2-Oxo-histidine-containing dipeptides are functional oxidation products

Article abstract of DOI:10.1074/jbc.RA118.006111

Imidazole-containing dipeptides (IDPs), such as carnosine and anserine, are found exclusively in various animal tissues, especially in the skeletal muscles and nerves. IDPs have antioxidant activity because of their metal-chelating and free radical-scaven

Full text of DOI:10.1074/jbc.RA118.006111

JBC Papers in Press. Published on November 30, 2018 as Manuscript RA118.006111
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.RA118.006111
2
-Oxo-histidine–containing dipeptides are functional oxidation products
1
1
1
2
3
Hideshi Ihara * ♯, Yuki Kakihana ♯, Akane Yamakage , Kenji Kai , Takahiro Shibata ,
4
5, 6
3, 6, 7
Motohiro Nishida , Ken-ichi Yamda , and Koji Uchida
*
1
From the Department of Biological Science, Graduate School of Science, Osaka Prefecture
2
University, Sakai, Osaka 599-8531, Japan; Department of Biological Chemistry, Graduate School
of Life and Environmental Sciences, Osaka Prefecture University, Sakai, Osaka 599-8531, Japan;
3
Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan;
4
Division of Cardiocirculatory Signaling, National Institute for Physiological Sciences, Okazaki 444-
5
8
787, Japan; Physical Chemistry for Life Science Laboratory, Faculty of Pharmaceutical Sciences,
6
Kyushu University, Fukuoka, Japan; Japan Agency for Medical Research and Development, CREST,
Tokyo, Japan; Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo
7
1
13-8657, Japan
Running title: 2-Oxo-IDPs are functional oxidation products
These authors contributed equally to this work.
To whom correspondence should be addressed:
♯
*
Hideshi Ihara: Department of Biological Science, Graduate School of Science, Osaka Prefecture
University, Sakai, Osaka 599-8531, Japan: ihara@b.s.osakafu-u.ac.jp; Tel.81-72-254-9753; Fax. 81-
7
2-254-9163
Koji Uchida: Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo
13-8657, Japan: a-uchida@mail.ecc.u-tokyo.ac.jp; Tel.81-3-5841-5127; Fax. 81-3-5841-8026
1
Keywords: 2-oxo-histidine-containing dipeptides, carnosine, anserine, homocarnosine, antioxidant
activity, neuroprotection, oxidative stress, imidazole, histidine
ABSTRACT
Imidazole-containing dipeptides (IDPs),
(2-oxo-IDPs) in all examined tissues. We noted
enhanced production of the 2-oxo-IDPs in the
brain of a mouse model of sepsis-associated
encephalopathy. Moreover, in SH-SY5Y
human neuroblastoma cells stably expressing
carnosine synthase, H2O2 exposure resulted in
the intracellular production of 2-oxo-carnosine,
which was associated with significant inhibition
of the H2O2 cytotoxicity. Notably, 2-oxo-
carnosine showed a better antioxidant activity
than endogenous antioxidants such as
glutathione and ascorbate. Mechanistic studies
indicated that carnosine monooxygenation is
mediated through the formation of a histidyl-
imidazole radical, followed by the addition of
such as carnosine and anserine, are found
exclusively in various animal tissues, especially
in the skeletal muscles and nerves. IDPs have
antioxidant activity owing to their metal-
chelating and free radical-scavenging properties.
However, the underlying mechanisms that
would fully explain IDPs’ antioxidant effects
remain obscure. Here, using HPLC–
electrospray ionization–tandem MS analyses,
we comprehensively investigated carnosine and
its related small peptides in the soluble fractions
of mouse tissue homogenates and ubiquitously
detected 2-oxo-histidine–containing dipeptides
1

molecular oxygen. Our findings reveal that 2-
oxo-IDPs are metal-catalyzed oxidation
products present in vivo and provide a revised
paradigm for understanding the antioxidant
effects of the IDPs.
Due to the metal-chelating property of the
imidazole ring, histidine is extremely sensitive
to metal-catalyzed oxidation reactions. In the
presence of oxygen and a reducing agent, such
as ascorbate, the binding of metal ions, such as
2
+
copper ion (Cu ), to histidine results in the
facile oxidation of its imidazole ring. The
2
+
The mammalian essential amino acid, L-
histidine, and its methylated derivatives (1- and
reaction involves the reduction of Cu by the
+
reducing agent to generate Cu . The reduced
3
-methylhistidines) are known to be widely and
form of copper ion donates one electron to O to
2
abundantly distributed in mammalian tissues in
their free form or as components of peptides and
proteins. Carnosine (β-alanyl-L-histidine),
which was first discovered over 100 years ago,
is the most well characterized imidazole-
containing dipeptide (IDP). Since then,
carnosine and other IDPs, such as anserine (β-
generate an unidentified reactive oxygen
species, which immediately oxidizes the ligand
itself (histidine). It has been reported that the
metal-catalyzed oxidation of histidine generates
a number of products, including a unique
monooxygenation product, 2-oxo-histidine.(9-
11) The formation of 2-oxo-histidine has been
demonstrated in the peptides and proteins in
vitro and implicated in aging and other
pathological states associated with oxidative
stress (9-11). However, no study has
definitively demonstrated the presence of 2-
oxo-histidine in vivo.
alanyl-3-methyl-L-histidine)
and
homocarnosine (γ-aminobutyryl-L-histidine),
have been observed at high concentrations in
the skeletal muscles and central nervous
systems of many vertebrates (1). The levels of
the IDPs are regulated by metabolic enzymes,
including carnosine synthase (CARNS) (2),
methyltransferase (3), and dipeptidase (4,5),
indicating that IDPs play physiological roles in
the muscle and brain. It has been postulated that
In the present study, we unambiguously
detected 2-oxo-histidine-containing dipeptides
(2-oxo-IDPs) in mouse tissue homogenates
using high performance liquid chromatography
with online electrospray ionization tandem
mass spectrometry (LC-ESI-MS/MS). To the
best of our knowledge, this is the first evidence
for the presence of oxidized peptides containing
2-oxo-histidine in vivo. In addition, using
human neuroblastoma cells stably expressing
CARNS, we demonstrated significant inhibition
carnosine
contributes
significantly
to
physicochemical buffering in skeletal muscles
by neutralizing the lactic acid produced during
anaerobic glycolysis (6). Evidence has also
been found that the peptide may play a role as a
neurotransmitter in olfactory receptor axons (7)
and as a regulator of enzymes (8). In addition to
these functions, carnosine has attracted a lot of
attention as a potential antioxidant due to its
reactivity with reactive oxygen and nitrogen
species, and its potential to form adducts with
deleterious aldehydes and ketones (1).
Carnosine also shows an efficient metal-
chelating property, which may be associated
with its antioxidant activity (1). However, the
exact antioxidant mechanisms of the peptide
remain unknown.
of the H
2
O cytotoxicity and a concomitant
2
increase in the intracellular levels of the 2-oxo-
IDPs. We also found that IDPs gain a free
radical scavenging activity via the oxygenation.
Mechanistic studies of the metal-catalyzed
oxidation of IDPs demonstrate that the mono-
oxygenation of IDPs may be mediated through
the formation of a histidyl radical followed by
the addition of molecular oxygen. These results
reveal new insights into the antioxidant function
of the IDPs.
2

