A flavin-dependent halogenase catalyzes the chlorination step in the biosynthesis of Dictyostelium differentiation-inducing factor 1

Article abstract of DOI:10.1073/pnas.1001681107

Differentiation-inducing factor 1 (DIF-1) is a polyketide-derived morphogen which drives stalk cell formation in the developmental cycle of Dictyostelium discoideum. Previous experiments demonstrated that the biosynthetic pathway proceeds via dichlorinati

Full text of DOI:10.1073/pnas.1001681107

A flavin-dependent halogenase catalyzes the
chlorination step in the biosynthesis of
Dictyostelium differentiation-inducing factor 1
a
a,1
b
Christopher S. Neumann , Christopher T. Walsh , and Robert R. Kay
a
b
Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, MA 02115; and Division of
Cell Biology, Medical Research Council Laboratory of Molecular Biology, Hills Road, Cambridge CB2 OQH, UK
Contributed by Christopher T. Walsh, February 12, 2010 (sent for review January 12, 2010)
Differentiation-inducing factor 1 (DIF-1) is a polyketide-derived
morphogen which drives stalk cell formation in the developmental
cycle of Dictyostelium discoideum. Previous experiments demon-
strated that the biosynthetic pathway proceeds via dichlorination
of the precursor molecule THPH, but the enzyme responsible for
this transformation has eluded characterization. Our recent studies
on prokaryotic flavin-dependent halogenases and insights from
Fig. 1. The chemical structure of DIF-1.
the sequenced Dd genome led us to a candidate gene for this trans-
formation. In this work, we present in vivo and in vitro evidence
that chlA from Dd encodes a flavin-dependent halogenase capable
of catalyzing both chlorinations in the biosynthesis of DIF-1. The
results provide in vitro characterization of a eukaryotic oxygen-
dependent halogenase and demonstrate a broad reach in biology
for this molecular tailoring strategy, notably its involvement in the
differentiation program of a social amoeba.
reproduction, so the individual cells responding to the DIF-1
signal are sacrificed for the reproductive benefit of the overall
community, representing an interesting case of evolved altruism.
DIF-1 biosynthesis and activity has been a long-standing topic of
interest due to its essential role in the proper developmental
program of Dictyostelium. DIF-1 has also garnered interest as
a lead compound with various biological activities in mammalian
cells (12–14).
Dictyostelium development ∣ enzymatic halogenation ∣ polyketide ∣
natural products
Early studies in Dictyostelium helped to define a three-step
biosynthetic pathway for production of DIF-1 (15). Formation
of the core polyketide (2,4,6-trihydroxyphenyl)-1-hexan-1-one
(THPH) is followed in order by dichlorination of the aromatic
ring and O-methylation. The first and last steps of this pathway
have been well characterized. In 2006, the Kay and Noel labora-
tories reported a unique Type I-Type III fused polyketide
synthase, StlB, which is responsible for production of THPH
(16). In vitro, the purified Type III domain was observed to
catalyze formation of THPH from hexanoyl-CoA and three mo-
lecules of malonyl-CoA. Previously, the Kay laboratory identified
dmtA as the gene encoding the O-methyltransferase (10). Puri-
fied DmtA protein was shown to methylate both monochloro-
econdary metabolites are widely produced by microorgan-
S
isms, ostensibly as defensive molecules to inhibit the growth
of competitors in the natural environment. Though antibiosis is a
widely appreciated effect of this secondary metabolism, there is a
developing understanding that such molecules can also modulate
more complex inter- and intraspecies interactions (1–3). For in-
stance, quorum sensing molecules secreted by various bacterial
species serve as indicators of local population density and mod-
ulate coordinated responses (e.g., luminescence, virulence) in
appropriate environmental conditions (4). Bacillus subtilus has
also been shown recently to generate a paracrine signal, using
the small molecule surfactin to induce differentiation of a subset
of cells during biofilm formation (5).
−
−
and dichloro-THPH. Both stlB and dmtA strains form irregular
slug and fruiting body structures, defining a “DIF-less” pheno-
type (10, 16).
Social amoebas, represented by the model species Dictyoste-
lium discoideum, also use a sophisticated system of chemical
messengers in the regulation of their unique life cycle (6, 7).
In nutrient-rich conditions, Dictyostelium exists as single-cell
amoeba which grow and reproduce by binary fission. Starvation
of the solitary amoeba induces a cAMP-mediated aggregation
response to initiate a multicellular stage of development. Aggre-
gated cells first form an undifferentiated mound comprised of up
Chlorination is an essential step in the maturation of DIF-1.
Not only is chlorination of THPH a prerequisite for methylation
by DmtA (15), but DIF-1 is 25 times more potent than its mono-
chloro analogue (the known metabolite DIF-3) in inducing stalk
cell differentiation (17). The chlorination of THPH has only been
observed as an enzymatic activity in crude lysates of Dictyostelium
(15). Chlorinating activity is low in vegetative cells but rises
substantially at the end of aggregation, mimicking the rise in en-
zymatic activity seen for the methyltransferase. The chlorinase
activity requires components from both the cytosolic and mem-
brane/organelle fractions of the preparation, with the soluble
component likely being a small molecule (R.R.K., unpublished).
