Discovery and optimization of phthalazinone derivatives as a new class of potent dengue virus inhibitors

Article abstract of DOI:10.1016/j.ejmech.2018.01.008

Using a dengue replicon cell line-based screening, we identified 3-(dimethylamino)propyl(3-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carbamate (10a) as a potent DENV-2 inhibitor, with an IC₅₀ value of 0.64 μM. A series of novel phthalazinone derivatives based on hit 10a were synthesized and evaluated for their in vitro anti-DENV activity and cytotoxicity. The subsequent SAR study and optimization led to the discovery of the most promising compound 14l, which displayed potent anti-DENV-2 activity, with low IC₅₀ value against DENV-2 RNA replication of 0.13 μM and high selectivity (SI = 89.2) with acceptable pharmacokinetics profiles.

Full text of DOI:10.1016/j.ejmech.2018.01.008

Accepted Manuscript
Discovery and optimization of phthalazinone derivatives as a new class of potent
dengue virus inhibitors
Dong Lu, Jianan Liu, Yunzhe Zhang, Feifei Liu, Limin Zeng, Runze Peng, Li Yang,
Huazhou Ying, Wei Tang, Wuhong Chen, Jianping Zuo, Xiankun Tong, Tao Liu,
Youhong Hu
PII:
S0223-5234(18)30008-4
10.1016/j.ejmech.2018.01.008
EJMECH 10085
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 12 October 2017
Revised Date: 2 January 2018
Accepted Date: 4 January 2018
Please cite this article as: D. Lu, J. Liu, Y. Zhang, F. Liu, L. Zeng, R. Peng, L. Yang, H. Ying, W. Tang,
W. Chen, J. Zuo, X. Tong, T. Liu, Y. Hu, Discovery and optimization of phthalazinone derivatives as
a new class of potent dengue virus inhibitors, European Journal of Medicinal Chemistry (2018), doi:
10.1016/j.ejmech.2018.01.008.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Title:
Discovery and optimization of phthalazinone derivatives as a new class of potent dengue virus
inhibitors

ACCEPTED MANUSCRIPT
Graphical abstract
HTS
SARs Study
H
N
O
O
O
N
O
F3C
N
O
N
N
N
N
N
O
H
F
Lead compound 14l
Hit compound 10a
IC50 = 0.64
IC90 = 4.65
M
M
µ
µ
IC50 = 0.13
IC90 = 1.15
M
M
µ
µ
SI = 13.3
SI = 89.2
A series of novel phthalazinone derivatives was synthesized and evaluated for their in vitro
anti-DENV-2 activities. The SAR study led to the discovery of the most promising compound 14l.

ACCEPTED MANUSCRIPT
Highlights
ò
ò
ò
ò
Novel phthalazinones as dengue virus inhibitors were synthesized and evaluated.
The SAR of the phthalazinones for anti-dengue virus activity was explored.
Lead compound 14l with acceptable pharmacokinetics profiles was investigated.
The computerized docking study of 14l with dengue NS3 protease was performed.

ACCEPTED MANUSCRIPT
Title:
Discovery and Optimization of Phthalazinone derivatives as a New Class of Potent Dengue Virus
Inhibitors
Dong Lu†,b,c, Jianan Liu†,b.c, Yunzhe Zhang†,a, Feifei Liu,b,c, Limin Zengb, Runze Pengb,c, Li
Yang b, Huazhou Yinga, Wei Tangb, Wuhong Chenb, Jianping Zuob, Xiankun Tong*,b, Tao
Liu*,a, Youhong Hu*,a,b
a Zhejiang Province Key Laboratory of Anti-Cancer Drug Research, College of Pharmaceutical
Sciences, Zhejiang University, Hangzhou 310058, China
bState Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy
of Sciences, 555 Zu Chong Zhi Road, Shanghai 201203, China
c University of Chinese Academy of Sciences, No.19A Yuquan Road, Beijing 100049, China
*Corresponding author: E-mail: yhhu@simm.ac.cn, Lt601@ zju. edu.cn, xktong@simm.ac.cn
DL, JL and YZ equally contributed to this work.
Abstract:
Using
a
dengue
replicon
cell
line-based
screening,
we
identified
3-(dimethylamino)propyl(3-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carba
mate (10a) as a potent DENV-2 inhibitor, with an IC50 value of 0.64 µM. A series of novel
phthalazinone derivatives based on hit 10a were synthesized and evaluated for their in vitro
anti-DENV activity and cytotoxicity. The subsequent SAR study and optimization led to the
discovery of the most promising compound 14l, which displayed potent anti-DENV-2 activity,
with low IC50 value against DENV-2 RNA replication of 0.13 µM and high selectivity (SI = 89.2)
with acceptable pharmacokinetics profiles.
Key words: Phthalazinone;Dengue Virus; Inhibitor; Optimization; SAR
1. Introduction
Dengue Virus (DENV) belongs to the genus Flavivirus, family Flaviviridae, which inclu
des Flavivirus, Pestivirius, and Hepacivirus. The genome of Dengue Virus is a positive-sen
se, single-stranded RNA of approximately 11 kb, encoding three structural proteins (capsid,
premembrane and envelop) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, N
S4A, NS4B and NS5). Dengue Virus contains four serotypes, known as DENV-1-4[1-4].
Dengue, generally transmitted by Aedes mosquitos, remains a major public health issue i
n tropical and subtropical areas, which is strongly associated with flu-like symptoms, life-t
hreatening dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS)[5-7]. Indee
d, one recent estimate indicates 390 million dengue infections per year, of which about 96
million develop symptoms[8]. The incidence of dengue has grown dramatically around the
world in recent years[8].
Currently, there is still no drugs available for the treatment of DENV. Indeed, the treatment of
dengue infections is confined to symptomatic alleviation and supportive care. Thus, the
development of effective and safe anti-DENV therapeutics remains of utmost importance. With
the understanding of the dengue pathogenesis, in the recent years, a number of anti-DENV agents