(
Fig. S4) showed that products 3 and 4 were
indistinguishable from β-alanyl-L-2-oxo-
histidine (2-oxo-carnosine) and β-alanyl-3-
Results
Comprehensive analysis of IDPs in mouse
muscle homogenates
methyl-L-2-oxo-histidine
respectively (Fig. 1B).
(2-oxo-anserine),
To simultaneously detect carnosine and
related peptides in vivo, we sought to identify a
common fragment ion from the MS/MS
product-ion analysis of the authentic peptides.
The product-ion analysis of carnosine gave
common fragments at the mass-to-charge ratios
Despite its abundance in the in vitro
oxidized proteins, the presence of 2-oxo-
histidine in vivo has never been demonstrated.
To accurately analyze the endogenous
formation of 2-oxo-IDPs in cells and tissues, we
established a highly sensitive and specific
method for the measurement of 2-oxo-IDPs
using LC-ESI-MS/MS coupled with a stable
isotope dilution method. Collision-induced
dissociation of purified 2-oxo-carnosine
showed relevant products at m/z 89.0 and m/z
(
m/z) of 89 and 72, corresponding to the
cleavage at the peptide bond, and at the N-Cα
bond in the peptide backbone, respectively (Fig.
S1). Similarly, anserine gave the same fragment
ions (Fig. S2). These characteristic common
fragment ions allowed the simultaneous
analysis of carnosine and anserine using LC-
ESI-MS/MS in the multiple reaction monitoring
196.1 (Fig. S5A). The product ions at m/z 89.0
and m/z 196.1 matched values expected to
originate from a β-alanine moiety and 2-oxo-
carnosine, respectively. The identification of
these product ions was supported by the
(
Fig. S3). We then applied this method to the
tissue samples to detect the IDPs. As shown in
Fig. 1A, the IDPs were detected in mouse
muscle along with several unknown peptides.
Identifications were tentatively made by
comparison of the retention time and mass-to-
charge ratio, indicating that the peptides 1 (m/z
observation
that
the
collision-induced
dissociation of the standard isotope-labeled 2-
oxo-carnosine, containing [ C , N] β-alanine,
1
3
15
3
produced relevant product ions at m/z 93.0 and
m/z 198.1 (Fig. S5B). Fig. S5C demonstrates
the result on the standard isotope-labeled
carnosine and non-labeled carnosine using
multiple reaction monitoring (MRM) between
227) and 2 (m/z 241) were identical to carnosine
and anserine, respectively. We also detected six
other peptides: two (peptides 3 and 4) of them
showed molecular ions at m/z 243 and 257
+
the transition from the protonated parent ions
(
[M+H] ), corresponding to a 16-Da increase in
+
[
M + H] to the characteristic daughter ions, m/z
the mass value of carnosine and anserine,
respectively. It was speculated that, because this
change in molecular weight could originate
from the mono-oxygenation of the imidazole
groups, the products might contain an oxo-
imidazole moiety.
247.1→198.1 and m/z 243.1→196.1. This
allowed detection of both the standard isotope-
labeled and non-labeled carnosine, respectively.
The characterization of 2-oxo-anserine and 2-
oxo-homocarnosine was also performed in a
similar way to 2-oxo-carnosine (data not
shown). Parameters for the MRM analysis of
the IDPs and 2-oxo-IDPs are summarized in
Table S1. The LOQ (limit of quantification) for
the 2-oxo-IDPs was 100 fmol on the column
Identification of oxidized IDPs
The formation of 2-oxo-histidine is now
known to be due to the metal-catalyzed
oxidation of histidine (12). Hence, to confirm
the structure of the products, carnosine and
anserine were incubated with ascorbate in the
2
with linearity (r = 0.999 (100−5000 fmol)).
Using the LC-ESI-MS/MS coupled with
a stable isotope dilution method, we analyzed
the IDPs and 2-oxo-IDPs in several mouse
2+
presence of Cu , and the reaction mixtures
were analyzed by LC-ESI-MS/MS. The data
3

tissues. Endogenous carnosine and 2-oxo-
carnosine were co-eluted with the spiked
standards labeled with the stable isotope at the
same retention time (Figs. 2A, B). Results of the
quantitative identification of the IDPs and their
of sepsis, including exhaustion and body-weight
loss, were observed (Fig. 3A). The levels of the
2-thiobarbituric acid reactive substances
(TBARS), a marker of oxidative stress, in the
brain significantly increased 24 h after the
injection of LPS (Fig. 3B), suggesting that
oxidative stress was enhanced in the brains of
the SAE mouse. The brain levels of the IDPs
(carnosine, anserine, and homocarnosine) were
nearly unchanged under these conditions (data
not shown). However, the levels of 2-oxo-
carnosine were transiently elevated 8 h after
injection and returned to the control levels after
24 h (Figs. 3C, D). A similar pattern was also
observed for the other 2-oxo-IDPs, including 2-
2
-oxo products are summarized in Fig. 2C. The
data showed that the levels of 2-oxo-carnosine
were 0.23, 2.1, and 4.8 pmol/mg protein in the
brain, kidney, and muscle, respectively, while
the corresponding levels of carnosine were 1968,
120, and 18921 pmol/mg protein, respectively.
Carnosine was also detected in the lung, heart,
and liver at 86, 224, and 11 pmol/mg protein,
respectively. The percentages of 2-oxo-
carnosine to carnosine were 0.012, 1.8, and
0.025% in the brain, kidney, and muscle,
oxo-anserine
(Fig.
3E)
and
2-oxo-
respectively. 2-Oxo-anserine was detected in all
the tested tissues at 0.11, 0.45, 0.36, 7.0, 0.33,
and 30 pmol/mg protein in brain, lung, heart,
kidney, liver, and muscle, respectively, and the
corresponding levels of anserine were 67, 116,
homocarnosine (Fig. 3F). The transient
increases in 2-oxo-IDPs may relate to their
turnover rates in vivo and may be associated
with the low levels of 2-oxo-IDPs in tissues (Fig.
2). These data are in line with the fact that
oxidative stress occurs in the early stages of
sepsis (13).
65, 211, 17, and 15990 pmol/mg protein,
respectively. 2-Oxo-homocarnosine was
detected only in the brain at 0.89 pmol/mg
protein, consistent with the result that
homocarnosine was mainly detected in the brain
Enhanced production of 2-oxo-carnosine in
CARNS-overexpressed cells exposed to
oxidants
(
570 pmol/mg protein).
To further assess the relationship
between the production of the 2-oxo-IDPs and
oxidative stress, we generated SH-SY5Y cells
stably expressing CARNS (Fig. 4A) and
examined the production of 2-oxo-carnosine
Enhanced production of 2-oxo-IDPs in a
mouse model of sepsis-associated
encephalopathy (SAE)
It has been reported that IDPs show an
antioxidant activity through metal-chelating and
free radical-scavenging mechanisms (1).
Therefore, it was speculated that the presence of
following exposure of the cells to H
2
O
2
. In the
presence of H , the cell lysates of the SH-
2
O
2
SY5Y cells expressing CARNS showed that the
levels of carnosine were approximately 20
nmol/mg protein, which was 240-fold higher
than in the control cell lysates (Fig. 4B). We
then examined the effect of the CARNS
overexpression on the cytotoxicity caused by
2
-oxo-IDPs in vivo might reflect the antioxidant
activity of the IDPs. To assess the involvement
of oxidative stress in the mono-oxygenation of
histidine residues in the IDPs, we quantitatively
analyzed the 2-oxo-IDPs in the brain of a mouse
model of SAE, an acute brain dysfunction
H
2
O
2
. H
2
O showed a toxicity to both the
2
resulting from
a
systemic inflammatory
control and CARNS-expressing cells; however,
the cells overexpressing CARNS were more
response using LC-ESI-MS/MS coupled with
stable isotope dilution methods. After
lipopolysaccharide (LPS) injection, symptoms
resistant to the H
2
O cytotoxicity than the
2
control cells (Fig. 4C). In addition, concomitant
4