The enzymatic activity was stimulated by very high levels (50 mM)
5
to 10 cells. This grouping of cells then reorganizes into a motile
slug form by which point cells show clear evidence of differentia-
tion towards stalk or spore formation. After migrating along
chemical, thermal, and light gradients to the soil surface, the or-
ganism completes its development into a fruiting body in which
the sorus composed of reproductive spores is lifted above the
substrate by a cellulose-rich stalk structure.
Author contributions: C.S.N., C.T.W., and R.R.K. designed research; C.S.N. and R.R.K.
performed research; C.S.N., C.T.W., and R.R.K. analyzed data; and C.S.N., C.T.W., and
R.R.K. wrote the paper.
Small molecule signals have been shown to mediate multiple
steps in this developmental process. Differentiation-inducing
factor 1 (DIF-1, Fig. 1) was one of the first morphogens to be
identified in Dictyostelium (8, 9). It rapidly induces prestalk-
specific gene transcription in responsive cells and is the primary
signal directing the differentiation of cells into the prestalk-O
The authors declare no conflict of interest.
1
To whom correspondence should be addressed. E-mail: Christopher_Walsh@hms.
harvard.edu.
This article contains supporting information online at www.pnas.org/cgi/content/full/
1001681107/DCSupplemental.
(pstO) lineage (10, 11). The stalk cells are not competent for
5
798–5803 ∣ PNAS ∣ March 30, 2010 ∣ vol. 107 ∣ no. 13
www.pnas.org/cgi/doi/10.1073/pnas.1001681107

of hydrogen peroxide, leading to an initial hypothesis that a chlor-
operoxidase enzyme was responsible for this transformation.
Since these initial results, the sequencing of the Dictyostelium
genome (18) and advances in the understanding of enzymatic
halogenation have allowed new insight into this critical step in
DIF-1 biosynthesis.
tion coincides with these events, we collected RNA from devel-
oping cells at consecutive points in the developmental process.
RT-PCR was used to detect the presence of transcripts corre-
sponding to chlA as well as the known genes stlB and dmtA
(Fig. 2). Transcription of chlA is up-regulated during early
development in synchrony with stlB and dmtA. Low levels of chlA
transcription were also observed at 0 and 4 h consistent with a
previous observation that lysates of undeveloped cells exhibit very
weak in vitro chlorinating activity (15).
Studies of halogenated natural products from microbial
sources have recently defined a new family of O -and flavin-
2
dependent halogenases which are distinct from the peroxide-
dependent haloperoxidases characterized many years ago in fungi
(19). The mechanism of halogenation is initiated by reaction of
Purification and Biochemical Analysis of ChlA. In order to character-
ize the enzymatic activity of ChlA, the protein was targeted for
overproduction and purification. Because of initial solubility pro-
blems in Escherichia coli, we pursued purification by homologous
overexpression in Dictyostelium. The native gene was cloned from
genomic DNA and inserted into the pTX-FLAG expression
vector (30) with N-terminal FLAG and C-terminal c-myc tags
for affinity purification. Expression in this vector is under the con-
trol of the constitutive actin15 promoter. Electroporation and
G418 selection provided a polyclonal population of transfor-
mants expressing soluble ChlA during axenic growth as evidenced
by Western blot (Fig. S1A). The observed solubility of the protein
here contrasts with the previous studies which suggested the
protein component of the chlorinase activity was located in
the insoluble/organelle fraction of the crude lysate. It is possible
that the native protein expressed during development is localized
to a specific organelle or otherwise processed in such a way as to
associate with insoluble membranes. Overproduction and/or epi-
tope tagging of the protein could be affecting any such process.
Large-scale growth followed by lysis and immunoaffinity purifica-
tion with an anti-FLAG resin provided partially purified ChlA
for biochemical analysis (Fig. S1B). The ChlA K86A mutant, de-
ficient in the conserved catalytic lysine residue, was generated by
site-directed mutagenesis and purified by the identical procedure.
Studies of prokaryotic halogenases have established the
reduced flavin cofactor with molecular oxygen in one enzyme ac-
tive site. The bridgehead peroxyflavin thus generated reacts with
chloride ion to produce hypochlorous acid which diffuses through
a tunnel approximately 10 Å in length to a second active site (20).