ACCEPTED MANUSCRIPT
targeting both dengue viral and host proteins have been discovered, including entry inhibitors,
capsid inhibitors, NS4B inhibitors and protease inhibitors[9-20]. Among them, Celgosivir, is under
clinical trial currently. Dengue vaccine developed by Sanofi Pasteur has been listed in more than
10 countries including United States, India, Australia, Mexico and Brazil to prevent dengue
fever[21].
Figure 1
High-throughput phenotypic screening is a powerful tool to identify compounds that targeting
either viral proteins and/or host proteins, which are essential for viral replication. As a result of
DENV-2 screening of our in-house collection of compounds, a novel chemical compound
3-(dimethylamino)propyl(3-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carba
mate (10a, Figure 2) was identified as a potent DENV inhibitor, with an IC50 value of 0.64 µM
against DENV-2 RNA replication in vitro. In consideration of its novel structural scaffold,
differing from those of all reported DENV inhibitors, here we studied further the structure-activity
relationships (SARs) of the related class of compounds to find the lead compound.
Figure 2
2. Results and discussion
2.1 Chemistry
The synthetic route of compounds 10a-10e was depicted in Scheme 1. 4-Chloro-4a,8a-di
hydrophthalazin-1(2H)-one (6) was synthesized by the reported procedure[22]. Coupling of
6 with 4-fluorobenzeneboronic acid by a Suzuki reaction produced intermediate 7. Aniline
ring containing intermediates 9 was generated from 7 by using sequences involving N-ben
zylation or Chan-Lam reaction[23] followed by nitro group reduction[24]. Then, condensati
on reaction of 9 with 4-(dimethylamino)butan-1-ol in the presence of triphosgene and Et3N
produced the target compounds 10a-10e.
Scheme 1
The synthesis of compounds 11a-11d was outlined in Scheme 2. 11a was prepared by the
condensation reaction of 9c with the acyl chloride. Then, 11a was reduced with LiAlH4 to afford
11b. Alternatively, the target compounds 11c and 11d were formed by condensation reactions of
9c with the corresponding alcohol or amine in the presence of triphosgene and Et3N, respectively.
Scheme 2 and 3
The synthesis of 14a-14p was shown in Scheme 3. N-Benzylation of phthalazinone 6 with
4-nitrobenzyl bromide followed by reduction of nitro group provided the key intermediate 12.
Intermediates 13 were obtained by carrying out Suzuki cross coupling reactions. Then, the target
compounds 14a-14p were formed by the condensation reactions of 13 with the
4-(dimethylamino)butan-1-ol in the presence of triphosgene and Et3N.
2.2 SAR development and lead generation
The potential anti-DENV-2 activity and cytotoxicity of the synthesized phthalazinone analogues,
were evaluated in Huh 7 cells. The results are summarized in Tables 1-4. The concentration of the
compound that achieved 50% inhibition (IC50) and 90% inhibition (IC90) of DENV-2 RNA
replication. The concentration of the compound killing 50% (CC50) of the Huh 7 cells represented