to the reduction of the H
enhanced production of 2-oxo-carnosine was
observed (Fig. 4D). To assess the involvement
2
O
2
cytotoxicity, an
preliminary experiments, we examined the
cytoprotective effect of 2-oxo-carnosine at
concentrations ranging from 0 to 400 μM and
observed that 2-oxo-carnosine concentrations
of as low as 50 μM showed significant effect
(data not shown). As shown in Fig. 5C, the
oxidized carnosine was slightly more effective
than its unoxidized form.
of the intracellular H
2
O
2
in the enhanced
production of 2-oxo-carnosine, we examined
the effect of the membrane-permeable PEG-
catalase. We observed that the production of 2-
oxo-carnosine was completely inhibited by
pretreatment with the antioxidant enzyme (Fig.
4
E). A similar cytoprotective effect of the
A mechanism for the conversion of IDPs to 2-
oxo-IDPs
CARNS overexpression was observed in the
rotenone-induced cytotoxicity (Figs. 4F–H).
These data suggest that the production of the 2-
oxo derivatives may reflect the antioxidant
activity of the IDPs.
To gain an insight into the formation of
the 2-oxo-IDPs in vivo, we characterized the
mechanism for the conversion of IDPs to the 2-
2
+
oxo-IDPs by Cu /ascorbate in vitro. As shown
2
+
in Fig. 6A, both Cu and ascorbate were
essential for the formation of 2-oxo-carnosine.
Similar patterns were observed for anserine and
homocarnosine (Fig. S6). To identify the origin
of oxygen in the 2-oxo-imidazole ring, we
Gain of antioxidant function
To establish that the monooxygenation is
involved in the gain of antioxidant function of
the IDPs, we examined the free radical
scavenging activity of carnosine and its
oxidized product (2-oxo-carnosine) using the
Trolox equivalent antioxidant capacity (TEAC)
1
8
18
examined the incorporation of O from
O
2
1
8
and H
2
O in carnosine. As shown in Fig. 6B, 2-
[ O] oxo-carnosine was detected in the reaction
1
8
1
8
18
assay. Carnosine showed
a
negligible
mixture containing
O
2, but not H O,
2
antioxidant activity (TEAC value = 0.0088
µmol/mmol). Strikingly, however, the TEAC of
indicating that oxygen at the C2 position of 2-
oxo-carnosine is derived from molecular
oxygen. This result strongly suggests the
formation of an imidazole radical as the
intermediate.
2
-oxo-carnosine was far greater (35,000-fold)
than that of carnosine (Fig. 5A). In addition, the
oxidized carnosine showed a better free radical
scavenging activity than the endogenous
antioxidants, such as glutathione and ascorbate.
Incubation with the stable radical, 1,1-diphenyl-
To detect the imidazole radical
intermediate, a spin-trapping reagent, 4-amino-
2,2,6,6-tetramethylpiperidinyl-1-oxy (amino-
TEMPO•), which converts radicals into stable
diamagnetic adducts, was used for the mass
spectrometry-based detection of biologically
relevant carbon-centered free radicals. When
2
2
-picrylhydrazyl (DPPH) resulted in the loss of
-oxo-carnosine (Fig. 5B), which was
accompanied by the formation of a product with
+
a molecular ion at m/z of 620 ([M+H] ) (data
2
+
not shown). This change in the molecular
weight corresponds to a 393-Da increase,
accounting for the molecular mass of DPPH, in
the mass value of the unmodified carnosine. The
detailed mechanism of how 2-oxo-carnosine
carnosine was incubated with Cu /ascorbate in
the presence of amino-TEMPO•, a putative
amino TEMPO-carnosine adduct was detected
at m/z 399 (Figs. 7A, B). Collision-induced
dissociation of the adduct produced relevant
product ions at m/z 156.0 and 173.1 (Fig. 7C),
which were consistent with a histidine moiety
and an amino TEMPO moiety, respectively.
The formation of the amino-TEMPO-carnosine
forms
the
product
with
DPPH remains unknown. We also assessed the
cytoprotective effect of 2-oxo-carnosine on the
rotenone-induced neuronal cell death. In our
5

adduct was accompanied by the reduced
formation of 2-oxo-carnosine (Figs. 7D, E),
suggesting that the formation of imidazole
radicals in the IDPs might be an intermediate
step for the production of the 2-oxo derivatives.
These data also support our hypothesis that the
mono-oxygenation of the IDPs may be
mediated through the formation of an imidazole
radical followed by the addition of molecular
oxygen (Fig. 7F).
brain regions and other tissues as well, but at
concentrations 10- to 1,000-fold lower than in
muscle. We also quantified 2-oxo-IDPs in the
tissue samples by LC-ESI-MS/MS. This
method showed LOQs of approximately 100
fmol for the oxidized IDPs. The amount of 2-
oxo-carnosine was 4.8 pmol/mg protein in the
muscle tissue, which was several-fold higher
than in other tissues. This was not surprising in
view of the fact that carnosine is the most
abundant dipeptide in the skeletal muscle.
Similar to 2-oxo-carnosine, 2-oxo-anserine was
mainly detected in the muscle tissue. However,
the level of 2-oxo-anserine in the muscle tissue
was 30 pmol/mg protein, which was
significantly higher than that of 2-oxo-
carnosine. This may be explained by the fact
that the 1-methylimidazole derivatives are
much more sensitive to mono-oxygenation than
the imidazoles (14). 2-Oxo-homocarnosine was
detected only in the brain samples at 0.89
pmol/mg protein. Thus, the quantities of the
oxidized IDPs were shown to correlate with
those of the original peptides in their respective
tissues.
Discussion
A growing body of evidence shows the
protective role of IDPs in ischemia/reperfusion
damage and in human diseases such as diabetes,
cataract, and neurodegenerative disorders (1).
However, the underlying molecular mechanism
for their beneficial effects remains unclear. In
the present study, we adopted a mass
spectrometry-based approach to analyze the
IDPs in tissue samples. Taking advantage of the
fact that the authentic IDPs we studied,
including carnosine and anserine, commonly
gave specific fragment ions at m/z 72 and 89, we
comprehensively analyzed the IDPs in mouse
muscle homogenates and detected two
unknown peptides, showing molecular ions at
IDPs are believed to function as an
antioxidant in muscle and brain. Several studies
have indeed claimed that IDPs might exert their
cytoprotective effect through their antioxidant
activities in neuronal cells (15,16). However, no
direct evidence that can satisfactorily explain
this function has been reported. In the present
study, we generated SH-SY5Y cells stably
expressing CARNS and tested the effect of
carnosine overproduction on neuronal cell death
induced by oxidative stress. The CARNS-
overexpressed SH-SY5Y neuroblastoma cells,
showing high levels of intracellular carnosine,
+
m/z 243 and 257 ([M+H] ), corresponding to a
16-Da increase in the mass value of carnosine
and anserine, respectively. Based on the LC-
ESI-MS/MS analysis of the synthetic
compounds, these derivatives were identical to
2
-oxo-carnosine and 2-oxo-anserine. Thus, the
comprehensive analysis of tissue IDPs
unexpectedly led to the discovery of 2-oxo-
IDPs in vivo. To the best of our knowledge, this
is the first report demonstrating that the
conversion of histidine to 2-oxo-histidine is a
naturally-occurring reaction in vivo.
were resistant to cytotoxicity induced by H
2
O
2
Our study on the quantification of IDPs
and rotenone. More interestingly, following its
antioxidant activity, the level of 2-oxo-
carnosine was significantly elevated in cells
treated with pro-oxidants. Along with the
finding that membrane-permeable PEG-
catalase inhibited the production of 2-oxo-
using LC-ESI-MS/MS coupled with a stable
isotope dilution method showed that, consistent
with previous findings (1), both carnosine and
anserine were mainly detected in skeletal
muscle tissues. They were also measurable in
6

