DMSO (negative control) rapidly degraded spa mRNA within 5 min
of transcriptional arrest, whereas cells treated with RNPA2000 (positive control) displayed
reduced cellular mRNA degradation. The majority of the analogs inhibited cellular mRNA

Antibiotics 2021, 10, 369
8 of 17
turnover compared to DMSO control, with RNP0014 and RNP0016 being the strongest
stabilizers of mRNA. RNP0008 and 9 were the weakest inhibitors of cellular RNA turnover,
which was also observed in vitro (Table 2). Surprisingly, RNP0010 was a strong inhibitor of
cellular mRNA turnover despite having weak inhibitory activity in vitro. RNP0011 and 12
were moderate inhibitors of RnpA-mediated RNA turnover.
Figure 3. Quantitative RT-PCR measures of spa transcript turnover (left) and ptRNATyr accumulation (right) in S.aureus
UAMS-1 cells treated with DMSO, JR analogs or RNPA2000 (positive control). For spa RNA turnover measures, cells were
treated with 0.5X MIC of each compound for 30 min prior to transcriptional arrest. For ptRNATyr accumulation studies,
cells were treated 0.5X for 1 h. Each compound was evaluated twice, and values averaged. * p-value < 0.05, ** p-value < 0.01,
*** p-value < 0.0001 (Two-way ANOVA).
2.4.3. Inhibition of Intracellular prRNA Processing
To evaluate the effects of each analog on cellular RnpA-mediated ptRNA processing, S.
aureus cells were treated with a sub-inhibitory concentration of each analog (0.5X MIC) and
qRT-PCR was used to measure ptRNATyr accumulation, as previously described [33
,34]. As
shown in Figure 3 (right), DMSO-treated cells did not accumulate ptRNATyr, while treatment
with the positive control, RNPA2000, resulted in an increase in ptRNATyr accumulation, as
expected. Compounds RNP0007, 11,13, 14, 15, and 16 had little effect on ptRNATyr levels in
the cellular context. The largest increases in ptRNATyr levels were measured in cells treated
with compounds RNP0008, 9, 10, and 12, all of which were considered highest priority analogs
as they displayed both in vitro inhibitory activity and antimicrobial activity.
Taken together, all of the analogs evaluated displayed inhibitory activity against one or
both RnpA-mediated RNA metabolism functions. It was observed that RNP0012 exhibited
the greatest combinatory effect against each process, and this translated to this molecule
displaying the greatest antimicrobial potency against S. aureus.
2.5. Evaluation of Analogs for Cytotoxicity on Human Cells
For the scaffold to have translational significance, it must be non-toxic to human cells.
Accordingly, an initial assessment of toxicity was performed using human liver epithelial
(HEP G2) cells via a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
assay in the presence of up to 400 µM of each analog. Figure 4 provides representative
viability data from the series of analogs that displayed the greatest antimicrobial and
cellular RnpA inhibition, whereas data for all analogs is provided in Table S1. Mitomycin
C was used as a positive control at 400 µM, which resulted in a decrease to 54.8% viability
(Table S1). Viability of 70% was used as the cut-off criteria for toxicity (Figure 4, dashed
line), according to ISO guidelines, as described in Materials and Methods.

Antibiotics 2021, 10, 369
9 of 17
Figure 4. Effects of prioritized compounds on human cell viability. RNP0008 (black), RNP0009
(white), RNP0010 (grey), and RNP0012 (checkered) were added to HEPG2 cells in increasing concen-
trations (x-axis). The dashed line represents the lower limit of tolerable cell viability, below which
compounds are considered to have toxic effects. Values are an average of two experiments performed
in triplicate.
Of the prioritized molecules, RNP008, 9, and 10 did not exhibit toxicity that was
beyond the 70% cut-off criteria at concentrations lower than 50 µM. RNP0012 displayed 68%
viability against HEP G2 cells at this dose, which is 263-fold above the MIC against S. aureus
for this analog. Survey of all of the analogs (Table S1) revealed that most compounds were
only moderately toxic at 50
cells. RNP0013 displayed the greatest toxicity at 52.9% cell viability at the highest doses of
200 and 400 M. Taken together, these data indicate that the molecules are non-toxic at the
µM with viability ranging from 70 to 93% compared to untreated
µ
reported MICs, and generally have low toxicity at concentrations up to 400 µM.
2.6. Evaluation of RNP0012 Efficacy in a Murine Model of Bacterial Keratitis
Finally, in a pilot study to assess the therapeutic potential of the chemical series RNP0012
was selected for in vivo efficacy in a murine keratitis model of S. aureus infection [39] be-
cause the analog displayed the combination of the most potent anti-staphylococcal activity,
low toxicity, and ability to inhibit both RnpA-mediated cellular functions within bacterial
cells. Corneal infections were induced by inoculating corneal scratches with S. aureus, eyes
were treated with RNP0012 6 h later and every 6 h thereafter for 48 h and bacterial burden
was enumerated. Mice treated with RNP0012 displayed a 1.2-log CFU reduction in com-
parison to vehicle treated animals (Figure 5). While the reduction observed in this pilot
study was not considered statistically different (t-test), the promising trend indicates that
RNP0012 formulation and/or dosing optimization may lead to a new strategy for treating
S. aureus keratitis.
107
106
105
104
103
102
Figure 5. Efficacy of RNP0012 in a murine model of bacterial keratitis. Corneal scratches were
inoculated with 107 CFU mL−1 UAMS-1 and dosed with PBS (n = 10) or 50
every 6 h for 48 h.