ACCEPTED MANUSCRIPT
the cytotoxicity. The selectivity index (SI), a major pharmaceutical parameter for specific antiviral
activity, was determined as the radio of CC50 to IC50.
As shown in Table 1, para-substitution/meta-substitution (10a, 10b) analogues showed good
anti-DENV-2 activity with their IC50 values of 0.64 and 0.62 µM against DENV RNA-2
replication, respectively. However, the anti-DENV-2 activity was decreased dramatically when the
carbamate group was moved from the meta (10a) to the ortho (10c) position. In addition,
introducing a methyl group at the carbon atom (10d) or shortening the linker chain (10e) had
negative effects on antiviral activity. It was remarkable that compound 10b, with carbamate group
on para position, showed the potent antiviral activity (IC50 = 0.62 µM) and the highest SI (30.7).
Thus, compound 10b was selected as the benchmark compound for the further optimization.
Table 1
Then, to identify the optimal side chain, modification of carbamate groups was subsequently
achieved as shown in Table 2. Compound 9c, without the carbamate group, completely lost the
anti-DENV-2 activity. When the replacement of the carbamate of compound 10b with amide,
amine or carbamide produced derivatives 11a-11c, the decreasing of anti-DENV-2 activity was
observed. In addition, compound 11d without the terminal hydrophilic dimethylamino group,
decreased the maximum inhibitory activity dramatically (IC90 > 80 µM), indicating that the
terminal hydrophilic group was important for potent antiviral activity.
Table 2
The further focused modification on the B ring of phthalazinone was achieved by introducing
various heteroaryl rings. The anti-DENV-2 activity and cytotoxicity of analogues 14a-14e were
summarized in Table 3. The pyrimidyl analogue 14a, with IC50 value of 0.46 µM, exhibited
comparable anti-DENV-2 activities and lower cytotoxicity (CC50 = 65.29 µM) compared to
compound 10b. However, its maximum inhibitory activity was decreased dramatically with IC90
value of 62.38 µM. Replacement of phenyl with pyridyl (14b and 14c) or N-methylpyrazole (14d),
also resulted in a remarkable decreasing in antiviral potency. Furthermore, the phenyl analogue
14e showed higher anti-DENV-2 activities and lower cytotoxicity compared to heteroaryl
analogue (IC50 = 2.68 µM, CC50 = 16.04 µM).
Table 3
The further SAR exploration was mainly focused on the substituents of the phenyl moiety. As
shown in Table 4. Compounds 14f-14p all showed the comparable anti-DENV-2 activities with the
variety of the substitution. Generally, compounds with the different electronic substitution at para
and meta position exhibited better activity than compounds with substitution at ortho position. The
compound 14j or 14l with OCH3 or CF3 substitution at meta position exhibited the significant
activity than other compounds. Combined the consideration with the IC50, IC90 and SI, Compound
14l showed the most potency against DENV RNA replication with IC50 and IC90 values of 0.13
and 1.05 µM, respectively.
Table 4
Compound 14l was then selected for the further evaluation of the pharmacokinetics (PK)
profiles. The results of Table 5 showed that 14l was absorbed after oral dosing at 10 mg/kg,
reaching the maximum plasma concentration (Cmax) of 94.5 ng/mL at an average time (Tmax) of 8 h.
Its oral half-time (T1/2) and the AUC0-t value were 2.91 h and 883 ng*h/mL, respectively. The
average bioavailability (F) of 14l was calculated at 34.9%.
Table 5

ACCEPTED MANUSCRIPT
2.3 Molecular Docking of lead compound 14l
Molecular docking studies were performed to investigate the binding mode between 14l and the
known anti-dengue targets including NS3 protease, capsid protein, RNA polymerase, envelop
protein and methyltransferase, using Autodock vina 1.1.2 [25]. The score results showed 14l had
the strongest affinity with NS3 protease (Table S1), indicating 14l preferred to bind with NS3
protease. As shown in Fig.3A, 14l adopted a compact conformation to bind inside of the pocket of
NS3 protease. The further analysis showed that the phthalazinone core of the 14l was located at
the hydrophobic pocket, surrounded by the residues Leu-128, Phe-130, Pro-132, Tyr-150 and
Tyr-161 (Fig. 3B). A key hydrogen bond interaction was observed between the carbonyl of
carbamate and the residue Gly-153 (bond distance: 2.1 Å). Moreover, the phenyl group containing
trifluoromethyl formed π-π interaction with the residue Tyr-161. The above molecular simulations
provided some valuable information for next target identification.
Figure 3
3. Conclusions
In conclusion, a series of novel phthalazinone derivatives based on hit 10a were synthesized
and evaluated for their in vitro anti-DENV RNA replication and cytotoxicity. The SAR results
showed that the carbamate with a terminal hydrophilic group is crucial for its excellent antiviral
activity. The SAR study and structural modification led to the discovery of the most promising
compound 14l, which displayed the potent anti-DENV activity, with IC50 value against DENV-2
RNA replication of 0.13 µM and high selectivity (SI = 89.2). Further mechanism study and
drug-like optimization of 14l are currently under investigation. Overall, the potent activity, the
synthetic ease and the desirable pharmacokinetics profiles for 14l as an attractive lead candidate,
is worthy for further investigation on the treatment of DENV infection.
4.1 General information
13
1H NMR and C NMR spectral data were recorded on with Varian Mercury 500, 400 or 300
NMR spectrometer and Chemical shifts (δ) were reported in parts per million (ppm), and the
signals were described as brs (broad singlet), d (doublet), dd (doublet of doublet), m (multiple), q
(quarter), s (singlet), and t (triplet). Coupling constants (J values) were given in Hz.
Low-resolution mass spectra (ESI) was obtained using Agilent HPLC-MS (1260-6120B) and all
final compounds had purity >95% determined by using High Pressure Liquid Chromatography
(HPLC) using a ZorbaxEclipase XDB-C18 column eluting with a mixture of MeCN/Water (V:V =
70: 30).
4.2 General procedure for preparation of 4-chlorophthalazin-1(2H)-one (6)
1,4-Dichloro-4a,8a-dihydrophthalazine (10 g, 50 mmol) was dissolved in AcOH (100 mL) and
o
the resulting mixture was refluxed at 120 C for 5 h. The solvent was removed under reduced
pressure and the residue was washed with water (3 x 30 mL) and dried through vacuum drying
oven to get crude product 6 as white solid. Yield 94% (8.50 g). 1H NMR (400 MHz, CDCl3) δ 9.94
– 9.87 (m, 1H), 8.48 (d, J = 8.0 Hz, 1H), 8.07 (d, J = 8.0 Hz, 1H), 8.00 – 7.87 (m, 2H). MS (ESI)
calcd for C8H7ClN2O [M+H]+ 181.0, found 181.0
4.3 General procedure for preparation of 4-(4-fluorophenyl)phthalazin-1(2H)-one (7)