carnosine, these results support a generally
accepted hypothesis that carnosine
endogenously produced in cells functions as an
antioxidant.
despite the numerous findings and mechanistic
insights that revealed the antioxidant functions
of IDPs, the exact antioxidant mechanism
remained unknown. In the current studies, we
characterized the free radical scavenging
activity of 2-oxo-carnosine using the TEAC
assay and unexpectedly discovered that the
oxidized IDP scavenged the free radicals far
more efficiently than its original form (Fig. 5).
More strikingly, 2-oxo-carnosine showed a
better antioxidant activity than glutathione and
ascorbate, the two main aqueous-phase
antioxidants within cells. Thus, the conversion
of IDPs into their 2-oxo forms may, at least in
part, explain their antioxidant activity. In
addition, it can be speculated that the 2-oxo-
IDPs may be converted to further oxidized
products when they exert their free radical
scavenging activity. We indeed detected the
product with the molecular mass, corresponding
to a DPPH-carnosine complex. However, the
detailed mechanisms for the formation of the
complex remain unknown. Certainly, further
studies are needed to unravel mechanistic
details concerning the antioxidant activity of
the 2-oxo-IDPs.
The discovery of 2-oxo-histidine was
first reported by Uchida and Kawakishi in 1986
in their attempt to identify oxidized products
generated during the metal-catalyzed oxidation
2
+
(
O /Cu /ascorbate) of histidine (12). They have
2
also shown that 2-oxo-histidine further
underwent oxidative degradation to generate
ring-opened products such as aspartate,
aspartylurea, and formylasparagine (17). Using
HPLC with electrochemical detection, the
formation of 2-oxo-histidine in oxidized
proteins has been established in vitro (18). So
far, 2-oxo-histidine has been detected in the in
vitro oxidation of proteins, such as Cu/Zn-
superoxide dismutase (19,20), human relaxin
(
21), vanadium bromoperoxidase (22), human
growth hormone (23), oxidized low density
lipoprotein (24), and prion protein (25). More
recently, Traore et al. (26) provided evidence
for the formation of 2-oxo-histidine during the
oxidative inactivation of PerR, a metal-
dependent sensor of H
that the bound iron coordinates H
2
O
2
. It has been proposed
and
2
O
2
The isolation and structural identification
generates a reactive species, which then directly
reacts with the nearby histidine (27). The
formation of 2-oxo-histidine has been suggested
of 2-oxo-IDPs and their reaction intermediates
in conjunction with isotopic incorporation
studies have enabled us to propose a mechanism
for the formation of 2-oxo-histidine (Figs. 6
and 7). Based on the result that the
to be an H
2
2
O -sensing mechanism by which
PerR uses metal-catalyzed oxidation reactions
to regulate the expression of oxidative defense
genes. Given the fact that IDPs are efficient
metal-chelating agents, the intracellular
formation of 2-oxo-IDPs may be the result of
metal-catalyzed oxidation reactions involving
loosely-chelated metal ions. Thus, it is
reasonable to speculate that the IDPs show their
antioxidant activity when they bind metal ions
to form IDP-metal complexes.
1
8
incorporation of O was only observed in the
1
8
reaction mixture containing
atom introduced into the 2-oxo-IDPs might
originate from O (Fig. 6). The initiating step
O
2
, the oxygen
2
may be H-abstraction from C-2 of the imidazole
ring of histidine residues followed by the
addition of O
hydroperoxy-histidine has indeed been detected
in H -oxidized Cu/Zn-superoxide dismutase
using tandem quadrupole/orthogonal-
2
to form a peroxy radical. The 2-
2
O
2
It has been shown that the antioxidant
a
activity of IDPs is mediated by different
mechanisms involving metal ion chelation and
scavenging reactive oxygen species. However,
acceleration time-of-flight (ESI-Q-TOF) mass
spectrometer combined with a nano-HPLC
system (19). A reactive species involving H-
7

abstraction from C-2 of the imidazole ring of
histidine residues remains unclear; however, a
peptides formed during the oxygenation of
natural IDPs of high medicinal interest. We thus
provide a novel paradigm to understand the
antioxidant effects of IDPs. One could also
speculate that IDPs showing a beneficial
antioxidant effect may gain a new function after
converting to 2-oxo derivatives. Studies into
this possibility represent an attractive future
area of investigation.
3+
high valent oxocopper species (Cu =O), a
possible hydroxylating species, has previously
been suggested as an intermediate in copper
oxygenases, including tyrosinase and dopamine
p-hydroxylase (28). The formation of 2-oxo-
IDPs may therefore be mediated by the
formation of O
2
-metal-IDPs. These complexes
could be associated with the formation of
3+
reactive species, such as Cu =O, upon reaction
with ascorbate followed by site-specific
oxygenation of the imidazole ring in histidine
residues. On the other hand, spin-trapping
reagents have been shown to be highly effective
probes for mass spectrometry-based detection
of biologically-relevant carbon-centered free
radicals. Hence, to gain insight into the
formation of imidazole-based free radicals, we
tested amino-TEMPO• as a spin-trapping
reagent and successfully detected an amino-
TEMPO-carnosine adduct by LC-ESI-MS/MS
Experimental procedures
Materials
L-Histidine, β-alanine, γ-aminobutyric
acid, p-toluenesulfonic acid (TsOH), thionyl
chloride, and N,N-dimethylacetamide were
purchased from Nacalai Tesque (Kyoto, Japan).
1
3
3
-Methyl-L-histidine, [ C
, 15N] β-alanine, and
3
LPS (from Escherichia coli; O26:B6) were
from Sigma-Aldrich (St Louis, MO, USA).
[15
N
3
] L-histidine, [ O] O
18
, and [ O] H O were
18
2
2
obtained from the Taiyo Nippon Sanso
Corporation (Tokyo, Japan). PEGylated
catalase (PEG-catalase) was prepared as
previously reported (29). Rotenone was
purchased from Tokyo Chemical Industry Co.,
Ltd. (Tokyo, Japan). Toluene and Dulbecco’s
modified Eagle’s medium (DMEM) were
purchased from Wako Pure Chemical Industry
(
Fig. 7). These data provide the first
mechanistic details of the mono-oxygenation of
IDPs, in which the metal-catalyzed oxidation
reaction is mediated through the formation of an
imidazole radical intermediate, followed by the
addition of molecular oxygen.
In summary, we analyzed IDPs in mouse
tissue homogenates and unambiguously
detected 2-oxo-IDPs. In addition, we showed
that the overexpression of CARNS resulted in a
(
Osaka, Japan). Fetal bovine serum (FBS) was
obtained from MultiSer (Cytosystems, Castle
Hill, NSW, Australia). 3-(4,5-Dimethylthial-2-
yl)-2,5-diphenyltetrazalium bromide (MTT)
was from Dojindo Laboratories (Kumamoto,
Japan). All other chemicals and reagents were
from common suppliers and were of the highest
commercially-available grade.
significant inhibition of the H
2
2
O cytotoxicity
and a concomitant increase in the intracellular
levels of the 2-oxo-IDPs. Notably, 2-oxo-
carnosine showed better antioxidant activity
than endogenous antioxidants, such as
glutathione and ascorbate. Mechanistic studies
of the metal-catalyzed oxidation of IDPs
revealed that the mono-oxygenation of IDPs
might be mediated through the formation of a
histidyl radical intermediate, followed by the
addition of molecular oxygen. The work
described here is the first example of the in vivo
Preparation of stable isotope-labeled IDPs
To prepare the isotope-labeled IDPs,
1
3
, 15N] β-alanine was treated
0
.225 mmol of [ C
with 0.45 mmol of TsOH in water (0.1 mL) for
0 min at room temperature, dried in vacuo and
3
3
then dissolved in toluene (0.4 mL). β-
Alanine•TsOH was dried in vacuo again. L-
Histidine•2TsOH was prepared by the above-
detection
of
2-oxo-histidine-containing
8