In this site, hypochlorous reacts first with a conserved lysine
residue to generate a metastable lysine-chloramine; it is this
þ
chloramine species which serves as the proximal donor of Cl
to an electron rich substrate (21). Genes for flavin-dependent
halogenases are found in a number of prokaryotic and fungal
biosynthetic gene clusters for secondary metabolites. These com-
pounds include a wide variety of antibacterials (e.g. chlortetracy-
cline), antifungals (e.g., kutznerides), and anticancer agents (e.g.,
rebeccamycin) (22–24). In vitro biochemical characterization has
been performed on prokaryote-derived enzymes which act on
amino acids (either free in solution or bound to carrier proteins),
though genetic and bioinformatic approaches have implicated
these halogenases in the tailoring of diverse polyketide and
eukaryote-derived natural products as well (25, 26).
Sequencing of the Dictyostelium genome allowed identification
of a putative flavin-dependent halogenase which we have termed
chlA (27). In consideration of the two-component nature of the
crude enzymatic activity, the genomic clustering of chlA with stlB
(
see below), and the sequence homology of ChlA to known
halogenases, we hypothesized that ChlA is responsible for the
dichlorination of THPH in the biosynthesis of DIF-1. Through
a combination of in vitro and in vivo experiments, this study
shows that ChlA is the essential halogenase in DIF-1 biosynthesis
and that it employs the same mechanistic logic used by prokar-
yotic halogenases. In doing so, we demonstrate that this enzy-
matic machinery plays an essential role in the biosynthesis of
signaling molecules to direct the developmental program of a
eukaryotic organism.
requirement for FADH, O , and chloride ion for catalysis. The
2
halogenase activity of ChlA was successfully reconstituted in
an in vitro assay comprising these reagents. Reduced flavin cofac-
tor was provided by in situ reduction of FAD by the NAD(P)H-
dependent flavin reductase SsuE from E. coli (31), although
halogenase activity was also observed in the absence of SsuE, pre-
sumably stimulated by an unknown copurifying flavin reductase.
Treatment of THPH with ChlA for 2 h at room temperature
afforded a substoichiometric amount of a new compound whose
HPLC retention time and UV spectrum (λmax ¼ 286 nm) match
that of synthetic (3-chloro-2,4,6-trihydroxyphenyl)-1-hexan-1-one
Results and Discussion
Genetic Context and Transcription of chlA. The chlA gene
(DDB_G0290825 at dictyBase, http://dictybase.org/) is located
(
Cl-THPH, Fig. S2). Further analysis of the reaction mixture by
high resolution liquid chromatography-mass spectrometry
LCMS) confirmed the identity of Cl-THPH based on its reten-
on chromosome 5 adjacent to stlB, and divergently transcribed
from it, with 2.7 kb of intervening noncoding sequence. There
are no introns present in chlA and the GC content is 31%,
consistent with overall gene GC content of 27% in Dictyostelium.
A highly similar gene (79% amino acid identity) is present in the
genome of Dictyostelium purpureum, a dictyostelid which may also
use DIF-1 as a morphogen.
(
−
tion time, molecular weight (½M-Hꢀ ¼ 257.0580, 0.39 ppm
error), and isotopic distribution (Fig. 3A). A trace amount of
(
3,5-dichloro-2,4,6-trihydroxyphenyl)-1-hexan-1-one (Cl -THPH,
2
−
½
M-Hꢀ ¼ 291.0183, 2.7 ppm error) was also detected, though the
A restriction-enzyme-mediated insertional mutant at the chlA
locus (V31853) was previously identified in a genetic screen for
developmental phenotypes and was reported to show aberrant
aggregation, cAMP wave formation, slug motility, and culmina-
tion (28). As part of a detailed phylogenetic analysis of
halogenases involved in cyanopeptolin and aeruginosin biosynth-
esis, Cadel-Six et al. have previously described the close sequence
relationship of ChlA to known and predicted prokaryotic halo-
genases (29).
Up-regulation of stlB and dmtA transcription has been
observed during development, coinciding with the first finger-
slug developmental stages and production of DIF-1 (10, 16).
Enzymatic chlorinating activity has also been shown to reach a
maximum at this time. To assess if the activation of chlA transcrip-
Fig. 2. RT-PCR analysis shows transcription of chlA is up-regulated along
with stlB and dmtA at 7–9 h of development. lg7 (mitochondrial large rRNA)
and total rRNA serve as PCR and loading controls, respectively.
Neumann et al.
PNAS
∣
March 30, 2010
∣
vol. 107
∣
no. 13
∣
5799

Fig. 3. Extracted ion chromatograms for in vitro activity of ChlA. (A) Conversion of THPH (red, truncated) to Cl-THPH (blue) is catalyzed by ChlA, but not the
−
ChlA K86A mutant. Inset MS shows observed spectrum for Cl-THPH (½M-Hꢀ : predicted ¼ 257.0581, observed ¼ 257.0580, 0.39 ppm error). (B) Conversion of
−
Cl-THPH (blue, truncated) to Cl2-THPH (green). Inset MS shows observed spectrum for Cl2-THPH (½M-Hꢀ : predicted ¼ 291.0191, observed ¼ 257.0183, 2.7 ppm
error).
