Copper-mediated arylsulfanylations and arylselanylations of pyrimidine or 7-deazapurine nucleosides and nucleotides

Article abstract of DOI:10.1039/c6ob01917j

The syntheses of 5-arylsulfanyl- or 5-arylselanylpyrimidine and 7-arylsulfanyl- or 7-arylselanyl-7-deazapurine nucleosides and nucleotides were developed by the Cu-mediated sulfanylations or selanylations of the corresponding 5-iodopyrimidine or 7-iodo-7-

Full text of DOI:10.1039/c6ob01917j

View Article Online
View Journal
Organic &
Biomolecular
Chemistry
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: F. Botha, M.
Slavickova, R. Pohl and M. Hocek, Org. Biomol. Chem., 2016, DOI: 10.1039/C6OB01917J.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
Information for Authors.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the Ethical guidelines still
apply. In no event shall the Royal Society of Chemistry be held
responsible for any errors or omissions in this Accepted Manuscript
or any consequences arising from the use of any information it
contains.
www.rsc.org/obc

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 1 of 5
View Article Online
DOI: 10.1039/C6OB01917J
Organic & Biomolecular Chemistry
ARTICLE
Copper-mediated arylsulfanylations and arylselanylations of
pyrimidine or 7-deazapurine nucleosides and nucleotides
Filip Botha,a† Michaela Slavíčková,a Radek Pohl,a and Michal Hocek* a,b
Received 00th January 20xx,
Accepted 00th January 20xx
Synthesis of 5-arylsulfanyl- or 5-arylselanylpyrimidine and 7-arylsulfanyl- or 7-arylselanyl-7-deazapurine nucleosides and
nucleotides was developed by Cu-mediated sulfanylations or selanylations of the corresponding 5-iodopyrimidine or 7-iodo-
7-deazapurine nucleosides or nucleotides with diaryldisulfides or -diselenides. The reactions were also applicable for direct
modifications of 2'-deoxycytidine triphosphate and the resulting 5-arylsulfanyl or 5-arylselanyl-dCTP served as substrates
for polymerase synthesis of modified DNA bearing arylsulfanyl or arylselanyl groups in the major groove.
DOI: 10.1039/x0xx00000x
www.rsc.org/
analogues were used17 as radical precursors for photochemical
generation of thymine in DNA. Some 7-arylsulfanyl-7-
deazaadenosine analogues displayed18 weak cytostatic effects,
Introduction
DNA molecules bearing modifications in major groove find
diverse applications mainly in bioanalysis and chemical biology.1
5-Substituted pyrimidine and 7-substituted 7-deazapurine 2'-
deoxyribonucleoside 5'-O-triphosphates (dNTPs) are good
substrates for DNA polymerases in enzymatic synthesis of base-
modified DNA.2,3 Modified dNTPs are mostly synthesized by
triphosphorylation of corresponding modified nucleosides4 but
this approach can fail in case of some reactive modifications not
compatible with the triphosphorylation methodology.
Therefore, direct methods of functionalization of dNTPs are
desirable but are inherently difficult due to lability of dNTPs
which are prone to hydrolysis. So far, the only reported
reactions suitable for modification of dNTPs were aqueous
cross-coupling reactions of halogenated dNTPs,3,5 thiol-
maleimide addition,6 some amide-forming reactions of 5-
aminoalkylethynyl-dUTP,7 hydrazone-formation,8 Diels-Alder9
and CuAAC click reaction.10 The Suzuki-Miyaura cross-coupling
reaction with arylboronic acids11 and the Sonogashira reactions
with terminal acetylenes12 are the most general and useful
reactions used in the synthesis of base-modified dNTPs. In
addition, several examples of the Heck coupling13 with
acrylates, as well as the Stille reaction14 with aryl- or
alkenylstannanes were recently reported. To the best of our
knowledge, no method for direct attachment of a heteroatom
to dNTPs has been published.
while the corresponding 7-S-substituted 7-deazaguanine
derivatives have never been reported. 5-Selenylated pyrimidine
nucleotides inhibit thymidylate synthase19 and have been
utilized20 for modification of DNA or RNA for X-ray
crystallography and 5-(phenylselenylmethyl)uracil was used21
as a T radical precursor for DNA crosslinking. Also related 5-
(phenyltelluranyl)uracil nucleoside has been prepared22 and,
after incorporated to DNA, used for X-ray and STM imaging.