ACCEPTED MANUSCRIPT
To a solution of 6 (8.50 g, 47.00 mmol) in 1,4-dioxane (200 mL) and H2O (40 mL) was
successively added (4-fluorophenyl)boronic acid (7.21 g, 51.50 mmol), Pd(dppf)2Cl2 (1.71 g, 2.34
o
mmol), and Cs2CO3 (30.00 g, 92.00 mmol).The resulting mixture was stirred at 100 C for 12 h
under argon atmosphere. Then the reaction mixture was cooled to room temperature and was
concentrated in vacuo. Then the mixture was diluted with water and extracted with ethyl acetate.
The combined organic layer was washed by saturated sodium chloride solution for three times,
dried over anhydrous Na2SO4 and concentrated under reduced pressure. The residue was purified
by silica gel chromatography to give 7 as a pale yellow solid. Yield 30% (3.60 g). 1H NMR (400
MHz, CDCl3) δ 8.46 (dd, J = 7.7, 1.1 Hz, 1H), 8.02 – 7.96 (m, 1H), 7.86 (dtd, J = 17.7, 7.3, 1.4 Hz,
2H), 7.36 (d, J = 8.4 Hz, 2H), 6.66 (d, J = 8.5 Hz, 2H), 5.27 (s, 2H). MS (ESI) calcd for
C14H10FN2O [M+H]+ 241.1, found 241.1
4.4 General procedure for preparation of 8
A mixture of the corresponding bromides (1.51 mmol) and 7 (0.30 g, 1.26 mmol) in DMF (30
mL) was added with Cs2CO3 (0.49 g, 1.51 mmol). The reaction was stirred for 5 h at 50 °C, and
then followed by dilution with water (150 mL). The mixture was extracted with ethyl acetate (50
mL×3). The combined organic layer was washed by water for two times and saturated sodium
chloride solution for one time, dried over anhydrous Na2SO4 and concentrated under reduced
pressure. The residue was purified by silica gel chromatography to afford 8a-8d.
4-(4-fluorophenyl)-2-(2-nitrobenzyl)phthalazin-1(2H)-one (8a).
1
Yellow oil (385mg, 81 %). H NMR (400 MHz, CDCl3) δ 8.58 – 8.53 (m, 1H), 8.38 (s, 1H),
8.17 (dd, J = 8.2, 1.2 Hz, 1H), 7.90 – 7.78 (m, 3H), 7.74 (dd, J = 6.9, 2.1 Hz, 1H), 7.64 – 7.51 (m,
3H), 7.25 (d, J = 8.6 Hz, 2H), 5.57 (s, 2H). MS (ESI) calcd for C21H15FN3O3 [M+H]+ 376.1, found
376.1
4-(4-fluorophenyl)-2-(3-nitrobenzyl)phthalazin-1(2H)-one (8b).
White solid (298mg, 63%). 1H NMR (400 MHz, CDCl3) δ 8.59 – 8.55 (m, 1H), 8.13 – 8.08 (m,
1H), 7.86 – 7.76 (m, 3H), 7.62 – 7.53 (m, 3H), 7.49 – 7.43 (m, 1H), 7.28 – 7.20 (m, 3H), 5.88 (d, J
= 24.0 Hz, 2H). MS (ESI) calcd for C21H15FN3O3 [M+H]+ 376.1, found 376.1
4-(4-fluorophenyl)-2-(4-nitrobenzyl)phthalazin-1(2H)-one (8c).
Yellow solid (287mg, 60%). 1H NMR (400 MHz, CDCl3) δ 8.55 (dd, J = 6.8, 2.4 Hz, 1H), 8.22
(s, 1H), 7.85 – 7.81 (m, 2H), 7.75 (t, J = 2.8 Hz, 1H), 7.67 (d, J = 8.7 Hz, 2H), 7.61 – 7.55 (m, 3H),
7.24 (d, J = 8.6 Hz, 2H), 5.56 (s, 2H). MS (ESI) calcd for C21H15FN3O3 [M+H]+ 376.1, found
376.1
4-(4-fluorophenyl)-2-(1-(4-nitrophenyl)ethyl)phthalazin-1(2H)-one4 (8d)
White solid (266mg, 54%). 1H NMR (400 MHz, CDCl3) δ 8.57 – 8.52 (m, 1H), 8.22 – 8.16 (m,
2H), 7.78 (dddd, J = 9.1, 7.7, 5.8, 2.2 Hz, 3H), 7.69 (t, J = 8.3 Hz, 2H), 7.60 – 7.54 (m, 2H), 7.28
– 7.22 (m, 2H), 6.58 (q, J = 7.1 Hz, 1H), 1.91 (d, J = 7.1 Hz, 3H). MS (ESI) calcd for
C22H17FN3O3 [M+H]+ 390.1, found 390.1
4.5 General procedure for preparation of 4-(4-fluorophenyl)-2-(4-nitrophenyl)phthalazin-1
(2H)-one (8e).