intensity of higher molecular weight isotopomers was insufficient
to establish the distribution ratio. We reasoned that the trace
Ax2 strain produces a detectable amount of the DIF-1 compound
whereas the mutant strains are completely deficient in chlori-
nated compounds (Fig. 4, lanes 1 and 3).
formation of Cl -THPH resulted from the low concentration
2
−
of the Cl-THPH intermediate, likely far below its K . To verify
A possible explanation for the failure of the chlA mutant to
m
that ChlA is indeed capable of catalyzing the second halogena-
tion event, we separately incubated purified enzyme with high
make DIF is that the adjacent stlB gene, or its promoter, is
inadvertently disrupted, thus blocking THPH production. To rule
−
−
levels (500 μM) of Cl-THPH. In this case Cl -THPH was readily
out this scenario, chlA and stlB (HM1154) strains were plated
36
2
−
detected by LCMS (Fig. 3B) and matched the spectral data for
the synthetic standard. When ChlA K86A was tested there was no
increase in product formation relative to no-enzyme control re-
actions, consistent with the proposed role of Lys-86 chloramine
formation (Fig. 3). Additional control experiments were run in
the absence of exogenous NADH and FAD and showed no for-
mation of chlorinated products confirming the requirement for
these redox cofactors.* Insolubility of the THPH and Cl-THPH
as single and mixed populations and labeled with Cl . Indivi-
−
−
dually, the chlA and stlB strains are deficient in production
of DIF-1, but codevelopment of the two strains restores produc-
tion of DIF-1 (Fig. 4, lanes 2–4). Because of the cell-permeable
−
nature of these metabolites, we can conclude that the chlA strain
−
is capable of producing THPH while the stlB strain is capable of
using this substrate to synthesize Cl -THPH. In this way, the two
2
strains are able to complement each other and reconstitute a fully
functional DIF-1 biosynthetic pathway. Additionally, inclusion of
THPH in the agarose substratum restores DIF-1 production in
substrates above 500 μM prevented accurate measurement of K
m
values, but we estimate them to be in the 200–400 μM range.
Because of the slow conversion of THPH into either Cl-THPH
−
−
stlB but not chlA strains (Fig. S4).
or Cl -THPH, we sought further evidence to verify that product
2
To demonstrate the in vivo activity of cloned ChlA, we trans-
formation is enzyme dependent. In a time course experiment,
yield was dependent on length of incubation in a roughly linear
fashion consistent with steady state enzymatic behavior (Fig. S3).
The reason for the low enzymatic activity is not clear at this point
in our studies. It is possible that the coupling efficiency between
the heterologous flavin reductase and halogenase is not optimal
in these in vitro reactions; in vivo, the unidentified flavin reduc-
tase endogenous to Dictyostelium might be more effective in
channeling the reduced cofactor into the halogenase active site.
Alternatively, it is possible that only a fraction of the purified
enzyme is catalytically active. Nonetheless, the data support
our initial hypothesis that ChlA is capable of catalyzing both
chlorination events in the biosynthesis of DIF-1.
−
formed the chlA strain with the expression plasmids used for
protein purification. Expression of wild-type ChlA restored the
36
−
production of DIF-1 as evidenced by Cl radio-TLC, whereas
expression of the ChlA K86A mutant failed to restore DIF-1
biosynthesis (Fig. 4, lanes 5–6). These results provide additional
confirmation that a deficiency in ChlA disrupts DIF-1 biosynth-
esis and that K86 is an essential residue for catalysis.
In Vivo Analysis of DIF-1 Production. To directly assess the role of
ChlA in production of DIF metabolites in Dictyostelium, the gene
was targeted by homologous recombination to produce a large
internal deletion, spanning amino acids 18-273, and thus includ-
ing the essential residue K86. Two individual blasticidin resistant
clones of the desired genomic structure were verified by PCR
3
6
−
analysis. Developing cells were labeled with Cl to permit
identification of chlorinated metabolites by autoradiography.
Organic-soluble metabolites were extracted after 16–17 h of
development, at the slug/early culminate stage, and analyzed
by radio-TLC. In each of three separate trials, the parental
Fig. 4. Radio-TLC analysis of DIF-1 production in vivo. The knockout strain
chlA (HM1522) is unable to produce detectable DIF-1 during development,
−
unlike its wild-type parent, Ax2. Complementation can be achieved by
codeveloping with a stlB strain (HM1154) or by expression of ChlA, but
not by expression of ChlA K86A.
*
We attempted to stimulate the in vitro reaction by addition of hydrogen peroxide as had
been done in the original experiments with crude lysates but observed a decrease in ChlA
activity. The reason for this discrepancy is a subject of ongoing experimentation.
−
5
800
∣
www.pnas.org/cgi/doi/10.1073/pnas.1001681107
Neumann et al.