mentioned method using 0.45 mmol of L-
histidine and 0.90 mmol of TsOH. β-
Alanine•TsOH was redissolved in thionyl
chloride (0.6 mL) and incubated for 1 h at room
temperature, dried in vacuo and then dissolved
in toluene (0.4 mL). β-alanineCl•TsOH was
dried in vacuo again. All the synthesized β-
alanineCl•TsOH and L-histidine•2TsOH were
mixed in N,N-dimethylacetamide (0.45 mL),
purged with nitrogen, and incubated for 1 h at
containing 50% acetonitrile and 100 mM
ammonium formate) (0% B at 0 min; 90% B at
20 min) at the flow rate of 1.5 mL/min. The
elution was monitored by absorbance at 250 nm.
The chemical structures of the products were
characterized by LC-ESI-MS/MS and NMR
analysis. The NMR analyses were performed
using a JEOL JNM-ECZ500R (500 MHz)
1
instrument. 2-Oxo-carnosine: H NMR (D
2
O):
δH 2.54 (dt, J = 3.5 Hz, 2H), 2.66 (dd, J = 8.2
Hz, 1H), 2.80 (dd, J = 5.5 Hz, 1H), 3.06 (t, J =
6.8 Hz, 2H), 4.41 (dd, J = 4.7 Hz, 1H), 6.12 (s,
1H); δC 31.34, 35.83, 39.70, 56.61, 119.01,
4
°C with shaking. An equal amount of water
was added to the mixture to hydrolyze the
unreacted β-alanineCl•TsOH. The obtained
1
3
15
[
(
C
3
,
N] carnosine was purified by HPLC
132.18, 159.10, 176.06, 179.17. 2-Oxo-
1
JASCO Corporation, Tokyo, Japan) under the
anserine: H NMR (D
2
O): δH 2.26 (dt, J = 3.1
following conditions: a Scherzo SS-C18
column (6.0 x 100 mm, Imtakt, Kyoto, Japan)
using a linear gradient of solvent A (water
containing 0.1% formic acid) and solvent B
Hz, 2H), 2.60 (dd, J = 10 Hz, 1H), 2.70 (t, J =
6.5 Hz, 2H), 2.84 (m, 1H), 3.05 (s, 3H), 4.26 (dd,
J = 4.7 Hz, 1H), 6.12 (s, 1H); δC 29.10, 31.92,
37.67, 38.87, 55.07, 117.95, 129.67, 155.86,
1
(
water containing 50% acetonitrile and 100 mM
ammonium formate) (0% B at 0 min; 75% B at
0 min) at the flow rate of 1.0 mL/min. The
elution was monitored by absorbance at 220 nm.
-Methyl-L-histidine was used for the
175.47, 179.10. 2-Oxo-homocarnosine:
NMR (D
H
2
O): δH 1.72-1.75 (m, 2H), 2.21 (dt, J
2
= 3.5 Hz, 2H), 2.53 (dd, J = 8.2 Hz, 1H), 2.76-
2.81 (m, 3H), 4.23 (dd, J = 4.7 Hz, 1H), 6.08 (S,
1H); δC 24.41, 29.46, 33.86, 40.21, 55.46,
116.34, 129.51, 164.25, 175.61, 178.91.
3
13
15
preparation of [ C
histidine. γ-Aminobutyric acid and [ N
3
, N] anserine, instead of L-
15
3
] L-
1
5
histidine were used for the preparation of [ N
3
]
LC-ESI-MS/MS analysis
homocarnosine, instead of β-alanine and L-
histidine, respectively. The chemical structures
of the products were characterized by LC-ESI-
MS/MS and NMR analyses.
The LC-ESI-MS/MS analyses were
carried out using the Xevo TQD triple
quadrupole mass spectrometer (Waters, MA,
USA). Chromatography was carried out by an
Intrada Amino Acid column (2.0 x 50 mm,
Imtakt) using an Alliance e2695 system (Waters,
MA, USA). A discontinuous gradient of solvent
A (acetonitrile containing 0.1% formic acid)
and solvent B (water containing 100 mM
ammonium formate) was used as follows: 0% B
at 0 min, 60% B at 0.1 min, 70% B at 5 min,
99% B at 9 min, at the flow rate of 0.3 mL/min.
The mass spectrometer operated in the positive
mode under the following conditions: capillary
voltage 1000 V and desolvation gas (nitrogen)
1000 L/h at 500 °C. The oxidized imidazole
dipeptides were identified and quantified in the
Preparation of oxidized IDPs
Oxidation of the imidazole ring of the
IDPs was carried out by the ascorbic acid-
copper ion system (12). The reaction mixtures
(
5 mL) containing 10 mM IDPs, 200 mM
sodium phosphate buffer (pH 7.2), 200 mM
ascorbate, and 2 mM CuSO were incubated at
4
room temperature. Oxygen gas was bubbled
into the mixture for 30 min. The oxidized IDPs
were purified under the following conditions: a
Scherzo SS-C18 column (6.0 x 100 mm) using
a linear gradient of solvent A (water containing
0.1% formic acid) and solvent B (water
9

multiple reaction monitor (MRM) mode. The
MRM parameters are listed in Table S1.
equilibrated with 100 mM HCl. The cartridge
was washed with 5 column volumes of
methanol, then the sample was eluted with 3
column volumes of 0.5 M ammonia in methanol.
The samples were then dried in vacuo, dissolved
in 0.1 mL of 2% formic acid in water, and
subjected to an LC-ESI-MS/MS.
Animal studies
This study was performed in accordance
with
the
Guidelines
for
Animal
Experimentation
of Osaka
Prefecture
University, Japan. All animal experiments were
approved by the Animal Ethical Committee of
Osaka Prefecture University. Nine-week-old
male C57BL/6J mice (Kiwa Laboratory
Animals Co., Ltd.; Wakayama, Japan) were
reared at 24 ± 1 °C and with a 12 h light/12 h
dark cycle with free access to water and a
standard diet for 1 week. For quantitative
analysis, the mice (n = 3) were sacrificed. Blood
was collected and serum was prepared, flash
frozen and stored at -80 °C until processed. The
lung, liver, heart, kidney, brain, and leg muscle
were harvested, flash frozen and stored at -
Preparation of SH-SY5Y stable cell line
overexpressing CARNS
The CARNS gene (NP_00159694) was
amplified from human brain cDNA using
primers:
forward,
5’-
CACCATGCACCATCATCATCATCATTCT
TCTGGTCTCTCCCTGGATCCATCGGGTC
CCG-3’
and
reverse,
5’-
CTATTTGAAGTGAGACAGGAAGTGGGC-
3’. The amplified CARNS gene was cloned into
the pENTR/D-TOPO vector using the
directional TOPO cloning system (Gateway
80 °C until processed. For oxidative stress
Cloning
Technology,
Thermo
Fischer
experiments, the mice were divided into four
groups (n = 3) and were intraperitoneally
injected with LPS (10 mg/Kg of body weight)
or quantified by the multiple reaction monitor
Scientific). The CARNS gene was subcloned
into the pcDNA3.2/nFLAG-DEST expression
plasmid by the LR reaction (Thermo Fischer
Scientific). The SH-SY5Y cells were cultured at
37 °C in DMEM (Wako Pure Chemical
Industries, Osaka, Japan) supplemented with
10% FBS. The cells were transfected with
(
MRM) mode vehicle control (PBS). After
injection for 0, 4, 8, or 24 h, the animals were
weighed and sacrificed. The brains were
harvested, flash frozen, and stored at -80 °C
until processed.
CARNS/pcDNA3.2/nFLAG-DEST
using
polyethylenimine Max (Polysciences, Inc., PA,
USA). Thereafter, the cells were cultured in the
medium containing 400 μg/ml G418. Four
weeks after transfection, the surviving clones
were isolated and grown on a large scale. The
expression of the FLAG-tagged CARNS was
analyzed by Western blotting using the anti
FLAG antibody (Sigma-Aldrich, MO, USA).
Stable cell lines with the overexpression of
CARNS were selected and maintained in the
medium containing 400 μg/ml G418.
Preparation of mouse tissue samples
Mouse tissues were homogenized with 10
volumes (w/v) of 80% acetonitrile in water
containing 50 pmol of stable isotope-labeled
standards using a Heidolph homogenizer
(
Heidolph, BY, Germany). The homogenates
were centrifuged at 18,800 g for 20 min at 4 °C.
The supernatants were collected and
concentrated by a vacuum concentrator until the
acetonitrile was removed. After the samples
were mixed with equal amounts of ethyl acetate,
an aqueous layer was obtained. The aqueous
layer was diluted 4-fold with 100 mM HCl and
applied on an Oasis MCX cartridge (Waters)
Cell treatment
The SH-SY5Y cells stably expressing
CARNS and the control cells were plated at a
4
density of 2.0 × 10 cells/well in 96 well plates
1
0