However, no selenylated 7-deazapurines are known so far.
Therefore, we report here the synthesis of arylsulfanyl and
arylselanyl derivatives of pyrimidine and 7-deazapurine
nucleosides and nucleotides and their potential for polymerase
incorporation to DNA.
Results and Discussion
Synthesis
Previously, 5-(alkylsulfanyl)pyrimidine bases or nucleosides
were prepared by alkylation of 5-mercaptouracil,23 reactions of
toxic 5-(chloromercuri)pyrimidines with disulfides,24 or more
recently by Pd-catalyzed coupling of 5-bromopyrimidine
derivatives with thiols,25 whereas 7-arylsulfanyl-7-deazapurines
were prepared by Cu-mediated S-H sulfenylations.18 The 5-
selenylated pyrimidines were prepared by Mn-mediated C-H
selenylations20 or electrophilic aromatic selenylation.26
5-Alkylsulfanyl- or arylsulfanyl-pyrimidine nucleosides were
reported to inhibit thymidylate kinase15 and slightly destabilized
DNA duplexes,16 whereas saturated 5-phenylsulfanyl-thymidine
Inspired by the works of Taniguchi27 on copper-catalyzed
reactions of diaryldisulfides or diaryldiselenides with
iodoarenes, we started our study by testing of reactions of
unprotected halogenated nucleosides.5 The reaction conditions
were first tested on 5-iodo-2'-deoxycytidine (dCI) in reaction
with diphenyldisulfide. In our hands, the Cu-catalyzed (10 mol.
% of CuI) reactions in presence or in the absence of Mg27 gave
a.Institute of Organic Chemistry and Biochemistry, Academy of Science Czech
Republic, Gilead Sciences and IOCB Research Center, Flemingovo nám. 2, 16610
Prague 6 (Czech Republic); E-mail: hocek@uochb.cas.cz
.
b.Department of Organic Chemistry, Faculty of Science, Charles University in
Prague, Hlavova 8, 12843 Prague 2 (Czech Republic)
.
† Passed away on July 11, 2016.
Electronic Supplementary Information (ESI) available: Experimental part, copies of
spectra. See DOI: 10.1039/x0xx00000x
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 1
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 2 of 5
ARTICLE
Journal Name
complex mixtures of products. Therefore, we used
stoichiometric amounts of copper powder in presence of 2,2'-
bipyridine (bpy). The reactions were performed at 80-110°C in
DMF (Scheme 1). Under these conditions (Method A), the
desired 5-phenylsulfanyl-2'-deoxycytidine was formed as major
product (in addition to small amounts of dehalogenated 2'-
deoxycytidine) and isolated in good yield of 58%. Similar
conversion and yield was achieved when using pre-generated
phenylsulfanylcuprate (Method B).
the reactions with dithienyldisulfide or diselenideVsie(wMAertitchleoOdnliAne)
gave the other corresponding 5-arylsuDlfOanI:y1l0-.10o3r9/pCh6eOnBy0l1-91o7Jr
methylselanyl uracil nucleosides (dUThS dUPhSe and dUMeSe) in
,
low yields. The reactions of 7-iodo-7-deazaadenine dAI and -7-
deazaguanine dGI nucleosides with PhSCu (Method B) gave the
7-(phenylsulfanyl)deazapurine nucleosidies dAPhS and dGPhS in
acceptable 50 or 39% yields, whereas the reactions with
diphenyldiselenide furnished the corresponding phenylselanyl
nucleosides dAPhSe and dGPhSe in moderate yields. Again, the
reaction with dimethyldiselenide gave very low conversion and
the dAMeSe was isolated only in 14%. Apparently the reactivity
of dimethyldiselenide is very low and the methylsulfanylation is
of very limited synthetic applicability.