Fig. 5. The developmental phenotype of a chlA− mutant. Slugs formed by the mutant (HM1522) are elongated and fragile, breaking apart shortly after
touching down on the agar surface (A–C). Wild-type Ax2 slug morphology (D) is recovered in the mutants by supplementing the agar with 100 nM DIF-1
(
E), but not with the halogenase substrate THPH (F).
Developmental Phenotype of chlA . Analyses of stlB and dmtA−
strains have previously defined a “DIF-less” phenotype asso-
ciated with disruption of the DIF biosynthetic pathway (10, 16,
−
−
of development. The chlorination of THPH and Cl-THPH can
be reconstituted in vitro using purified ChlA protein. Lysine-
86 has been identified as an essential catalytic residue, consistent
with the lysine-chloramine model of halogenation proposed for
this family.
3
2, 33). The chlA− strain exhibits the same deficiencies in slug
structure and fruiting body formation seen in these other strains.
Most notably, mutant cells reproducibly form elongated slugs that
often break apart shortly after touching down on the substrate
In vivo, disruption of chlA leads to the characteristic DIF-less
phenotype of fragile slug formation and collapsed fruiting bodies.
More directly, the synthesis of DIF-1 and related metabolites is
also inhibited by this mutation. ChlA deficiency can be comple-
(
Fig. 5 A–C). In addition, spore cells are unable to properly as-
cend the weakened stalk and the collapsed fruiting body struc-
tures lead to a disheveled appearance at the end of development.
Development of the mutant strains on agar containing 100 nM
DIF-1 restores wild-type slug morphology to the strains (Fig. 5 D
and E), suggesting that a deficiency in this metabolite is respon-
sible for the observed phenotype. In addition, development in
−
mented by codevelopment with a stlB mutant, by development
on agar containing DIF-1 or Cl2-THPH, and by transformation
with an expression plasmid for ChlA. These experiments there-
fore draw direct links between the biochemistry of ChlA seen in
vitro, the in vivo production of DIF-1, and the physiological
process of Dictyostelium development.
the presence of Cl -THPH also rescues wild-type development,
2
demonstrating that this intermediate lies downstream of the
blocked step in DIF-1 biosynthesis (Fig. S5). When developed
in the presence of 100 nM THPH, the mutant cells retain the
fragile slug phenotype (Fig. 5F), again indicating that disruption
of the adjacent stlB gene is not responsible for the DIF-less
phenotype seen in HM1522.
This study also serves to complete the molecular characteriza-
tion of the DIF-1 biosynthetic pathway (Fig. 6). The three-step
process first proposed is now shown to be composed of THPH
formation by an unusual Type I-Type III polyketide synthase StlB,
dichlorination by the flavin-dependent halogenase ChlA, and
O-methylation by DmtA. Biochemically, the characterization
of ChlA provides a foundation for the further analysis of
polyketide halogenases. Upon optimization of expression and
As a final test of our hypothesis, we evaluated the developmen-
−
tal phenotype of the chlA strain transformed with expression
vectors containing the epitope-tagged chlA gene or the gene en-
coding for the K86A mutant (Fig. S5). Expression of the wild-type
gene restored proper slug development and fruiting body forma-
tion, whereas the K86A mutant retained the DIF-less phenotype.
In addition to verifying that the chlA gene alone is sufficient to
restore normal development, these data suggest that the tagged
construct achieves sufficient activity in vivo to allow critical flux
through the DIF pathway.
Conclusions
The biochemical basis for halogenation of DIF-1 has remained
poorly defined since the first enzymatic activity was detected
in crude lysates (15). The combination of in vitro and in vivo
experiments in this study conclusively demonstrate that both
chlorination events in this pathway are carried out by the fla-
vin-dependent halogenase ChlA. The chlA gene is clustered with
stlB, the polyketide synthase involved in THPH formation, the
first step in DIF-1 biosynthesis. Increased transcription of chlA
coincides with rises in stlB and dmtA transcription at ∼9–11 h
Fig. 6. The complete molecular-level description of the DIF-1 biosynthetic
pathway, consisting of StlB-mediated polyketide formation, ChlA-mediated
dichlorination, and DmtA mediated O-methylation.
Neumann et al.
PNAS
∣
March 30, 2010
∣
vol. 107
∣
no. 13
∣
5801

2L portions to 2–3 × 106 cells∕ml and harvested by centrifugation at 500 g.
Cells were resuspended in 4 ml∕g (wet weight) of lysis buffer (20 mM HEPES,
reconstitution methods we can further explore kinetic parameters
and substrate specificity, with an eye towards manipulating spe-
cificity determinants for the generation of novel analogues.
Finally, our results illustrate the broad reach of halogenation
chemistry in biological systems by showing that a flavin-
dependent halogenase plays an essential role in the maturation
of a chemical signal for cell differentiation in a eukaryotic
organism. It serves as a reminder that, beyond defensive roles
in competitive environments, small “secondary” metabolites
can serve as vital signals for essential biological processes in
higher organisms.