µM RNP0012 (n = 9)

Antibiotics 2021, 10, 369
10 of 17
3. Discussion
S. aureus is well-recognized for its ability to cause severe bacterial infections that lead
to high rates of morbidity and mortality. While historically considered an opportunis-
tic nosocomial pathogen, the recent emergence of hypervirulent strains that are capable
of causing community-associated infections combined with the organism’s ability to re-
sist front-line antibiotics and nonsensical outright elimination of most pharmaceutical
antibacterial development groups have further exacerbated healthcare concern.
To that end, one of our major goals has been to explore the therapeutic promise
of strategies that are designed to exploit S. aureus RnpA for antimicrobial development
purposes. The premise for doing so is that the protein is hypothesized to be a unique
antibacterial target that is required for two essential cellular processes, ptRNA processing
and mRNA degradation [33]. As such, it is possible, even likely, that resistance to cor-
responding RnpA inhibitors may be slow to develop as target site mutations that limit
inhibitor binding may be tolerated by one of the protein’s activities but limit the other.
Moreover, the development of such antimicrobials may be accelerated from the perspective
that they may achieve therapeutic antimicrobial efficacy as a function of synergy associated
with partially crippling two cellular activities as opposed to requiring the laborious task of
developing exquisite inhibitors of a “single” target molecule to achieve efficacy.
Accordingly, small molecule inhibitors of S. aureus RnpA-associated mRNA degrada-
tion (RNPA1000), ptRNA processing (neomycin) and both functions (RNPA2000) have been
identified [28,32,33]. In keeping with the dual essentiality hypothesis and desire to develop
compounds that effect both RnpA mRNA and ptRNA processing activities, medicinal
chemistry campaigns designed to explore RNPA20000s therapeutic promise and reduce
the scaffold’s chemical liabilities have revealed that while one can successfully modify
the chemical series furan moiety, eliminating its central thiourea group results in a loss of
RnpA inhibition and anti-staphylococcal activity, reducing enthusiasm for the scaffold’s
development [36]. More recently, two additional chemical scaffolds, JC and JR1, have been
identified has potent RnpA inhibitors with excellent antibacterial activity [34]. The goal
of the current study was to perform an early JR1 structure activity relationship. To do
so, 12 analogs were synthesized to probe the scaffold’s phenyl ring, cycloalkane ring size,
and trifluoroacetamide moieties, with each compound evaluated for antimicrobial activity,
mammalian cytotoxicity, in vitro and cellular RnpA-dependent ptRNA and mRNA effects.
From these studies, SAR was further developed for the 2-acylaminocycloalkylthiophene
scaffold that will help guide optimization of future next-generation analogs. More directly,
results revealed that the seven membered cycloalkane ring size is important, as restriction
to a six-membered ring significantly reduced antimicrobial activity. Indeed, comparisons of
matched molecular pairs revealed that reducing the ring size limited antimicrobial activity
between 4- and 16-fold. In vitro assays revealed that the reduced ring size compounds ap-
peared to retain, or improve, RnpA inhibitory activity of some compounds, suggesting that
the enhanced antibacterial activity of the seven-membered ring is attributable to bacterial
compound entry and/or intracellular stability and exemplifies the importance of cell-based
assays in establishing a SAR. Similarly, results also revealed that the trifluoracetamide
moiety is required for antimicrobial activity, as any modifications to this group appeared
to completely eliminate bacterial activity, which is consistent with our previous finding
that its removal radically reduced antibacterial performance [34]. Exploration of the scaf-
fold’s phenyl ring revealed RnpA dependent antimicrobial tunability. Here, changes of the
para-Cl to F improved antimicrobial activity, which was further enhanced by switching
to a trifluoromethyl group, resulting in compound RNP0012 with a 6.6-fold increase in
anti-staphylococcal activity (MIC 0.19 µM). Modifications of the meta position also were
well tolerated, suggesting that future exploration of the scaffold’s meta- and para- positions,
both alone and in conjunction, are warranted.
In addition to excellent antimicrobial activity, RNP0012 exhibited little mammalian
cytotoxicity (therapeutic index of ~260) and displayed among the highest inhibition of
in vitro RnpA mediated mRNA degradation and ptRNA processing activities. Likewise, it

Antibiotics 2021, 10, 369
11 of 17
was a top performer in cellular assays of RnpA-dependent mRNA degradation and ptRNA
processing. More specifically, RNP0012 was additive in combination with mupirocin, but
not other antibiotics, providing an initial indication that the compound’s antimicrobial
activity is RnpA-dependent. Indeed, the compound significantly reduced RnpA-associated
mRNA degradation within S. aureus cells and was the top-performing cellular ptRNA
processing inhibitor among all analogs evaluated. For these reasons we focused our
attention on using RNP0012 in a pilot study of the scaffold’s therapeutic usefulness.
S. aureus is a predominant cause of bacterial keratitis, which is an invasive infection of
the cornea and contributes to approximately 2 million worldwide cases of blindness annu-
ally [17]. A corresponding S. aureus keratitis model has been developed in our laboratories
that allows an early indication of antibiotic efficacy in the absence of complicating factors
such as PK/PD associated with more traditional systemic models of delivery [39]. In a pilot
study using this model we found that scratched murine corneas inoculated with S. aureus
show a 1.2 log reduction in bacterial burden in comparison to vehicle treated animals.
While the treatment did not reach statistical significance, the trend certainly indicates
that the reduction in bacterial burden can be further enhanced by higher concentration,
more frequent dosing, or a refined/optimized RNP0012 next-generation analog or formula-
tion. Consequently, the 2-acylaminocycloalkylthiophene chemical series may represent a
promising new class of RnpA targeting antimicrobials worthy of further exploration.