Scheme 2. Sulfanylations and selanylations of dCIMP
Scheme 1. Sulfanylations and selanylations of nucleosides
Next, we tested the reactions of nucleotides and started with
stable nucleoside 5'-O-monophosphates (dNMPs). The model
iodinated dCIMP was tested in reactions with diaryldisufides or
diselenides (Scheme 2, Method A). Most of these reactions gave
very low conversions and only two products, dCThSMP and
dCPhSeMP were isolated in acceptable yields. On the other hand,
the phosphorylation of the 5-arylsulfanyl- or arylselanyl-
cytosine nucleosides gave the desired modified nucleotides in
better yields (22-48%).
Finally, we tested the reactions for direct modification of
hydrolytically labile dNTPs (Scheme 3). Thus the iodinated
triphosphate dCITP was reacted with PhSCu (Method B) to give
the desired 5-(phenylsulfanyl)-dCTP (dCPhSTP) in low 7% yield.
Better conversions were achieved when using reactions with
The same reaction of nucleoside dCI (Method A) was then
performed with a small series of diaryldisulfides to obtain the
corresponding 5-(4-nitrophenyl)sulfanyl
methoxyphenyl)sulfanyl (dCMOPS), 5-(2,4-dinitrophenyl)sulfanyl
dCDNPS) and 5-(2-thienylsulfanyl)- (dCThS) 2'-deoxycytidines in
(
dCNOPS), 5-(4-
(
moderate yields (21-50%). The reaction (Method A) with
diphenyldiselenide gave the 5-(phenylselanyl)cytosine
nucleoside dCPhSe in good 50% yield, whereas the corresponding
5-(methylselanyl)C nucleoside dCMeSe was only obtained in low
18% yield.
Then we tested other iodinated nucleosides (Scheme 1). The
reaction of 5-iodo-2'-deoxyuridine (dUI) with PhSCu (Method B)
provided the 5-substituted dUPhS nucleoside in 47%, whereas
2 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Page 3 of 5
Organic & Biomolecular Chemistry
Please do not adjust margins
Journal Name
ARTICLE
diaryldisulfides or diselenides (Method A). The desired dCThSTP Then we tested the same nucleotides (dCPhSTP
,
VdiewCTAhrtSiTclPe Oanlninde
and dCPhSeTP were obtained in good yields of 24 and 31% (which dCPhSeTP) in a more challenging PEX reaDcOtiIo: n10.u10s3in9g/Ca6O3B10-1m91e7Jr
are fully comparable to typical yields of cross-coupling reactions template tempPrb4baseII (Figure 2). This PEX reactions leads to a
of dNTPs11-14).
31-mer DNA containing four modified dCRX nucleotides. KOD XL
was found the best polymerase which gave clean full-length
products in all three cases, whereas the other two enzymes
gave less clean products containing minor amounts of truncated
products. The PEX products were characterized by MALDI-TOF
analysis (Table 2).
Scheme 3. Sulfanylations and selanylations of dNTPs
Polymerase incorporation of modified nucleotides
,
The three new 5-S- or Se-linked dNTPs (dCPhSTP dCThSTP and
Figure 2: PEX reactions with tempPrb4baseII using KOD XL, Vent(exo-) or Pwo
polymerase. Lanes 1,7,13, P: primer; +: products of PEX with natural dNTPs;
-: products of PEX with dTTP, dATP, dGTP; lanes 4-6, 10-12 and 16-18, CRX
:
dCPhSeTP) were then tested as substrates for DNA polymerases.