3
00 mM NaCl, pH 7.5). A protease inhibitor cocktail (Roche) was added to 1X
according to manufacturer instructions. Cells were lysed by two passes
through a cell disruptor at 10,000–15,000 psi and the lysate cleared by cen-
trifugation at 35,000 rpm for 35 min. The lysate was incubated with anti-
FLAG M2-agarose conjugate (Sigma) for 2 h at 4 °C. The resin was washed
with lysis buffer until the A280 of eluent was below 0.03. Bound protein
was eluted with 200 ng∕μl 3X FLAG peptide (Sigma). The resin was washed
with 0.1 M glycine pH 3.5 and reequilibrated with lysis buffer. The flow
through from the first round of purification was reused for a second round
and the two batches combined. The eluted protein was washed with ∼3 vo-
lumes of lysis buffer and passed through a 30 kD molecular weight cutoff
filter to reduce the concentration of 3X FLAG peptide. Concentrated protein
was then flash frozen and stored at −80 °C until use. Protein yields were
approximately 0.7 mg per liter of culture; total protein concentration was
estimated by A280 measurement.
Materials and Methods
Dictyostelium Growth and Manipulation. Dictyostelium strains Ax2 (Kay
laboratory, Dictyostelium Stock Center ID DBS0235521) and Ax4 were
propagated on lawns of Klebsiella aerogenes or axenically in HL5 medium
according to standard published protocols (34). Genomic DNA was isolated
by phenol:chloroform extraction (35). Cloning vectors were propagated in
E. coli Top-10 cells (Invitrogen). PCR reactions were performed using Phusion
High Fidelity polymerase in 50 ul reaction volumes. The chlA gene was
amplified using primers ATTATTCGAGCTCATGGATACAAATATTATTAATC
In Vitro Assay of ChlA Activity. THPH was synthesized according to the method
of Masento et al. (38); Cl-THPH, and Cl2-THPH were synthesized according to
the method of Gokan et al. (39). A typical assay was run in 20 mM HEPES,
1
1
50 mM NaCl, pH 7.5 with 67 μM ChlA, 4.5 μM SsuE, 10 mM NADH,
00 μM FAD, and 500 μM substrate (either THPH or Cl-THPH). ChlA concen-
(
forward) and ATTATTCGAGCTCATACTTCCAATCAACAATATTATT (reverse), di-
gested with SacI (sites underlined), and ligated into SacI-digested pTX-FLAG
vector (30) to provide N-terminal FLAG and C-terminal c-myc tags. The ex-
pression vector for ChlA K86A was constructed by PCR-mediated site-directed
mutagenesis of the wild-type expression vector with primers ATAGAGAAT-
CATCCACCAGCATTTTCATTACAATTTCAT and ATGAAATTGTAATGAAAATGCT-
GGTGGATGATTCTCTAT (Ala codons underlined). Plasmids were transformed
into Dictyostelium by electroporation in H50 buffer (36). Development of Dic-
tration is reported as the upper limit, calculated by assuming 100% purity.
Final reaction volumes were 10–20 μl. Reactions were quenched by dilution
with 300 μl buffer followed by immediate extraction with three portions of
3
00 μl EtOAc. The organic extract was dried and redissolved in 75 μl 5%
DMSO. HPLC analysis was carried out on a Beckman instrument equipped
with a Phenomenex Luna C18 column and diode array detector using a
gradient of acetonitrile in water with 0.1% TFA as modifier. LCMS analysis
was carried out on an Agilent 1200 series HPLC interfaced to an Agilent
7
tyostelium strains was induced by plating ∼4 × 10 cells on KK2 (20 mM
K1K2PO4, pH 6.2) plates supplemented with 0.1 mM CaCl2 and 2 mM
6
250 Q-TOF. Chromatography was run on a Phenomenex Gemini-NX C18
MgSO . Developmental structures were visualized and photographed on
4
column using a gradient of acetonitrile in water with 0.1% formic acid
modifier and mass spectra were collected in the negative mode. LCMS data
was analyzed with MassHunter Qualitative Analysis software (Agilent).
an Olympus SZX12 stereomicroscope equipped with a Olympus HC-300z/
OL digital camera. RNA was isolated using the RNeasy mini kit (Qiagen).