4. Materials and Methods
4.1. Chemistry
General Experimental
1H, 13C, and 19F NMR spectra were recorded on Bruker DRX500 or ARX-800 spec-
trometers in [D6] DMSO or CDCl3 with or without the internal standard of TMS at 0.05 or
0.1% v/v. The purity of all final compounds was >95% purity as assessed by HPLC. Final
compounds were analyzed on an Agilent 1200 series chromatograph. The chromatographic
methods used were either (A) ThermoScientific Hypersil GOLD C18 column (3
µM particle
size, 150 mm length, 4.6 mm ID) or (B) ThermoScientific Hypersil GOLD C18 column (3
µM
particle size, 250 mm length, 4.6 mm ID). UV detection wavelength = 254 nm; flow rate =
1.0 mL min−1; solvents: (A) water (0.1% trifluoroacetic acid v/v) and (B) acetonitrile (0.1%
trifluoroacetic acid v/v). Gradient: 5–95% solvent B over 9 min [40]. The mass spectrometer
used is an Advion CMS-L Compact Mass Spectrometer with an ESI or an APCI ionization
source. Samples are submitted for analysis using either the atmospheric solids analysis
probe (ASAP) or flow injection analysis (FIA). Compounds were prepared according to the
following protocols and are detailed in the Supplementary Material.
4.2. Biological Evaluation
4.2.1. Bacterial Growth Conditions
Staphylococcus aureus strains UAMS-1 is a well-characterized antibiotic susceptible
osteomyelitis clinical isolate (Blevins Infect. Immun 2003). For experiments, UAMS-1 was
cultured in Mueller Hinton (MH) broth and processed as described below. Escherichia coli
strain BL21 (DE3) was cultured in Luria–Bertani (LB) and supplemented with ampicillin
(50 µg ml−1) where indicated.
4.2.2. Antimicrobial Susceptibility Testing
Minimum inhibitory concentration (MIC) was performed according to the Clinical
and Laboratory Standards Institute (CLSI) guidelines. Briefly, individual wells of a 96-well
microtiter plate were inoculated with 104 colony forming units (CFU) of S. aureus UAMS-1
containing two-fold increasing concentrations (0
µ
M to 100
µ
M) of the indicated antibiotic
◦
or putative RnpA inhibitor and grown at 37 C for 16 h in MH broth. The MIC was defined
as the lowest concentration of compound in which there was no visible bacterial growth
detected by the unaided eye.

Antibiotics 2021, 10, 369
12 of 17
Fractional inhibitory concentration (FIC) testing was performed, as previously de-
scribed [41]. Briefly, each well of a 96-well microtiter plate was inoculated with 104 CFU of
S. aureus UAMS-1 [42]. Each row of the plate was supplemented with two-fold increasing
concentrations of mupirocin (0
µ µ
g mL−1 to 2 g mL−1) whereas each column contained
two-fold increasing concentrations of putative RnpA inhibitor compound (0.03, 0.0625,
0.125, 0.25, 0.5, 1, or 2
×
MIC). Following bacterial inoculation, plates were incubated at
◦
37 C for 16 h in MH broth and the MIC was determined by the unaided eye. The FIC index
was defined by the following formula: FIC = (MIC of Drug A in Combination/MIC of
Drug A Alone) + (MIC of Drug B in Combination/MIC of Drug B Alone). A synergistic in-
teraction was defined as a FIC value of
as 1–4 and antagonistic interaction as FIC ≥ 4, as described [41].
≤
0.5, an additive interaction as 0.5–1, no interaction
4.2.3. RnpA Protein Purification
His-tagged RnpA was purified as previously described [33]. E. coli BL21 (DE3) cells
harboring plasmid pEXP5-nt containing a hexahistidine tag fused to the N−-t1erminus of
S.aureus RnpA coding region were grown in LB supplemented with 50 µg mL ampicillin
to OD600 = 0.6 and induced with 1mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for
three hours to induce protein expression. E. coli cells were subjected to centrifugation at
◦
1560
×
g for 20 min at 4 C and the cell pellet was resuspended in 20 mL buffer A (300 mM
NaCl, 50 mM Na2HPO4, pH 7.4) containing a mini EDTA-free protease inhibitor tablet
(Roche; Bradford, CT, USA) and 20 mM imidazole. Cells were mechanically lysed by
three passes at 18,000 psi through a French Pressure Cell Press (SLM-Aminco; Pittsford,
NY, USA) and cell debris was removed by centrifugation at 17,000
×
g for 10 min at 4 ◦C.
Supernatants were collected, filtered through a 0.2 micron syringe filter, then loaded onto
a 5 mL HisPur cobalt column (ThermoFisher Scientific, Waltham, MA, U.S.A.) using the
BioRad Maximizer Duo-Flow Medium Pressure Chromatography System. Protein was
eluted using an imidazole gradient (80 mM to 500 mM). Fractions were assessed for RnpA
presence and purity via SDS-PAGE analysis, Coomassie staining and Western blotting
using an anti-His antibody (Invitrogen; Grand Island, NY, USA).