At first we tested them in primer extension (PEX) reaction with
either KOD XL, Vent(exo-) or Pwo polymerases, 15-mer
Primer248-sh and a 19-mer template tempoligo1C (for sequences,
see Table 1). Figure 1 shows the PAGE analysis of the PEX
reactions. While KOD XL and Vent(exo-) polymerases gave quite
clean bands of the 19-mer oligonucleotide (ON) products
bearing one modified dCRX nucleotide, Pwo gave a mixture of
the full-lenths and a truncated product.
products of PEX with dTTP, dATP, dGTP and functionalized dCRXTP
Table 2: MALDI-TOF data of modified oligodeoxyribonucleotides
ssDNA
M (calc.)
(Da)
M (found) [M or M+H]+
(Da)
ON4ThS
ON4PhS
ON4PhSe
10073.2
10049.3
10241.1
10075.1
10050.8
10240.2
Table 1: List of ON sequences used in this study
Finally, we tested the nucleotides (dCPhSTP dCThSTP and
,
Oligo
Sequence
5’-CATGGGCGGCATGGG-3’
5’-CCCGCCCATGCCGCCCATG-3’
dCPhSeTP) in PCR amplification using a 98-mer template
(tempFLV-A). Figure 3 shows that all three dNTPs were good
substrates of KOD XL polymerase in PCR reaction and gave the
corresponding full-length amplified products (double-stranded
DNA with modification in both strands). The yield of PCR with
dCPhSeTP was further improved by addition of Mg2+ or higher
Primer248-sh
tempoligo1C
tempPrb4baseII 5’-CTAGCATGAGCTCAGTCCCATGCCGCCCATG-3’
primerLT25TH
primerL20
5’-CAAGGACAAAATACCTGTATTCCTT-3’
5’-GACATCATGAGAGACATCGC-3’
5’-GACATCATGAGAGACATCGCCTCTGGGCTAATAGGACTACTT
tempFVL-A
CTAATCTGTAAGAGCAGATCCCTGGACAGGCAAGGAATACAGGT concentration of the modified nucleotide (see Figures S1-S3 in
ATTTTGTCCTTG-3’
ESI).
Figure 1: PEX reactions with tempoligo1C using KOD XL, Vent(exo-) or Pwo
polymerase. Lanes 1,7,13, P: primer; +: products of PEX with natural dNTPs; -
: products of PEX with dTTP, dATP, dGTP; lanes 4-6, 10-12 and 16-18, CRX
:
products of PEX with dTTP, dATP, dGTP and functionalized dCRXTP
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 3
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 4 of 5
ARTICLE
Journal Name
Enderlin, G. Mackenzie, and C. Len, RSC Adv., 2014, , 18558-
M. Welter, D. Verga, and A. Marx, ADnOgeI:w10..1C0h3e9/mC6. OInBt0.19E1d7.J,
2016, 55, 10131–10135.
Figure 3: PCR experiments using KOD XL DNA polymerase. Lanes 1,7 , L:
ladder ; lane 2, C+: products of PEX with natural dNTPs; lane 3, C-: products
of PEX with dTTP, dATP, dGTP; lanes 4-6, CRX: products of PCR with dTTP,
dATP, dGTP and functionalized dCRXTP.
4
View Article Online
18594.
6
7
(a) A. Baccaro, A. L. Steck, and A. Marx, Angew. Chem. Int. Ed.,
2012, 51, 254–257; (b) X. Ren, M. Gerowska, A. H. El-Sagheer,
and T. Brown, Bioorg. Med. Chem., 2014, 22, 4384–4390.
V. Raindlová, R. Pohl, B. Klepetářová, L. Havran, E. Šimková, P.
Horáková, H. Pivoňková, M. Fojta, and M. Hocek,
ChemPlusChem, 2012, 77, 652–662.