RT-PCR was carried out with the Thermoscript reverse transcriptase and
Platinum Taq polymerase (Invitrogen). Primers for stlB, dmtA, and lg7 were
previously reported (16); primers for chlA were GTCAAGATGTGA-
CATGCTCTTGGAC (forward) and TGACCACCTCTATGATTATCCATGAATCC (re-
verse). The chlA knockout strain was generated by homologous
recombination using plasmid pRRK2, which is based on plasmid pLPBLP
Radio-TLC Analysis of Chlorinated Metabolites. 36Cl− radio-TLC experiments
were carried out as previously described (15). Briefly, cells were allowed to
develop on an agar surface (1.8% electrophoresis-grade agarose) containing
10% DIFlab (100% is 12 mM KH2PO4, 8 mM Na2HPO4), 0.1 mM MgSO4 at pH
−
1
36
−
(
1
37) and has a blasticidin resistance cassette flanked by approximately
.6 kb on either side of genomic sequence at the locus (CCCCAAATTTTATCT
6.7, with 0.05 or 0.1 μCi ml
Cl . After 16–17 h of starvation, cells were
harvested and organic components extracted by the method of Bligh and
Dyer (26). TLC was performed on activated Whatman LK6D silica plates
developed with 60∕40∕2 ethyl acetate/hexane/acetic acid. Radio-labeled
compounds were detected by exposure to phosphor imager plates in a lead
box to reduce background.
to GTTGTATTTTCAATT in the genome) and produces a deletion of amino
acids 18-273. Two resistant clones (HM1522, HM1523) were verified to be
−
chlA by multiple PCR analyses and showed identical developmental and la-
beling phenotypes. HM1522 was used for the experiments presented herein.
Overproduction and Purification of ChlA. Expression constructs in pTX-FLAG
for ChlA and ChlA K86A were transformed into Dictyostelium Ax4 and main-
tained under constant selection with 20 μg∕mL G418. Expression of protein
was confirmed by Western blotting with anti-FLAG and anti-c-myc antibodies
conjugated to horseradish peroxidase. For purification, cells were grown in
ACKNOWLEDGMENTS. We thank Prof. Ralph Isberg and Ms. Tamara O’Conner
(
Tufts University) for providing strain Ax4 and technical assistance to C.S.N.,
and Dr. Michael Myre (Massachusetts General Hospital) for plasmid
pTX-FLAG. This work was supported by National Institutes of Health Grant
GM20011 (to C.T.W.) and core funding from the MRC (R.R.K.).
1
2
3
4
5
6
7
8
. Camilli A, Bassler BL (2006) Bacterial small-molecule signaling pathways. Science
12. Kubohara Y (1999) Effects of differentiation-inducing factors of Dictyostelium
3
11:1113–1116.
discoideum on human leukemia K562 cells: DIF-3 is the most potent anti-leukemic
agent. Eur J Pharmacol 381:57–62.
. Shank EA, Kolter R (2009) New developments in microbial interspecies signaling. Curr
Opin Micrbiol 12:205–214.
. Yim G, Huimi Wang H, Davies Frs J (2007) Antibiotics as signalling molecules. Philos T
Roy Soc B 362:1195–1200.
. Antunes LCM, Ferreira RBR (2009) Intercellular communication in bacteria. Crit Rev
Microbiol 35:69–80.
. López D, Vlamakis H, Losick R, Kolter R (2009) Paracrine signaling in a bacterium.
Genes Dev 23:1631–1638.
13. Myre MA, et al. (2009) Reduced amyloidogenic processing of the amyloid beta-protein
precursor by the small-molecule differentiation inducing factor-1. Cell Signal
2
1:567–576.
1
4. Omata W, et al. (2007) Dictyostelium differentiation-inducing factor-1 induces glucose
transporter 1 translocation and promotes glucose uptake in mammalian cells. FEBS J
2
74:3392–3404.
1
1
5. Kay RR (1998) The biosynthesis of differentiation-inducing factor, a chlorinated signal
molecule regulating Dictyostelium development. J Biol Chem 273:2669–2675.
6. Austin MB, et al. (2006) Biosynthesis of Dictyostelium discoideum differentiation-
inducing factor by a hybrid type I fatty acid-type III polyketide synthase. Nat Chem
Biol 2:494–502.
. Chisholm RL, Firtel RA (2004) Insights into morphogenesis from a simple developmen-
tal system. Nat Rev Mol Cell Biol 5:531–541.
. Kessin RH (2001) Dictyostelium: Evolution, Cell Biology, and the Development of
Multicellularity (Cambridge Univ Press, Cambridge, UK).
. Morris HR, Taylor GW, Masento MS, Jermyn KA, Kay RR (1987) Chemical structure of
the morphogen differentiation inducing factor from Dictyostelium discoideum.
Nature 328:811–814.
1
1
7. Insall R, Kay RR (1990) A specific DIF binding protein in Dictyostelium. EMBO J
9
:3323–3328.
8. Eichinger L, et al. (2005) The genome of the social amoeba Dictyostelium discoideum.
9
. Town CD, Gross JD, Kay RR (1976) Cell differentiation without morphogenesis in
Dictyostelium discoideum. Nature 262:717–719.
Nature 435:43–57.
1
1
0. Thompson CR, Kay RR (2000) The role of DIF-1 signaling in Dictyostelium development.
Mol Cell 6:1509–1514.
1. Williams JG, et al. (1987) Direct induction of Dictyostelium prestalk gene expression by
DIF provides evidence that DIF is a morphogen. Cell 49:185–192.