4.2.4. In Vitro Transcription of RNA
rnpB and RNA substrates (spa, ptRNATyr) for RnpA functional assays, as well as
mature tRNA were synthesized in vitro, as previously described [33]. Each gene was PCR
amplified using S. aureus UAMS-1 chromosomal DNA as a template and the corresponding
oligonucleotide primer pairs, in which the forward primers contained an RNA polymerase
T7 promoter sequence. The following primer pairs were used in this study (T7 promoter un-
derlined): T7-rnpB forward—GATTACATAATACGACTCACTATAGGGTGATATTTCGG-
GTAATCGCTATA and rnpB reverse—ACTAGTAGTGATATTTCTATAAGCCATG; T7-ptRN-
ATyr forward—GATTACATAATACGACTCACTATAGGGCACCATTTATGGAGGGGTAG-
CG and ptRNATyr reverse—TGGTGGAG GGGGGCAGATTC; T7-spa forward—GATTAC-
ATAATACGACTCACTATAGGGTTATAGTTCGCGA CGACGTCCAG and spa reverse—
TTGAAAAAGAAAAACATTTATTCAATTCGTAAACTAGG. Resulting PCR products
were analyzed on a 0.8% agarose gel and purified using the Qiagen QIAquick Gel Ex-
traction kit, according to the manufacturer’s instructions. In vitro transcription was per-
formed using the TranscriptAid T7 High Yield Transcription kit (Fermentas; Burlington,
ON, Canada) following manufacturer’s instructions. Following in vitro transcription, the
RNA was treated with DNase I for 90 min and re-purified using the Qiagen RNeasy Mini
kit. RNA was quantified using a NanoDrop2000 spectrophotometer.
4.2.5. In Vitro mRNA Degradation Assays
RnpA-mediated degradation was assessed using the Rnase Alert QC System (Ther-
mofisher Scientific). 20 pmol of His-RnpA was combined with 0.4
FRET substrate and either DMSO (negative control) or compound
Alert Buffer. Reactions were assembled in 96-well PCR plates (BioRad) and incubated at
µM (final concentration)
≤
500 M in 1 Rnase
µ
×

Antibiotics 2021, 10, 369
13 of 17
37 ◦C for 30 min in the BioRad CFX 96 Connect Real Time instrument, measuring fluo-
rescence every 2 min at 490 nm excitation/520 nm emission. Percent inhibition of each
compound was calculated at the 30 min time-point based on the following formula: (RFU
of compound treated RnpA/RFU of DMSO-treated RnpA) × 100.
4.2.6. In Vitro ptRNA Processing Assays
S.aureus Rnase P activity assays were performed as previously described [33]. Briefly,
◦
ptRNATyr and rnpB RNA was denatured by heating to 95 C for 5 min then slow cooled
to room temperature. RNA species were then combined with 2
×
low salt buffer (50 mM
Tris-HCl pH 8.0, 5 mM MgCl2) and incubated for 5 min at 37 ◦C. Rnase P was reconstituted
by mixing an equal molar ratio of His-RnpA and rnpB for 15 min at 37 ◦C. Precursor tRNA
processing inhibition reactions were performed by combining 5 pmol of reconstituted Rnase
◦
P with DMSO (negative control) or 50
µ
M compound and incubating for 5 min at 37 C. Then,
5 pmol ptRNATyr was added to each reaction and incubated for an additional 30 min at 37 C.
◦
Reactions were stopped with 2
×
RNA loading dye (Thermo Scientific) and heating to 65 ◦C
for 10 min. Samples were electrophoresed on a 7M urea/8% polyacrylamide gel then stained
with 0.5
µ
g mL−1 ethidium bromide. The BioRad EZ Gel Doc imaging system was used to
visualize the RNA and relative abundance of mature tRNATyr in the DMSO control or in the
samples containing compound and analyzed using BioRad Image Lab densitometry software.
The percent inhibitory activity of each compound was calculated using the following equation:
(% experimental processing/% processing negative control) × 100.
4.2.7. Cellular mRNA Turnover Assays
S.aureus RNA half-life measurements were performed as described [33]. Briefly,
S.aureus UAMS-1 was grown to an optical density at 600 nm of 0.18 in MHB and treated
with DMSO (negative control) or 0.5
shaking at 37 ◦C. To inhibit de novo RNA synthesis, rifampin (Alfa Aesar, Haverhill, MA,
USA) was added to the culture at a final concentration of 200
g mL−1. Half of the culture
×
MIC of the indicated compound for 30 min with
µ
was immediately removed and combined with an equal volume of ice-cold acetone:ethanol
◦
(1:1 v/v). The remainder of the culture was returned to the 37 C incubator for an additional
5 min, then combined with an equal volume of ice-cold acetone:ethanol (1:1 v/v) and stored
at −80 ◦C.
4.2.8. Cellular tRNATyr Population Measures
Cellular S. aureus tRNATyr pools were measured as previously described [34]. Briefly,
S. aureus was grown to OD600 = 0.18 in MHB and treated with DMSO (negative control),
◦
0.5
×
or 1
×
MIC of the indicated compound for 1 h with shaking at 37 C. The culture
was removed, combined with an equal volume of acetone:ethanol (1:1 v/v) and stored at
−80 ◦C.