Conclusions
8
9
In conclusion, we developed a new method for direct
functionalization of 5-iodopyrimidine and 7-iodo-7-deazapurine
nucleosides and nucleotides based on Cu-mediated
arylsulfanylation or aryl/alkylselenylation. The reactions are
even applicable for modification of fragile halogenated dNTPs.
The S- or Se-modified dNTPs are good substrates for DNA
polymerases and can be used as building blocks for enzymatic
synthesis of modified ONs or DNA.
In this way, an aryl substituent can be attached to the
nucleobase (in nucleoside, nucleotides or DNA) through a
flexible sp3-hybridized sulfide or selenide linkage, which in
principle offers possibility for further transformations (e.g.
oxidations). The arylsulfanyl or arylselenyl group can also serve
as a radical precursor and the selenyl substituents can be used
for X-ray crystallography of nucleic acids. The aryl group can be
functionalized (e.g. NO2 or MeO groups) so the approach can be
potentially used for redox28 or fluorescent29 labelling of nucleic
acids. Research along these lines is on-going.
(a) V. Borsenberger, M. Kukwikila, and S. Howorka, Org.
Biomol. Chem., 2009, 7, 3826–3835; (b) V. Borsenberger and
S. Howorka, Nucleic Acids Res., 2009, 37, 1477–1485.
10 (a) X. Yang, C. Dai, A. D. Molina, and B. Wang, Chem. Commun.,
2010, 46, 1073–1075; (b) Y. Cheng, C. Dai, H. Peng, S. Zheng,
S. Jin, and B. Wang, Chem. Asian J., 2011, 6, 2747–2752.
11 P. Capek, H. Cahová, R. Pohl, M. Hocek, C. Gloeckner, and A.
Marx, Chem. Eur. J., 2007, 13, 6196–6203.
12 L. H. Thoresen, G. S. Jiao, W. C. Haaland, M. L. Metzker, and K.
Burgess, Chem. Eur. J., 2003, 9, 4603–4610.
13 J. Dadová, P. Vidláková, R. Pohl, L. Havran, M. Fojta, and M.
Hocek, J. Org. Chem., 2013, 78, 9627–9637.
14 A. Krause, A. Hertl, F. Muttach, and A. Jäschke, Chem. Eur. J.,
2014, 20, 16613–16619.
15 A. Hampton, R. R. Chawla, and F. Kappler, J. Med. Chem.,
1982, 25, 644-649.
16 M. Ahmadian, P. Zhang, and D. E. Bergstrom, Nucleic Acids
Res., 1998, 26, 3127-3135.
17 (a) J. M. San Pedro, and M. M. Greenberg, ChemBioChem,
2013, 14, 1590–1596. (b) M. J. Resendiz, A. Schön, E. Freire,
and M. M. Greenberg, J Am Chem Soc, 2012, 134, 12478–
12481.
Experimental
For full Experimental part, procedures and characterization of
all compounds, see ESI.
18 M. Klečka, L. P. Slavětínská, E. Tloušťová, P. Džubák, M.
Hajdúch, and M. Hocek, Med. Chem. Commun., 2015, 6, 576–
580.
19 (a) R. F. Schinazi, J. Arbiser, J. J. S. Lee, T. I. Kalman, and W. H.
Prusoff, J. Med. Chem., 1986, 29, 1293-1295. (b) S. Choi, T. I.
Kalman, and T. J. Bardos, J. Med. Chem., 1979, 22, 618-621.
20 (a) A. E. Hassan, J. Sheng, J. Jiang, W. Zhang, and Z. Huang,
Org. Lett., 2009, 11, 2503–2506. (b) W. Zhang, J. Sheng, A. E.
Acknowledgements
This work was supported by the Academy of Sciences of the
Czech Republic (RVO: 61388963 and Praemium Academiae to
M. H.), the Czech Science Foundation (14-04289S to F. B., M. S.
and M. H.), and by Gilead Sciences, Inc. (Foster City, CA, U. S.