ACCEPTED MANUSCRIPT
To a solution of 7 (0.30 g, 2.50 mmol) in DMF (20 mL) was added (4-nitrophenyl)boronic acid
(0.47 g, 5.50 mmol), pyridine (0.39 g, 10.00 mmol) and Cu(OAc)2 (0.035 mg, 0.35 mmol). The
reaction was stirred for 12 h at room temperature under oxygen atmosphere. Then the mixture was
poured into water (60 mL) and was extracted with ethyl acetate (20 mL×3). The combined
organic layer was washed by water for two times and saturated sodium chloride solution for one
time, dried over anhydrous Na2SO4 and concentrated under reduced pressure. The residue was
1
purified by silica gel chromatography to afford 8e. Yield 89% (400 mg). H NMR (400 MHz,
CDCl3) δ 8.70 - 8.62 (m, 1H), 8.38 (t, J = 8.8 Hz, 4H), 8.09 (s, 1H), 7.91 - 7.88 (m, 1H), 7.82 (d, J
= 8.8 Hz, 3H), 7.67 (dd, J = 8.7, 5.2 Hz, 2H). MS (ESI) calcd for C20H13FN3O3 [M+H]+ 362.1,
found 362.1
4.6 General procedure for preparation of 10
i
To a solution of 8 (1.00 mmol) in PrOH (30 mL) was added B2Pin2 (1.01 g, 4.00 mmol) and
o
KOtBu (0.028 g, 2.50 mmol). The reaction was stirred at 110 C. After 12 h, the mixture was
cooled to room temperature and was concentrated in vacuo. Then the mixture was diluted with
water and extracted with ethyl acetate. The combined organic layer was washed by saturated
sodium chloride solution for three times, dried over anhydrous Na2SO4 and concentrated under
reduced pressure. The residue was purified by silica gel chromatography to give 9.
To a stirred solution of 9 (0.29 mmol) and triphosgene (0.086 g, 0.33 mmol) in anhydrous
o
dichloromethane (5 mL) at 0 C was added triethylamine (0.12 mL, 0.87 mmol) under nitrogen
atmosphere. Then a solution of 4-(dimethylamino)butan-1-ol (0.87 mmol) in dichloromethane (5
mL) was added. The mixture was stirred at room temperature overnight, diluted with
dichloromethane (15 mL) and washed with water (3 × 20 mL). The organic phases were separated,
combined, dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by
using column chromatography to afford the corresponding product 10a-10e.
4-(dimethylamino)butyl(3-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carba
mate (10a).
1
Yellow solid (57mg, 51%, 2 steps). H NMR (400 MHz, CDCl3) δ 8.56 – 8.53 (m, 1H), 7.78
(dd, J = 8.8, 7.1, 3.6 Hz, 2H), 7.74 – 7.70 (m, 1H), 7.64 – 7.59 (m, 2H), 7.45 (s, 2H), 7.26 (t, J =
1.9 Hz, 1H), 7.24 (s, 1H), 7.22 (s, 1H), 7.20 (d, J = 7.7 Hz, 1H), 5.45 (s, 2H), 4.17 (t, J = 6.4 Hz,
13
2H), 2.38 – 2.31 (m, 2H), 2.27 (s, 6H), 1.70 (dd, J = 14.2, 6.8 Hz, 2H), 1.62 – 1.56 (m, 2H). C
NMR (126 MHz, CDCl3) δ 163.31 (d, J = 249.0 Hz), 159.01, 153.55, 146.19, 138.19, 137.82,
132.93, 131.49, 131.43, 131.21 (d, J = 3.3 Hz), 129.29, 129.15, 128.40, 127.44, 126.47 , 123.57,
118.87, 118.08, 115.77, 115.60, 64.96, 59.09, 54.87 , 45.24 , 26.76, 23.83. MS (ESI) calcd for
C28H30FN4O3 [M+H]+ 489.2, found 489.2
4-(dimethylamino)butyl(4-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carba
mate (10b).
Yellow solid (44mg, 45%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.56 – 8.52 (m, 1H), 7.77 (tt,
J = 8.6, 3.6 Hz, 2H), 7.72 – 7.68 (m, 1H), 7.61 – 7.55 (m, 2H), 7.49 (d, J = 8.5 Hz, 2H), 7.37 (d, J
= 7.7 Hz, 2H), 7.24 (t, J = 8.6 Hz, 2H), 5.43 (s, 2H), 4.17 (t, J = 6.3 Hz, 2H), 2.39 (d, J = 7.5 Hz,
2H), 2.29 (s, 6H), 1.69 (dd, J = 13.4, 6.8 Hz, 2H), 1.61 (dd, J = 10.2, 5.2 Hz, 2H). 13C NMR (126