4.2.9. Bacterial RNA isolation and Quantitative Reverse Transcription Polymerase Chain
Reaction (qRT-PCR)
Cell suspensions in acetone:ethanol were thawed on ice and centrifuged at 1560
g for 10 min at 4 ◦C. Acetone:ethanol was decanted, and pellets were left to air-dry for
5 min. Cell pellets were resuspended in 500 L ice-cold TE buffer (10 mM Tris-HCl, pH
8.0, 1mM EDTA) and transferred to FastPrep Lysing Matrix B tubes (MP Biomedicals,
×
µ
Santa Ana, CA). Mixtures were homogenized at 5 m s
−1 for 20 s, rested on ice for 5 min,
·
then homogenized again at 4.5 m
were centrifuged at 16,200
·
s−1 for 20 s in a FastPrep-24 instrument. Cell lysates
◦
×
g for 15 min at 4 C to remove cell debris. Total bacterial
RNA and tRNATyr populations were isolated from the supernatant using Qiagen RNeasy
Mini kits and miRNeasy kits, respectively, following the manufacturer’s recommenda-
tions (Germantown, MD). For qRT-PCR, 2
µ
g of RNA substrate was treated with 2 units
◦
of DNase I (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 C and re-purified
using Qiagen RNeasy Mini kits, following the manufacturer’s instructions. RNA was
measured for concentration and quality using a NanoDrop spectrophotometer. Quantabio

Antibiotics 2021, 10, 369
14 of 17
(Beverly, MA, USA) qScript cDNA Supermix was used to convert 200 ng of RNA into
cDNA, following manufacturer’s instructions, which was subsequently amplified using
Quantabio SYBR Green Fast Mix following manufacturer’s instructions. Fluorescence
was read on the BioRad (Hercules, CA, USA) CFX 96 Connect Real Time Machine. Tran-
script levels were compared to the internal control 16S rRNA (∆∆Ct) and plotted as fold
change compared to the control. The following primer pairs were used in this study
for qRT-PCR: spa forward—GCAGATAACAAATTAGCTGATAAAAACAT; spa reverse—
CTAACGCTAATGATAATCCACCAAATAC; –15 ptRNATyr forward—TTAACTGAATAAG-
CTGGAGGGG; tRNATyr reverse—TGGTG GAGGGGGGCAGATTC; 16S rRNA forward—
TAACCTACCTATAAGACTGGGATAA; 16S rRNA reverse—GCTTTCACATCAGACTTAA-
AAA.
4.2.10. Cytotoxicity Testing
Human liver epithelial cells (HEP G2) were cultured in Dulbecco’s Modified Eagle
Medium (DMEM; Fisher Scientific, Hampton, NH) supplemented with 10% heat inacti-
vated fetal bovine serum (FBS; Corning Life Sciences) and 1% penicillin/streptomycin
(Thermofisher Scientific). Cells were incubated at 37 ◦C with 5% CO2 in Nunc (Roskilde,
Denmark) tissue culture flasks. Cells were grown in monolayers until exceeding 70%
confluency, removed with 0.25% trypsin (Fisher Scientific), resuspended in fresh medium,
and used to seed approximately 2.5
microplate (Nunc) containing 200
×
105 cells/mL into each well of a 96 well tissue culture
L of fresh medium. Cytotoxicity testing was conducted
µ
according to the guidelines of the International Organization for Standardization (ISO)
10993-5:2009. After 24 h of incubation, the cell media was removed, and adherent cells
were washed with 1
5% per volume of compound at final concentrations from 12.5
20–24 h at 37 ◦C with 5% CO2. After incubation, medium supplemented with compound
was removed from the wells and replaced with 100 L of fresh culture medium. Then,
10 L of 12 mM (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) stock
reagent (CyQUANT MTT cell proliferation kit; Thermofisher Scientific) was added to each
well. After labeling the cells with the MTT reagent, all but 25 L of medium was removed
×
phosphate buffered saline (PBS). Cell media was supplemented with
µ
M to 400 M and incubated
µ
µ
µ
µ
from the wells, and 50 µL of DMSO was added to each well and mixed thoroughly and
cells were incubated at 37 ◦C with 5% CO2 for 10 min. After incubation, wells were mixed
again and using a SPECTRAmax5 microplate reader, absorbance was read at 540 nm. Cells
were treated with 125 µg/mL mitomycin C (Fisher Scientific) to serve as a positive control
and 2% DMSO as a negative control. Following ISO guidelines, compounds that resulted
in cell viability below 70% were considered to have cytotoxic effects. All compounds were
tested in in two independent experiments in triplicate and cell viability was expressed as a
percent of the negative control.
4.2.11. Murine Corneal Infection Model and Treatment
In vivo efficacy studies utilizing a murine model of corneal S. aureus infection were
performed as previously described [39]. Female BALB/c mice four to six weeks of age
were acquired from Charles River (Washington, MA, USA) and housed according to the
approved University of Rochester Medical Center Council on Animal Research (UCAR)
protocol. S. aureus clinical isolate USA300 was grown overnight on both MH agar and
MH broth at 37 ◦C. Broth cultures were centrifuged at 2000
×
g for 10 min at 4 ◦C and the
sterile PBS in a volume equivalent to the starting volume.
pellet was resuspended in 1
×
The mice were anesthetized with 100 mg kg−1 ketamine (Par Pharmaceutica; Chestnut
Ridge, NY, USA) and 10 mg kg−1 xylazine (Akorn, Inc.; Lake Forest, IL, USA) and 0.5%
proparacaine (Akorn, Inc.) was applied to the right eye of each mouse. Excess proparacaine
was blotted from the ocular surface. Using a 27-gauge needle, inoculated with a single
colony of S. aureus USA300, three 2 mm scratches were made across the right cornea.