A.).
Hassan, and Z. Huang, Chem. Asian J., 2012, 7, 476–479. (c) Z.
Wen, H. E. Abdalla, and H. Zhen, Sci. China Chem., 2013, 56
273–278.
,
21 (a) I. S. Hong, and M. M. Greenberg, Org. Lett., 2004, 6, 5011–
5013. (b) I. S. Hong, and M. M. Greenberg, J. Am. Chem. Soc.,
2005, 127, 10510–10511. (c) I. S. Hong, H. Ding, and M. M.
Greenberg, J. Am. Chem. Soc., 2006, 128, 2230–2231. (d) X.
Peng, I. S. Hong, H. Li, M. M. Seidman, and M. M. Greenberg,
J. Am. Chem. Soc., 2008, 130, 10299–10306.
Notes and references
22 J. Sheng, A. E. Hassan, W. Zhang, J. Zhou, B. Xu, A. S. Soares,
and Z. Huang, Nucleic Acids Res., 2011, 39, 3962–3971.
23 M. P. Kotick, C. Szantay, and T. J. Bardos, J. Org. Chem., 1969,
34, 3806-3813.
24 D. E. Bergstrom, P. Beal, J. Jenson, and X. Lin, J. Org. Chem.,
1991, 56, 5598-5602.
25 D. G. Kananovich, A. Reino, K. Ilmarinen, M. Roomuskos, M.
Karelsson, and M. Loop, Org. Biomol. Chem., 2014, 12, 5634-
5644.
26 M. Abdo, Y. Zhang, V. L. Schramm, and S. Knapp, Org. Lett.,
2010, 13, 2982-2985.
27 (a) N. Taniguchi, T. Onami, Synlett, 2003, 829-832. (b) N.
Taniguchi, T. Onami, J. Org. Chem., 2004, 69, 915-920.
28 J. Balintová, M. Plucnara, P. Vidláková, R. Pohl, L. Havran, M.
Fojta, and M. Hocek, Chem. Eur. J., 2013, 19, 12720–12731.
29 D. Dziuba, P. Jurkiewicz, M. Cebecauer, M. Hof, and M. Hocek,
Angew. Chem. Int. Ed., 2016, 55, 174–178.
1
2
3
Nakatani, K.; Tor, Y. (Eds) Modified Nucleic Acids, Nucleic Acids
and Molecular Biology Series, Vol. 31, Springer 2016, pp. 1-
276.
Reviews: (a) A. Hottin, and A. Marx, Acc. Chem. Res., 2016, 49
,
418–427. (b) M. Hollenstein, Molecules, 2012, 17, 13569–
13591.
Reviews: (a) M. Hocek, J. Org. Chem., 2014, 79, 9914–9921.
(b) J. Dadová, H. Cahová, and M. Hocek, Polymerase Synthesis
of Base-Modified DNA in Modified Nucleic Acids (Nakatani, K.;
Tor, Y., Eds); Springer International Publishing: Cham, 2016;
pp. 123–144.
4
5
(a) J. Ludwig, Acta Biochim. Biophys. Acad. Sci. Hung., 1981,
16, 131–133. (b) T. Kovacs, and L. Otvos, Tetrahedron Lett.,
1988, 29, 4525–4528.
Reviews on cross-coupling reactions of unprotected
nucleosides and nucleotides: (a) K. H. Shaughnessy,
Molecules, 2015, 20, 9419–9454. (b) G. Hervé, G. Sartori, G.
4 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Page 5 of 5
Organic & Biomolecular Chemistry
Please do not adjust margins
Journal Name
ARTICLE
View Article Online
DOI: 10.1039/C6OB01917J
Graphical abstract:
Nucleosides or nucleotides were modified by Cu-mediated
arylsulfanylations or -selanylations and used in enzymatic
synthesis of DNA bearing arylsulfanyl or arylselanyl groups.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 5
Please do not adjust margins