ACCEPTED MANUSCRIPT
MHz, CDCl3) δ 163.30 (d, J = 249.0 Hz), 158.93, 153.58, 146.10, 137.56, 132.89, 131.93, 131.44
(d, J = 5.0 Hz), 131.36, 131.27, 129.67, 129.11, 128.43, 127.41, 126.42, 118.73, 115.79, 115.61,
64.88, 59.01, 54.47, 45.13, 26.70, 23.70. MS (ESI) calcd for C28H30FN4O3 [M+H]+ 489.2, found
489.2.
4-(dimethylamino)butyl(2-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carba
mate (10c).
1
Yellow solid (42mg, 43 %, 2 steps). H NMR (400 MHz, CDCl3) δ 9.66 (s, 1H), 8.55 (dd, J =
7.7, 1.1 Hz, 1H), 7.89 (s, 1H), 7.83 (dd, J = 14.9, 7.2, 1.5 Hz, 2H), 7.74 (d, J = 7.8 Hz, 1H), 7.66
(dd, J = 7.7, 1.5 Hz, 1H), 7.64 – 7.59 (m, 2H), 7.38 – 7.32 (m, 1H), 7.30 (d, J = 2.1 Hz, 1H), 7.28
– 7.25 (m, 1H), 7.14 – 7.07 (m, 1H), 5.44 (s, 2H), 4.26 (t, J = 6.2 Hz, 2H), 3.09 – 3.01 (m, 2H),
2.77 (s, 6H), 1.99 (dd, J = 15.7, 8.2 Hz, 2H), 1.86 (dd, J = 13.6, 6.5 Hz, 2H). MS (ESI) calcd for
C28H30FN4O3 [M+H]+ 489.2, found 489.2.
4-(dimethylamino)butyl(4-(1-(4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)ethyl)phenyl)carba
mate (10d).
1
Yellow solid (59mg, 48%, 2 steps). H NMR (400 MHz, CDCl3) δ 8.53 (dd, J = 6.3, 2.7 Hz,
1H), 7.79 – 7.71 (m, 3H), 7.59 – 7.54 (m, 2H), 7.48 (d, J = 8.6 Hz, 2H), 7.40 (d, J = 8.4 Hz, 2H),
7.23 (t, J = 8.7 Hz, 2H), 6.48 (q, J = 7.1 Hz, 1H), 4.16 (t, J = 6.1 Hz, 2H), 2.84 – 2.78 (m, 2H),
2.61 (s, 6H), 1.84 (s, 2H), 1.83 (d, J = 7.1 Hz, 3H), 1.76 – 1.68 (m, 2H). MS (ESI) calcd for
C29H32FN4O3 [M+H]+ 503.2, found 503.2.
4-(Dimethylamino)butyl(4-(4-(4-fluorophenyl)-1-oxo-1,8a-dihydrophthalazin-2(4aH)-yl)phenyl
)carbamate (10e)
Yellow solid (55mg, 53%, 2 steps) 1H NMR (400 MHz, CDCl3) δ 8.66 – 8.60 (m, 1H), 7.84 (dq,
J = 7.1, 5.5 Hz, 2H), 7.77 (d, J = 7.1 Hz, 1H), 7.70 – 7.63 (m, 4H), 7.53 (d, J = 8.3 Hz, 2H), 7.24
(t, J = 8.7 Hz, 2H), 4.22 (t, J = 6.4 Hz, 2H), 2.43 (d, J = 7.5 Hz, 2H), 2.33 (s, 6H), 1.77 – 1.71 (m,
2H), 1.66 (d, J = 7.1 Hz, 2H). MS (ESI) calcd for C27H28FN4O3 [M+H]+ 475.2, found 475.2
4.7 General procedure for preparation of 4-(dimethylamino)-N-(4-((4-(4-fluorophenyl)-1-ox
ophthalazin-2(1H)-yl)methyl)phenyl)butanamide (11a)
To a stirred solution of 4-(dimethylamino)butanoic acid (70 mg, 0.42 mmol) in anhydrous
dichloromethane (10 mL) at 0 oC was added oxalyl chloride (0.11 mL,1.25 mmol) and DMF (cat).
After 3 h, the solvent was removed under reduced pressure and the residue was dissolved with
anhydrous THF (10 mL) to get acyl chloride intermediate. Then acyl chloride intermediate was
slowly added to the solution of 9c (97mg, 0.35mmol) and Et3N (0.12 mL, 0.83 mmol) at 0 oC. The
organic phases were separated, combined, dried over anhydrous Na2SO4 and concentrated in
vacuo. The residue was purified by using column chromatography to afford the 11a.
Yellow solid (98mg, 61%). 1H NMR (400 MHz, CDCl3) δ 9.86 (s, 1H), 8.51 (dd, J = 6.8, 2.5 Hz,
1H), 7.76 (ddt, J = 9.8, 7.1, 3.4 Hz, 2H), 7.69 (dt, J = 6.5, 3.2 Hz, 1H), 7.56 (ddd, J = 17.4, 8.7,
5.3 Hz, 4H), 7.47 (d, J = 8.5 Hz, 2H), 7.26-7.19 (m, 2H), 5.42 (s, 2H), 2.51 (dd, J = 14.2, 7.3 Hz,