The scratches were inoculated with a 5
µ
L volume of the bacterial culture containing 107
CFU. After infection, the eyes were assigned a disease severity score every 24 h, using a

Antibiotics 2021, 10, 369
15 of 17
previously validated scale, as follows: 0, no evidence of clinical infection; 1, opacity < 4
mm; 2, opacity > 4 mm; 3, dense opacity covering the entire cornea; 4, perforation of the
cornea (Beisel and Berk 1983). In the event of a perforation, the mouse was euthanized
immediately via carbon dioxide asphyxiation. Treatments were administered in 5 µL
aliquots to the infected eyes every 6 h beginning 6 h post-inoculation and ending 48 h
post-inoculation. The treatments included PBS (negative control) and RNP0012, diluted
in PBS to 50 µM. The animals were euthanized after 48 h and whole eyes were excised,
homogenized, and plated to quantitate viable S. aureus colonies present. To do so, eyes
were added to tubes containing 1.4 mm ceramic beads (Fisher Scientific; Hampton, NJ,
USA) and 0.5 mL PBS and homogenized using the Fisherbrand Bead Mill homogenizer.
Aliquots of 0.1 mL were removed from each tube, serially diluted in 0.8% sodium chloride,
and plated on mannitol salt agar plates (Fisher Scientific) for enumeration after incubating
16 h at 37 ◦C, any animals that appeared.
5. Conclusions
This study describes work designed to study the structure activity relationship of
the 2-acylaminocycloalkylthiophene chemical class of RnpA inhibiting antimicrobials. In
doing so we found features of the chemical class, such as the cycloalkane ring size and
trifluoroacetamide moiety, were indispensable for antimicrobial activity toward S. aureus.
Conversely changes to the scaffold’s phenyl ring were well tolerated and modulated RnpA
targeting effects, which were best measured in cell-based assays of the protein’s mRNA
degradation and ptRNA activities. A frontrunner, RNP0012 was identified to exhibit
excellent antimicrobial activity and inhibition of both RnpA functions that appeared to
display appreciable antimicrobial performance in a murine model of S. aureus keratitis.
Supplementary Materials: The following are available online at https://www.mdpi.com/article/10
.3390/antibiotics10040369/s1, Table S1: Cell viability measurements of analogs against human HEP
G2 cells, all analog synthesis and characterization data is provided in supplementary material.
Author Contributions: Conceptualization, P.M.D. and D.P.F.; methodology, M.C. and X.C.; formal
analysis, M.C.; data curation, M.C. and X.C.; writing—original draft preparation, M.C.; writing—
review and editing, M.C., X.C., D.P.F., and P.M.D.; project administration, D.P.F. and P.M.D.; funding
acquisition, D.P.F. and P.M.D. All authors have read and agreed to the published version of the
manuscript.
Funding: This research was funded by National Institute for Allergy and Infectious Disease R01AI34685
(D.P.F. and P.M.D).
Institutional Review Board Statement: The study was conducted according to the guidelines of
the Declaration of Helsinki and approved by the Institutional Review Board of The University of
Rochester School of Medicine (protocol code 101864/2017-022 approved 6 January 2021).
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available in the published article
and supplementary information.
Conflicts of Interest: P.M.D. is co-founder of Arcum Therapeutics.
References
1.
2.
3.
4.
Wertheim, H.F.L.; Melles, D.C.; Vos, M.C.; van Leeuwen, W.; van Belkum, A.; Verbrugh, H.A.; Nouwen, J.L. The role of nasal
carriage in Staphylococcus aureus infections. Lancet Infect. Dis. 2005, 5, 751–762. [CrossRef]
Becker, K.; Schaumburg, F.; Fegeler, C.; Friedrich, A.W.; Köck, R. Staphylococcus aureus from the German general population is
highly diverse. Int. J. Med. Microbiol. 2017, 307, 21–27. [CrossRef]
Roberts, S.; Chambers, S. Diagnosis and management of Staphylococcus aureus infections of the skin and soft tissue. Intern. Med.
J. 2005, 35, S97–S105. [CrossRef] [PubMed]
Mitchell, D.H.; Howden, B.P. Diagnosis and management of Staphylococcus aureus bacteraemia. Intern. Med. J. 2005, 35, S17–S24.
[CrossRef]

Antibiotics 2021, 10, 369
16 of 17
5.
Murdoch, D.R.; Corey, G.R.; Hoen, B.; Miró, J.M.; Fowler, V.G.; Bayer, A.S.; Karchmer, A.W.; Olaison, L.; Pappas, P.A.; Moreillon, P.
Clinical presentation, etiology, and outcome of infective endocarditis in the 21st century: The International Collaboration on
Endocarditis–Prospective Cohort Study. Arch. Intern. Med. 2009, 169, 463–473. [CrossRef] [PubMed]
Murray, R.J. Staphylococcus aureus infective endocarditis: Diagnosis and management guidelines. Intern. Med. J. 2005, 35,
S25–S44. [CrossRef]
Turner, N.A.; Sharma-Kuinkel, B.K.; Maskarinec, S.A.; Eichenberger, E.M.; Shah, P.P.; Carugati, M.; Holland, T.L.; Fowler, V.G.
Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat. Rev. Microbiol. 2019, 17, 203–218.
[CrossRef]
6.
7.
8.
9.
Diekema, D.J.; Hsueh, P.-R.; Mendes, R.E.; Pfaller, M.A.; Rolston, K.V.; Sader, H.S.; Jones, R.N. The microbiology of bloodstream
infection: 20-year trends from the SENTRY antimicrobial surveillance program. Antimicrob. Agents Chemother. 2019, 63, e00355-19.
[CrossRef] [PubMed]
Tong, S.Y.C.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G. Staphylococcus aureus infections: Epidemiology, pathophys-
iology, clinical manifestations, and management. Clin. Microbiol. Rev. 2015, 28, 603–661. [CrossRef]
10. Fowler, V.G.; Miro, J.M.; Hoen, B.; Cabell, C.H.; Abrutyn, E.; Rubinstein, E.; Corey, G.R.; Spelman, D.; Bradley, S.F.; Barsic, B.