6
for the MTT assay and at 4.0 × 10 cells/dish in
emission at 553 nm). Malondialdehyde
bis(dimethylacetal) was used as the standard.
a 100-mm dish for the LC-ESI-MS/MS analysis.
To investigate the antioxidant capacity of
carnosine, the cells were treated with different
Measurement of antioxidant activity
concentration of H
O
2 2
or rotenone for 24 h. The
The scavenging effect of 2-oxo-carnosine
cell viability was determined by using the MTT
method (30).
To analyze the formation of 2-oxo-
carnosine, the cells were treated with 150 μM
on a DPPH radical was monitored as previously
described (32). Briefly, the reaction mixtures,
containing a micromolar range of carnosine, 2-
oxo-carnosine, glutathione, or ascorbate, were
incubated with 100 µM DPPH (Alfa Aesar, MA)
in 12 mM sodium phosphate buffer (pH 7.4),
containing 40% ethanol, for 30 min at room
temperature. The absorbance at 540 nm was
measured by a Model 680 plate reader (Bio-Rad,
CA, USA). Trolox (MERCK, Darmstadt,
Germany) was used as the standard. The radical
scavenging activities were evaluated by µmol of
Trolox equivalent per mmol of the sample. TEAC
was calculated by the equation according to the
scavenging percentage of the sample solution to
the DPPH radical solution. Consumption of 2-
oxo-carnosine and the formation of products were
monitored by LC-ESI-MS/MS.
H
2
2
O or 2.5 μM rotenone for the various time
periods. To examine the effects of ROS on the
formation of 2-oxo-carnosine, the cells were
pretreated with or without 200 U/mL PEG-
catalase for 1 h. After washing with PBS 5 times,
the cells were then treated with 150 μM H
2
2
O or
2.5 μM rotenone for 2 h. The cells were washed
twice with PBS and collected by using a cell
scraper in 1 mL of 80% acetonitrile in water
containing stable isotope-labeled standards.
After centrifuged at 18,800 g at 4 °C for 20 min,
the supernatants were collected, dried,
dissolved in 100 mM HCl, and applied on an
Oasis MCX cartridge (Waters). The samples
were eluted and subjected to LC-ESI-MS/MS
by the above-mentioned method.
Cytotoxicity
SH-SY5Y cells were plated at a density of
4
TBARS
1.0 × 10 cells/well in 96 well plates for the MTT
The amount of the TBARS was determined assay. To demonstrate the cytoprotective effect of
according to the method described by Masaki et al 2-oxo-carnosine against oxidative stress, cells
(
31). The brains (approximately 10 mg) were were pretreated with 50 μM carnosine or 2-oxo-
homogenized in 0.4 ml of PBS containing 1% carnosine for 3 h, then the cells were treated with
Triton X-100. After centrifuged at 18,800 g at 2 μM rotenone for 24 h. The cell viability was
4
°C for 20 min, 50 μl of the supernatants were determined using the MTT method.
mixed with 0.35 mL of PBS containing 1% Triton
X-100 and 0.8 ml of 0.375% 2-thiobarbituric acid, Statistical analysis
15% trichloroacetic acid, 2% ethanol, 250 mM
All experiments were performed at least
HCl, and 0.4% butylhydroxytoluene, then boiled three times. The values for the individual
for 15 min. After cooling, the samples were experiments are presented as the means ± SD.
centrifuged (18,800 g,
5
min), and the Statistical significance was determined by the
fluorescence intensities were analyzed by a one-way ANOVA, two-way ANOVA or
fluorescence detector (excitation at 515 nm and Student’s paired t test using GraphPad Prism
software. P<0.05 was considered significant.
1
1

Conflict of interest: The authors declare that they have no conflicts of interest with the contents of
this article.
Author contributions: HI and YK contributed equally to this work. HI, YK, and KU designed the
study; HI, YK, AY, KK, and TS performed the research; HI, YK, KK, TS, MN, KY and KU analyzed
the data; and HI, YK, TS and KU wrote the paper.
1
2

References
1.
Boldyrev, A. A., Aldini, G., and Derave, W. (2013) Physiology and Pathophysiology of
Carnosine. Physiol. Rev. 93, 1803-1845
2.
Drozak, J., Veiga-da-Cunha, M., Vertommen, D., Stroobant, V., and Van Schaftingen, E.
(
2010) Molecular Identification of Carnosine Synthase as ATP-grasp Domain-containing
Protein 1 (ATPGD1). J. Biol. Chem. 285, 9346-9356
3
4
5
.
.
.
Drozak, J., Piecuch, M., Poleszak, O., Kozlowski, P., Chrobok, L., Baelde, H. J., and de
Heer, E. (2015) UPF0586 Protein C9orf41 Homolog Is Anserine-producing
Methyltransferase. J. Biol. Chem. 290, 17190-17205
Lenney, J. F. (1990) Separation and characterization of two carnosine-splitting cytosolic
dipeptidases from hog kidney (carnosinase and non-specific dipeptidase). Biol. Chem.
Hoppe Seyler 371, 433-440
Teufel, M., Saudek, V., Ledig, J.-P., Bernhardt, A., Boularand, S., Carreau, A., Cairns, N. J.,
Carter, C., Cowley, D. J., Duverger, D., Ganzhorn, A. J., Guenet, C., Heintzelmann, B.,
Laucher, V., Sauvage, C., and Smirnova, T. (2003) Sequence Identification and
Characterization of Human Carnosinase and a Closely Related Non-specific Dipeptidase. J.
Biol. Chem. 278, 6521-6531
6
7
8
.
.
.
Davey, C. L. (1960) The significance of carnosine and anserine in striated skeletal muscle.
Arch. Biochem. Biophys. 89, 303-308
González-Estrada, M. T., and Freeman, W. J. (1980) Effects of carnosine on olfactory bulb
EEG, evoked potentials and DC potentials. Brain Res. 202, 373-386
Ikeda, T., Kimura, K., Hama, T., and Tamaki, N. (1980) Activation of Rabbit Muscle
Fructose 1, 6-Bisphosphatase by Histidine and Carnosine. The Journal of Biochemistry 87,
179-185
9
1
.
Stadtman, E. R. (1992) Protein oxidation and aging. Science 257, 1220-1224
Stadtman, E. R., and Levine, R. L. (2003) Free radical-mediated oxidation of free amino
acids and amino acid residues in proteins. Amino Acids 25, 207-218
0.
11.
Uchida, K. (2003) Histidine and lysine as targets of oxidative modification. Amino Acids
25, 249-257
12.
Uchida, K., and Kawakishi, S. (1986) Selective oxidation of imidazole ring in histidine
residues by the ascorbic acid — copper ion system. Biochem. Biophys. Res. Commun. 138,
659-665
1
1
3.
4.
Berg, R. M., Moller, K., and Bailey, D. M. (2011) Neuro-oxidative-nitrosative stress in
sepsis. J. Cereb. Blood Flow Metab. 31, 1532-1544
Uchida, K., and Kawakishi, S. (1990) Highly site-specific oxygenation of 1-
methylhistidine and its analogue with a copper(II)/ascorbate-dependent redox system.
Biochimica et Biophysica Acta (BBA) - General Subjects 1034, 347-350
Tabakman, R., Jiang, H., Levine, R. A., Kohen, R., and Lazarovici, P. (2004) Apoptotic
characteristics of cell death and the neuroprotective effect of homocarnosine on
pheochromocytoma PC12 cells exposed to ischemia. J. Neurosci. Res. 75, 499-507
1
5.
1
3

16.
Tabakman, R., Lazarovici, P., and Kohen, R. (2002) Neuroprotective effects of carnosine
and homocarnosine on pheochromocytoma PC12 cells exposed to ischemia. J. Neurosci.
Res. 68, 463-469
1
1
1
7.
8.
9.
Uchida, K., and Kawakishi, S. (1989) Ascorbate-mediated specific oxidation of the
imidazole ring in a histidine derivative. Bioorg. Chem. 17, 330-343
Uchida, K., and Kawakishi, S. (1993) 2-Oxo-histidine as a novel biological marker for
oxidatively modified proteins. FEBS Lett. 332, 208-210
Kurahashi, T., Miyazaki, A., Suwan, S., and Isobe, M. (2001) Extensive Investigations on
Oxidized Amino Acid Residues in H2O2-Treated Cu,Zn-SOD Protein with LC-ESI-Q-
TOF-MS, MS/MS for the Determination of the Copper-Binding Site. J. Am. Chem. Soc.
123, 9268-9278
2
2
0.
1.
Uchida, K., and Kawakishi, S. (1994) Identification of oxidized histidine generated at the
active site of Cu,Zn-superoxide dismutase exposed to H2O2. Selective generation of 2-
oxo-histidine at the histidine 118. J. Biol. Chem. 269, 2405-2410
Li, S., Nguyen, T. H., Schoneich, C., and Borchardt, R. T. (1995) Aggregation and
precipitation of human relaxin induced by metal-catalyzed oxidation. Biochemistry 34,
5762-5772
2
2
2.
3.
Meister Winter, G. E., and Butler, A. (1996) Inactivation of Vanadium Bromoperoxidase:ꢀ
Formation of 2-Oxohistidine. Biochemistry 35, 11805-11811
Zhao, F., Ghezzo-Schöneich, E., Aced, G. I., Hong, J., Milby, T., and Schöneich, C. (1997)
Metal-catalyzed Oxidation of Histidine in Human Growth Hormone: MECHANISM,
ISOTOPE EFFECTS, AND INHIBITION BY A MILD DENATURING ALCOHOL. J.
Biol. Chem. 272, 9019-9029
2
2
2
4.
5.
6.
Retsky, K. L., Chen, K., Zeind, J., and Frei, B. (1999) Inhibition of copper-induced LDL
oxidation by vitamin C is associated with decreased copper-binding to LDL and 2-oxo-
histidine formation. Free Radic. Biol. Med. 26, 90-98
Requena, J. R., Groth, D., Legname, G., Stadtman, E. R., Prusiner, S. B., and Levine, R. L.
(
2001) Copper-catalyzed oxidation of the recombinant SHa(29–231) prion protein. Proc.
Natl. Acad. Sci. U. S. A. 98, 7170-7175
Traore, D. A., El Ghazouani, A., Jacquamet, L., Borel, F., Ferrer, J. L., Lascoux, D.,
Ravanat, J. L., Jaquinod, M., Blondin, G., Caux-Thang, C., Duarte, V., and Latour, J. M.
(
2009) Structural and functional characterization of 2-oxo-histidine in oxidized PerR
protein. Nat. Chem. Biol. 5, 53-59
2
2
7.
8.
Lee, J. W., and Helmann, J. D. (2006) The PerR transcription factor senses H2O2 by metal-
catalysed histidine oxidation. Nature 440, 363-367
Stewart, L. C., and Klinman, J. P. (1987) Characterization of alternate reductant binding
and electron transfer in the dopamine beta-monooxygenase reaction. Biochemistry 26,
5302-5309
29.
Matoba, T., Shimokawa, H., Morikawa, K., Kubota, H., Kunihiro, I., Urakami-Harasawa,
L., Mukai, Y., Hirakawa, Y., Akaike, T., and Takeshita, A. (2003) Electron Spin Resonance
1
4