ACCEPTED MANUSCRIPT
13
4H), 2.37 (s, 6H), 1.94 – 1.86 (m, 2H). C NMR (126 MHz, CDCl3) δ 171.21, 163.30 (d, J =
248.9 Hz), 158.93, 146.11, 138.35, 132.91, 132.20, 131.45 (d, J = 5.4 Hz), 131.36, 131.23 (d, J =
3.2 Hz), 129.44, 129.10, 128.40, 127.36, 126.43, 119.57, 115.79, 115.61, 58.59, 54.59, 44.66,
36.07, 22.35. MS (ESI) calcd for C27H28FN4O2 [M+H]+ 459.2, found 459.2.
4.8
General
procedure
for
preparation
of2-(4-((4-(dimethylamino)butyl)amino)benzyl)-4-(4-fluorophenyl)phthalazin-1(2H)-one (11b)
To a solution of 11a (90 mg, 0.20 mmol) in anhydrous THF (20 mL) was added LiAlH4 (9 mg,
0.24 mmol) at refluxing. After 2 hours, the solvent was removed under reduced pressure. The
residue was purified by using column chromatography to afford the 11b.
Yellow solid (70mg, 78%). 1H NMR (400 MHz, CDCl3) δ 8.54 (d, J = 7.4 Hz, 1H), 7.81 - 7.68
(m, 3H), 7.62 - 7.53 (m, 3H), 7.40 (d, J = 8.5 Hz, 2H), 7.23 (dd, J = 18.4, 9.8 Hz, 2H), 6.61 (s,
1H), 5.36 (s, 2H), 3.21 (dd, J = 13.3, 6.6 Hz, 2H), 3.03 - 2.95 (m, 2H), 2.77 (s, 6H), 1.97 (d, 2H),
1.74 (d, J = 6.9 Hz, 2H). MS (ESI) ) calcd for C27H30FN4O [M+H]+ 445.2, found 445.2.
4.9 General procedure for preparation of 11c-11d
To a stirred solution of 9c (43 mg, 0.20 mmol) and triphosgene (36 mg, 0.20 mmol) in
o
anhydrous dichloromethane (5 mL) at 0 C was added triethylamine (60 mg, 0.60 mmol) under
nitrogen atmosphere. Then a solution of N,N-dimethylbutane-1,4-diamine (0.085 mL, 0.60 mmol)
or n-butanol (0.052 mL, 0.60 mmol) in dichloromethane (5 mL) was added. The mixture was
stirred at room temperature for overnight, and then diluted with dichloromethane (15 mL).. The
organic phases was washed with water (3×20 mL) and dried over anhydrous Na2SO4 and
concentrated in vacuo. The residue was purified by using column chromatography to afford the
corresponding product 11c-11d.
1-(4-(dimethylamino)butyl)-3-(4-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl
)urea (11c)
Yellow solid (55mg, 56%). 1H NMR (400 MHz, CDCl3) δ 8.51 (d, J = 7.8 Hz, 1H), 7.84 - 7.69
(m, 3H), 7.64 - 7.53 (m, 2H), 7.44 - 7.33 (m, 3H), 7.27 - 7.20 (m, 3H), 5.40 (s, 2H), 3.21 (s, 2H),
2.56 (s, 2H), 2.30 (s, 2H), 2.21 (s, 6H), 1.51 (s, 4H). MS (ESI) calcd for C28H31FN5O2 [M+H]+
488.2, found 488.2.
butyl (4-((4-(4-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carbamate (11d)
Yellow solid (60mg, 61%). 1H NMR (400 MHz, CDCl3) δ 8.55 (dd, J = 7.2, 2.1 Hz, 1H), 7.82 -
7.74 (m, 2H), 7.72 - 7.68 (m, 1H), 7.61 - 7.55 (m, 2H), 7.50 (d, J = 8.5 Hz, 2H), 7.36 (d, J = 8.3
Hz, 2H), 7.27 - 7.21 (m, 2H), 5.43 (s, 2H), 4.17 (t, J = 6.7 Hz, 2H), 1.65 (d, J = 7.8 Hz, 2H), 1.42
(dd, J = 15.1, 7.5 Hz, 2H), 0.96 (t, J = 7.4 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ 165.20 (d, J =
249.1 Hz), 160.84, 155.58, 148.01, 139.54, 134.80, 133.74, 133.35 (d, J = 5.2 Hz), 133.26, 133.15
(d, J = 3.2 Hz), 131.59, 131.00, 130.33, 129.32, 128.33, 120.53, 117.70, 117.52, 67.02, 56.39,
32.85, 20.97, 15.63. MS (ESI) calcd for C26H25FN3O3 [M+H]+ 446.2, found 446.2.
4.10 General procedure for preparation of 2-(4-Aminobenzyl)-4-chlorophthalazin-1(2H)-on
e (12)
To a solution of 6 (3.00 g, 12.50 mmol) was added 1-bromo-4-(nitromethyl)benzene (3.24 g,
15.00 mmol) and Cs2CO3 (4.89 g, 15.00 mmol). The reaction mixture was stirred at 50 oC. After 5
h, the mixture was poured into water (100 mL) and then was extracted with ethyl acetate (100 mL