Staphylococcus aureus endocarditis: A consequence of medical progress. JAMA 2005, 293, 3012–3021. [CrossRef]
11. Huang, Y.; Jiao, Y.; Zhang, J.; Xu, J.; Cheng, Q.; Li, Y.; Liang, S.; Li, H.; Gong, J.; Zhu, Y. Microbial etiology and prognostic factors of
ventilator-associated pneumonia: A multicenter retrospective study in Shanghai. Clin. Infect. Dis. 2018, 67, S146–S152. [CrossRef]
12. Bonell, A.; Azarrafiy, R.; Huong, V.T.L.; Viet, T.L.; Phu, V.D.; Dat, V.Q.; Wertheim, H.; van Doorn, H.R.; Lewycka, S.; Nadjm, B. A
systematic review and meta-analysis of ventilator-associated pneumonia in adults in Asia: An analysis of national income level
on incidence and etiology. Clin. Infect. Dis. 2019, 68, 511–518. [CrossRef] [PubMed]
13. Rosenthal, V.D.; Maki, D.G.; Mehta, A.; Álvarez-Moreno, C.; Leblebicioglu, H.; Higuera, F.; Cuellar, L.E.; Madani, N.; Mitrev, Z.;
Dueñas, L. International nosocomial infection control consortium report, data summary for 2002–2007, issued January 2008. Am.
J. Infect. Control. 2008, 36, 627–637. [CrossRef] [PubMed]
14. Rosenthal, V.D.; Al-Abdely, H.M.; El-Kholy, A.A.; AlKhawaja, S.A.A.; Leblebicioglu, H.; Mehta, Y.; Rai, V.; Hung, N.V.; Kanj,
S.S.; Salama, M.F. International Nosocomial Infection Control Consortium report, data summary of 50 countries for 2010–2015:
Device-associated module. Am. J. Infect. Control. 2016, 44, 1495–1504. [CrossRef]
˙
15. Wałaszek, M.; Rózan´ska, A.; Wałaszek, M.Z.; Wójkowska-Mach, J. Epidemiology of Ventilator-Associated Pneumonia, microbio-
logical diagnostics and the length of antimicrobial treatment in the Polish Intensive Care Units in the years 2013–2015. BMC Infect.
Dis. 2018, 18, 308. [CrossRef]
16. Peng, M.Y.; Cevallos, V.; McLeod, S.D.; Lietman, T.M.; Rose-Nussbaumer, J. Bacterial keratitis: Isolated organisms and antibiotic
resistance patterns in San Francisco. Cornea 2018, 37, 84. [CrossRef]
17. Whitcher, J.P.; Srinivasan, M.; Upadhyay, M.P. Corneal blindness: A global perspective. Bull. World Health Organ. 2001, 79,
214–221.
18. Planet, P.J. Life after USA300: The rise and fall of a superbug. J. Infect. Dis. 2017, 215, S71–S77. [CrossRef]
19. Hiramatsu, K.; Hanaki, H.; Ino, T.; Yabuta, K.; Oguri, T.; Tenover, F.C. Methicillin-resistant Staphylococcus aureus clinical strain
with reduced vancomycin susceptibility. J. Antimicrob. Chemother. 1997, 40, 135–136. [CrossRef]
20. Liu, C.; Chambers, H.F. Staphylococcus aureus with heterogeneous resistance to vancomycin: Epidemiology, clinical significance,
and critical assessment of diagnostic methods. Antimicrob. Agents Chemother. 2003, 47, 3040–3045. [CrossRef] [PubMed]
21. Lee, C.-H.; Wang, M.-C.; Huang, I.-W.; Chen, F.-J.; Lauderdale, T.-L. Development of daptomycin nonsusceptibility with
heterogeneous vancomycin-intermediate resistance and oxacillin susceptibility in methicillin-resistant Staphylococcus aureus
during high-dose daptomycin treatment. Antimicrob. Agents Chemother. 2010, 54, 4038–4040. [CrossRef]
22. Long, S.W.; Olsen, R.J.; Mehta, S.C.; Palzkill, T.; Cernoch, P.L.; Perez, K.K.; Musick, W.L.; Rosato, A.E.; Musser, J.M. PBP2a
mutations causing high-level ceftaroline resistance in clinical methicillin-resistant Staphylococcus aureus isolates. Antimicrob.
Agents Chemother. 2014, 58, 6668–6674. [CrossRef] [PubMed]
23. Schaumburg, F.; Peters, G.; Alabi, A.; Becker, K.; Idelevich, E.A. Missense mutations of PBP2a are associated with reduced
susceptibility to ceftaroline and ceftobiprole in African MRSA. J. Antimicrob. Chemother. 2016, 71, 41–44. [CrossRef]
24. Mammina, C.; Bonura, C.; di Carlo, P.; Calà, C.; Aleo, A.; Monastero, R.; Palma, D.M. Daptomycin non-susceptible, vancomycin
intermediate methicillin-resistant Staphylococcus aureus ST398 from a chronic leg ulcer, Italy. Scand. J. Infect. Dis. 2010, 42,
955–957. [CrossRef]
25. Boucher, H.W.; Talbot, G.H.; Bradley, J.S.; Edwards, J.E.; Gilbert, D.; Rice, L.B.; Scheld, M.; Spellberg, B.; Bartlett, J. Bad bugs,
no drugs: No ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2009, 48, 1–12. [CrossRef]
[PubMed]
26. Spitzfaden, C.; Nicholson, N.; Jones, J.J.; Guth, S.; Lehr, R.; Prescott, C.D.; Hegg, L.A.; Eggleston, D.S. The structure of ribonuclease
P protein from Staphylococcus aureus reveals a unique binding site for single-stranded RNA. J. Mol. Biol. 2000, 295, 105–115.