19. Neumann CS, Fujimori DG, Walsh CT (2008) Halogenation strategies in natural product
biosynthesis. Chem Biol 15:99–109.
20. Dong C, et al. (2005) Tryptophan 7-halogenase (PrnA) structure suggests a mechanism
for regioselective chlorination. Science 309:2216–2219.
5
802
∣
www.pnas.org/cgi/doi/10.1073/pnas.1001681107
Neumann et al.

2
2
2
2
2
2
2
1. Yeh E, Blasiak LC, Koglin A, Drennan CL, Walsh CT (2007) Chlorination by a long-lived
intermediate in the mechanism of flavin-dependent halogenases. Biochemistry
30. Levi S, Polyakov M, Egelhoff TT (2000) Green fluorescent protein and epitope tag
fusion vectors for Dictyostelium discoideum. Plasmid 44:231–238.
4
6:1284–1292.
31. Eichhorn E, van der Ploeg JR, Leisinger T (1999) Characterization of a two-component
alkanesulfonate monooxygenase from Escherichia coli. J Biol Chem 274:26639–26646.
2. Dairi T, Nakano T, Aisaka K, Katsumata R, Hasegawa M (1995) Cloning and nucleotide
sequence of the gene responsible for chlorination of tetracycline. Biosci Biotechnol
Biochem 59:1099–1106.
3. Heemstra JR, Walsh CT (2008) Tandem action of the O2- and FADH2-dependent
halogenases KtzQ and KtzR produce 6,7-Dichlorotryptophan for kutzneride assembly.
J Am Chem Soc 130:14024–14025.
4. Yeh E, Garneau S, Walsh CT (2005) Robust in vitro activity of RebF and RebH, a
two-component reductase/halogenase, generating 7-chlorotryptophan during
rebeccamycin biosynthesis. Proc Natl Acad Sci USA 102:3960–3965.
5. Wang S, et al. (2008) Functional characterization of the biosynthesis of radicicol, an
Hsp90 inhibitor resorcylic acid lactone from Chaetomium chiversii. Chem Biol
3
2. Rieu JP, Saito T, Delanoe-Ayari H, Sawada Y, Kay RR (2009) Migration of Dictyostelium
slugs: Anterior-like cells may provide the motive force for the prespore zone. Cell Motil
Cytoskeleton 66:1073–1086.
3
3
3. Saito T, Kato A, Kay RR (2008) DIF-1 induces the basal disc of the Dictyostelium fruiting
body. Dev Biol 317:444–453.
4. Fey P, Kowal AS, Gaudet P, Pilcher KE, Chisholm RL (2007) Protocols for growth and
development of Dictyostelium discoideum. Nat Protoc 2:1307–1316.
35. Pilcher KE, Fey P, Gaudet P, Kowal AS, Chisholm RL (2007) A reliable general purpose
method for extracting genomic DNA from Dictyostelium cells. Nat Protoc 2:1325–1328.
36. Gaudet P, Pilcher KE, Fey P, Chisholm RL (2007) Transformation of Dictyostelium
discoideum with plasmid DNA. Nat Protoc 2:1317–1324.
1
5:1328–1338.
6. Winter JM, et al. (2007) Molecular basis for chloronium-mediated meroterpene
cyclization: Cloning, sequencing, and heterologous expression of the napyradiomycin
biosynthetic gene cluster. J Biol Chem 282:16362–16368.
7. Vaillancourt FH, Yeh E, Vosburg DA, Garneau-Tsodikova S, Walsh CT (2006) Nature’s
inventory of halogenation catalysts: Oxidative strategies predominate. Chem Rev
3
7. Faix J, Kreppel L, Shaulsky G, Schleicher M, Kimmel AR (2004) A rapid and efficient
method to generate multiple gene disruptions in Dictyostelium discoideum using a
single selectable marker and the Cre-loxP system. Nucleic Acids Res 32:e143.
8. Masento MS, et al. (1988) Differentiation-inducing factor from the slime mould
Dictyostelium discoideum and its analogues. Synthesis, structure and biological
activity. Biochem J 256:23–28.
3
1
06:3364–3378.
2
2
8. Sawai S, Guan X-J, Kuspa A, Cox E (2007) High-throughput analysis of spatio-temporal
dynamics in Dictyostelium. Genome Biol 8:R144.
9. Cadel-Six S, et al. (2008) Halogenase genes in nonribosomal peptide synthetase gene
clusters of Microcystis (Cyanobacteria): Sporadic distribution and evolution. Mol Biol
Evol 25:2031–2041.
39. Gokan N, et al. (2005) Structural requirements of Dictyostelium differentiation-
inducing factors for their stalk-cell-inducing activity in Dictyostelium cells and anti-
proliferative activity in K562 human leukemic cells. Biochem Pharmacol 70:676–685.
Neumann et al.
PNAS
∣
March 30, 2010
∣
vol. 107
∣
no. 13
∣
5803