Detection of Hydrogen Peroxide as an Endothelium-Derived Hyperpolarizing Factor in
Porcine Coronary Microvessels. Arterioscler. Thromb. Vasc. Biol. 23, 1224-1230
Ihara, H., Yamamoto, H., Ida, T., Tsutsuki, H., Sakamoto, T., Fujita, T., Okada, T., and
Kozaki, S. (2012) Inhibition of nitric oxide production and inducible nitric oxide synthase
expression by a polymethoxyflavone from young fruits of Citrus unshiu in rat primary
astrocytes. Biosci. Biotechnol. Biochem. 76, 1843-1848
30.
3
3
1.
2.
Masaki, N., Kyle, M. E., and Farber, J. L. (1989) tert-butyl hydroperoxide kills cultured
hepatocytes by peroxidizing membrane lipids. Arch. Biochem. Biophys. 269, 390-399
Yoshida, T., Mori, K., Hatano, T., Okumura, T., Uehara, I., Komagoe, K., Fujita, Y., and
Okuda, T. (1989) Studies on inhibition mechanism of autoxidation by tannins and
flavonoids. V. Radical-scavenging effects of tannins and related polyphenols on 1,1-
diphenyl-2-picrylhydrazyl radical. Chem. Pharm. Bull. (Tokyo) 37, 1919-1921
1
5

FOOTNOTES
This work was supported in part by a Grant-in-Aid for Scientific Research (S) (No. 17H06170)
(
1
K.U.), Scientific Research (B) (No. 16H04674) (H.I.), Challenging Exploratory Research (No.
6K13089) (H.I.) and Grant-in-Aid for Scientific Research on Innovative Areas "Oxygen Biology:
a new criterion for integrated understanding of life" (No. 26111011) (K.U., H.I., M.N.) of the
Ministry of Education, Sciences, Sports, Technology (MEXT), Japan. This research was also
supported by AMED-CREST from AMED (K.Y, K.U.), and the Smoking Research Foundation
(
H.I.)
The abbreviations used are: IDP, imidazole-containing dipeptide; CARNS, carnosine synthase;
, hydrogen peroxide; HPLC, high performance liquid chromatography; ESI, electrospray
H
2
O
2
ionization; MS, mass spectrometry; MS/MS, tandem MS; TsOH, p-toluenesulfonic acid; ANOVA,
analysis of variance; MRM, multiple reaction monitor; LOQ, limit of quantitation; SAE, sepsis-
associated encephalopathy; LPS, lipopolysaccharide; TBARS, 2-thiobarbituric acid reactive
substances; amino-TEMPO•, 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy; DMEM, Dulbecco’s
modified Eagle’s medium; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide;
TEAC, Trolox equivalent antioxidant capacity; DPPH, 1,1-diphenyl-2-picrylhydrazyl
1
6

Figure 1. Simultaneous detection of IDPs in the mouse tissues. (A) Authentic standards were used
for the development of a LC-MS/MS method in the separation and quantification of carnosine and
anserine using MS/MS fragments and retention times unique to each IDP (Fig. S3). Carnosine,
anserine, 2-oxo-carnosine, and 2-oxo-anserine are indicated by 1, 2, 3, and 4, respectively. (B)
Chemical structure of carnosine, anserine, 2-oxo-carnosine, and 2-oxo-anserine.
1
7

Figure 2. Quantitative identification of IDPs and oxidized IDPs in mouse tissues. (A) LC-ESI-
MS/MS analysis of endogenous carnosine in the mouse skeletal muscle. Representative LC-ESI-
MS/MS chromatograms of spiked isotope-labeled carnosine (upper), and endogenous carnosine
(
lower) are shown. (B) LC-ESI-MS/MS analysis of endogenous 2-oxo-carnosine in the mouse
skeletal muscle. Representative LC-ESI-MS/MS chromatograms of spiked isotope-labeled 2-oxo-
carnosine (upper), and endogenous 2-oxo-carnosine (lower) are shown. (C) Quantitative
identification of IDPs (upper) and oxidized IDPs (lower) in the mouse tissues. The IDPs and oxidized
IDPs in mouse tissues were quantified using LC-ESI-MS/MS coupled with a stable isotope dilution
method. Data are mean ± SD (n = 3).
1
8

Figure 3. Generation of oxidized IDPs in brain of SAE model mouse. Mice were intraperitoneally
injected with LPS. (A) Body weights. Graph indicates the body weights of SAE model mice. Date
represent means ± SD (n = 3). One-way ANOVA with the Tukey post hoc test was used for the
statistical analysis. **P < 0.01 compared with values for 0 h sample. (B) TBARS levels in brains.
Graph indicates the TBARS levels in the brains of an SAE model mice. Data represent means ± SD
(
0
n = 3). One-way ANOVA with the Tukey post hoc test was used for the statistical analysis. *P <
.05 compared with values for 0 h sample. (C) LC-ESI-MS/MS analysis of endogenous 2-oxo-
carnosine in brain of an SAE model mouse. Representative LC-ESI-MS/MS chromatograms of
endogenous- (left) and spiked isotope-labeled 2-oxo-carnosine (right) are shown. (D) Bar graph
which indicates the levels of 2-oxo-carnosine. Data represent means ±SD (n = 3). One-way ANOVA
with the Tukey post hoc test was used for the statistical analysis. ***P < 0.001 compared with values
for 0 h sample. (E) Quantitative identification of 2-oxo-anserine in brain of an SAE model mouse.
2
-Oxo-anserine was quantified using LC-ESI-MS/MS coupled with a stable isotope dilution method.
Date represent means ±SD (n = 3). One-way ANOVA with the Tukey post hoc test was used for the
statistical analysis. *P < 0.05 compared with values for 0 h sample. (F) Quantitative identification of
2
-oxo-homocarnosine in brain of an SAE model mouse. 2-Oxo-homocarnosine was quantified using
LC-ESI-MS/MS coupled with a stable isotope dilution method. Data represent means ±SD (n = 3).
One-way ANOVA with the Tukey post hoc test was used for the statistical analysis. **P < 0.01
compared with values for 0 h sample.
1
9