[CrossRef]
27. Kazantsev, A.V.; Pace, N.R. Bacterial RNase P: A new view of an ancient enzyme. Nat. Rev. Microbiol. 2006, 4, 729–740. [CrossRef]
28. Olson, P.D.; Kuechenmeister, L.J.; Anderson, K.L.; Daily, S.; Beenken, K.E.; Roux, C.M.; Reniere, M.L.; Lewis, T.L.; Weiss, W.J.;
Pulse, M.; et al. Small molecule inhibitors of staphylococcus aureus RnpA alter cellular mRNA turnover, exhibit antimicrobial
activity, and attenuate pathogenesis. PLoS Pathog. 2011, 7. [CrossRef]

Antibiotics 2021, 10, 369
17 of 17
29. Roux, C.M.; DeMuth, J.P.; Dunman, P.M. Characterization of components of the Staphylococcus aureus mRNA degradosome
holoenzyme-like complex. J. Bacteriol. 2011, 193, 5520–5526. [CrossRef]
30. Wang, X.; Wang, C.; Wu, M.; Tian, T.; Cheng, T.; Zhang, X.; Zang, J. Enolase binds to RnpA in competition with PNP ase in
Staphylococcus aureus. FEBS Lett. 2017, 591, 3523–3535. [CrossRef]
31. Ha, L.; Colquhoun, J.; Noinaj, N.; Das, C.; Dunman, P.M.; Flaherty, D.P. Crystal structure of the ribonuclease-P-protein subunit
from Staphylococcus aureus research communications. Acta Crystallogr. Sect. F Struct. Biol. Commun. 2018, 74 Pt 10, 632–637.
[CrossRef]
32. Blanchard, C.; Brooks, L.; Beckley, A.; Colquhoun, J.; Dewhurst, S.; Dunman, P.M. Neomycin sulfate improves the antimicrobial
activity of mupirocin-based antibacterial ointments. Antimicrob. Agents Chemother. 2016, 60, 862–872. [CrossRef]
33. Eidem, T.M.; Lounsbury, N.; Emery, J.F.; Bulger, J.; Smith, A.; Abou-Gharbia, M.; Childers, W.; Dunman, P.M. Small-Molecule
Inhibitors of Staphylococcus aureus RnpA-Mediated RNA Turnover and tRNA Processing. Antimicrob. Agents Chemother. 2015
59, 2016–2028. [CrossRef] [PubMed]
,
34. Colquhoun, J.M.; Ha, L.; Beckley, A.; Meyers, B.; Flaherty, D.P.; Dunman, P.M. Identification of Small Molecule Inhibitors of
Staphylococcus aureus RnpA. Antibiotics 2019, 8, 48. [CrossRef] [PubMed]
35. Truong, E.C.; Phuan, P.W.; Reggi, A.L.; Ferrera, L.; Galietta, L.J.V.; Levy, S.E.; Moises, A.C.; Cil, O.; Diez-Cecilia, E.; Lee, S.; et al.
Substituted 2-Acylaminocycloalkylthiophene-3-carboxylic Acid Arylamides as Inhibitors of the Calcium-Activated Chloride
Channel Transmembrane Protein 16A (TMEM16A). J. Med. Chem. 2017, 60, 4626–4635. [CrossRef] [PubMed]
36. Lounsbury, N.; Eidem, T.; Colquhoun, J.; Mateo, G.; Abou-gharbia, M.; Dunman, P.M.; Childers, W.E. Novel inhibitors of
Staphylococcus aureus RnpA that synergize with mupirocin. Bioorg. Med. Chem. Lett. 2018, 28, 1127–1131. [CrossRef] [PubMed]
37. Potter, V.R. Sequential blocking of metabolic pathways in vivo. Proc. Soc. Exp. Biol. Med. 1951, 76, 41–46. [CrossRef] [PubMed]
38. Bushby, S.R. Synergy of trimethoprim-sulfamethoxazole. Can. Med. Assoc. J. 1975, 112, 63.
39. Chojnacki, M.; Philbrick, A.; Wucher, B.; Reed, J.N.; Tomaras, A.; Dunman, P.M.; Wozniak, R.A.F. Development of a broad-
spectrum antimicrobial combination for the treatment of Staphylococcus aureus and Pseudomonas aeruginosa corneal infections.
Antimicrob. Agents Chemother. 2019, 63, e01929-18. [CrossRef]
40. Kaur, J.; Cao, X.; Abutaleb, N.S.; Elkashif, A.; Graboski, A.L.; Krabill, A.D.; AbdelKhalek, A.H.; An, W.; Bhardwaj, A.; Seleem,
M.N.; et al. Optimization of Acetazolamide-Based Scaffold as Potent Inhibitors of Vancomycin-Resistant Enterococcus. J. Med.
Chem. 2020, 63, 9540–9562. [CrossRef] [PubMed]
41. Odds, F.C. Synergy, antagonism, and what the chequerboard puts between them. J. Antimicrob. Chemother. 2003, 52, 1. [CrossRef]
[PubMed]
42. Blevins, J.S.; Beenken, K.E.; Elasri, M.O.; Hurlburt, B.K.; Smeltzer, M.S. Strain-dependent differences in the regulatory roles of
sarA and agr in Staphylococcus aureus. Infect. Immun. 2002, 70, 470–480. [CrossRef] [PubMed]