Figure 4. Formation of 2-oxo-carnosine in the SH-SY5Y cells stably expressing CARNS under
oxidative stress. (A) Western blotting showing CARNS protein levels in the SH-SY5Y cells stably
expressing CARNS and in the control cells. Expression of FLAG-tagged CARNS in the SH-SY5Y
cells was analyzed using the anti-FLAG antibody. -Actin was used as a loading control. (B)
Quantitative identification of carnosine in the SH-SY5Y cells stably expressing CARNS and in the
control cells. Carnosine was quantified using LC-ESI-MS/MS coupled with a stable isotope dilution
method. Data represent means ±SD (n = 3). Student’s paired t-test was used for the statistical analysis.
***P < 0.001 compared with values for the control. (C) Cytotoxicity induced by H
2
2
O in the SH-
SY5Y cells stably expressing CARNS (black) and in the control cells (gray). Cell viability was
determined by the MTT assay. Data represent means ±SD (n = 5). Two-way ANOVA with the
Bonferroni post hoc test was used for the statistical analysis. ***P < 0.001 compared with values for
control. (D) Quantitative identification of endogenous 2-oxo-carnosine in the SH-SY5Y cells stably
expressing CARNS treated with H
2
2
O . 2-Oxo-carnosine was quantified using LC-ESI-MS/MS
2
0

coupled with a stable isotope dilution method. Data represent means ±SD (n = 5). Two-way ANOVA
with the Bonferroni post hoc test was used for the statistical analysis. **P < 0.01 and ***P < 0.001
compared with values for control. (E) Inhibition of 2-oxo-carnosine formation by PEG-catalase. The
CARNS expressing cells were pretreated with PEG-catalase. After washing, the H
2
2
O -induced
cytotoxicity was assessed. Data represent means ±SD (n = 3). One-way ANOVA with the Tukey
post hoc test was used for the statistical analysis. ***P < 0.001 compared with values for 0 h sample.
#
##
P < 0.001 compared with values for H
2
2
O treatment. (F) Cytotoxicity induced by rotenone in the
SH-SY5Y cells stably expressing CARNS (black) and in the control cells (gray). Cell viability was
determined by the MTT assay. Data represent means ±SD (n = 5). Two-way ANOVA with the
Bonferroni post hoc test was used for statistical analysis. *P < 0.05 and ***P < 0.001 compared with
values for control. (G) Quantitative identification of endogenous 2-oxo-carnosine in the SH-SY5Y
cells stably expressing CARNS treated with rotenone. 2-Oxo-carnosine was quantified using LC-
ESI-MS/MS coupled with a stable isotope dilution method. Data represent means ±SD (n = 3). One-
way ANOVA with the Tukey post hoc test was used for the statistical analysis. **P < 0.01 and ***P
<
0.001 compared with values for the control. (H) Inhibition of 2-oxo-carnosine formation by PEG-
catalase. The CARNS expressing cells were pretreated with PEG-catalase. After washing, the
rotenone-induced cytotoxicity was assessed. Data represent means ±SD (n = 3). One-way ANOVA
with the Tukey post hoc test was used for the statistical analysis. ***P < 0.001 compared with values
for control. # P < 0.001 compared with values for the rotenone treatment.
##
2
1

Figure 5. Gain of antioxidant function. (A) Comparison of DPPH radical scavenging activity of
-oxo-carnosine with the antioxidants. The data are expressed as µmol of Trolox equivalent per mmol
2
of samples. (B) Consumption of 2-oxo-carnosine upon incubation with DPPH. (C) Cytoprotective
effect of 2-oxo-carnosine against rotenone-induced neuronal cell death. Cell viability was determined
by the MTT assay. Data represent means ±SD (n = 5). One-way ANOVA with the Tukey post hoc
*
**
###
test was used for the statistical analysis. P < 0.001 compared with values for control. P < 0.001
compared with values for rotenone treatment. N.S., not significant.
2
2

Figure 6. Mechanism for the conversion of carnosine to 2-oxo-carnosine. (A) LC-ESI-MS/MS
analysis of formation of 2-oxo-carnosine by metal-catalyzed oxidation. Ten mM Carnosine was
incubated in 200 mM sodium phosphate buffer (pH 7.2) in the presence or absence of 200 mM
ascorbate or 2 mM CuSO at room temperature with the bubbling of oxygen gas for 30 min.
4
Representative LC-ESI-MS/MS chromatograms of carnosine (right) and 2-oxo-carnosine (left) are
shown. (B) Incorporation of oxygen at C2 position of 2-oxo-carnosine. The degassed reaction
mixture containing 0.5 mM carnosine, 100 mM sodium phosphate buffer (pH 7.2), and 50 mM
1
6
18
16
18
ascorbate was prepared using water- O or water- O. Oxygen- O
2
or - O gas was bubbled into the
2
mixture. Metal-catalyzed oxidation was started by the addition of 1/100 volume of 50 mM CuSO
4
,
and then the mixtures were incubated for 5 min at room temperature. The samples were analyzed by
LC-ESI-MS/MS.
2
3

Figure 7. Analysis of radical intermediate of carnosine by amino-TEMPO. (A) Chemical
structure of 4-amino-TEMPO•. (B) Mass chromatograph of putative carnosine-amino TEMPO
adduct. The reaction mixtures containing 5 mM carnosine, 500 mM sodium phosphate buffer (pH
7
.2), 50 mM ascorbate, 0.5 mM CuSO , and 4-amino-TEMPO (0 or 100 mM) were incubated with
4
bubbling oxygen gas at room temperature for 30 min. The samples were subjected to HPLC-ESI-MS
+
monitoring at m/z 399. (C) Collision-induced dissociation of the [M + H] of putative carnosine-
amino TEMPO adduct at m/z 399 at a collision energy of 10 V. (D) Formation of carnosine-amino
TEMPO adduct. The reaction mixtures containing 5 mM carnosine, 500 mM sodium phosphate
buffer (pH 7.2), 50 mM ascorbate, 0.5 mM CuSO , and 4-amino-TEMPO (0, 50, or 100 mM) were
4
incubated with bubbling oxygen gas at room temperature for 30 min. The samples were analyzed by
LC-ESI-MS/MS with MRM (m/z 399→173). (E) Inhibition of 2-oxo-carnosine formation by 4-
amino-TEMPO. The same samples were analyzed by LC-ESI-MS/MS with MRM (m/z 243→196).
(
F) Proposed mechanism of the mono-oxygenation of the IDPs.
2
4

2
-Oxo-histidine−containing dipeptides are functional oxidation products
Hideshi Ihara, Yuki Kakihana, Akane Yamakage, Kenji Kai, Takahiro Shibata,
Motohiro Nishida, Ken-ichi Yamda and Koji Uchida
J. Biol. Chem. published online November 30, 2018
Access the most updated version of this article at doi: 10.1074/jbc.RA118.006111
Alerts:
•
•
When this article is cited
When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts

Supporting Information
2-Oxo-histidine–containing dipeptides are functional oxidation products
†
†
†
♯
¶
Hideshi Ihara , Yuki Kakihana , Akane Yamakage , Kenji Kai , Takahiro Shibata , Motohiro
†
†
‡, ||
§, ¶, ||
Nishida , Ken-ichi Yamda , and Koji Uchida
Address:
†
Department of Biological Science, Graduate School of Science, Osaka Prefecture University,
Sakai, Osaka 599-8531, Japan
♯
Department of Biological Chemistry, Graduate School of Life and Environmental Sciences,
Osaka Prefecture University, Sakai, Osaka 599-8531, Japan
¶
Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan
†
†
Division of Cardiocirculatory Signaling, National Institute for Physiological Sciences,
Okazaki 444-8787, Japan
‡
Physical Chemistry for Life Science Laboratory, Faculty of Pharmaceutical Sciences, Kyushu
University, Fukuoka, Japan.
||
Japan Agency for Medical Research and Development, CREST, Tokyo, Japan.
§
Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657,
Japan

Table S1

Fig. S1. Collision-induced dissociation of carnosine. (A) mass spectrum of fragment ions
dissociated from carnosine at a collision energy of 10 V. (B) chemical structure of carnosine.
Cleavage sites were indicated by dashed lines.

Fig. S2. Collision-induced dissociation of anserine. (A) mass spectrum of fragment ions
dissociated from anserine at a collision energy of 10 V. (B) chemical structure of anserine.
Cleavage sites were indicated by dashed lines.

Fig. S3. Adductome analysis of authentic IDPs. (A) adductome maps of authentic carnosine and
anserine indicated by 1 and 2, respectively. (B) chemical structure of carnosine and anserine.