ACCEPTED MANUSCRIPT
×3). The combined organic layer was washed by water for two times and saturated sodium
chloride solution for one time, dried over anhydrous Na2SO4 and concentrated under reduced
pressure. The crude product was further reacted directly for next step without purification. The
i
crude product above (3.00 g, 9.50 mmol) was dissolved in PrOH (100 mL), the solution was
added with B2Pin2(14.47 g, 57.00 mmol), KOtBu (2.56 g, 22.80 mmol). The reaction was stirred at
110 oC. After 12 h, the reaction mixture was cooled to room temperature and was concentrated in
vacuo. Then the mixture was diluted with water and extracted with ethyl acetate. The combined
organic layer was washed by saturated sodium chloride solution for three times, dried over
anhydrous Na2SO4 and concentrated under reduced pressure. The residue was purified by silica
gel chromatography to give 12.
Yellow solid (2.15g, 60%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.59 – 8.55 (m, 1H), 8.13 –
8.08 (m, 1H), 7.86 – 7.76 (m, 3H), 7.62 – 7.53 (m, 3H), 7.49 – 7.43 (m, 1H), 7.28 – 7.20 (m, 3H),
5.88 (d, J = 24.0 Hz, 2H). MS (ESI) calcd for C15H13ClN3O [M+H]+ 286.1, found 286.1.
4.11 General procedure for preparation of 14a-14r
12 (100 mg, 0.35 mmol) was dissolved in the mixture of 1,4-dioxane (10 mL) and H2O (2.00
mL) and then added with boronic acid (2.80 mmol), Pd(dppf)2Cl2 (28 mg, 0.035 mmol) and
o
Cs2CO3 (228 mg, 0.70 mmol). The reaction was heated at 100 C under argon atmosphere. After
12h, the reaction mixture was cooled to room temperature and was concentrated in vacuo. Then
the mixture was diluted with water and extracted with ethyl acetate. The combined organic layer
was washed by saturated sodium chloride solution for three times, dried over anhydrous Na2SO4
and concentrated under reduced pressure. The residue was purified by silica gel chromatography
to give 13.
To a stirred solution of 13 and triphosgene (100 mg, 0.34 mmol) in anhydrous dichloromethane
(5 mL) was added triethylamine (104 mg, 1.02 mmol) at 0 oC under nitrogen atmosphere. After 5
minutes, a solution of 4-(dimethylamino)butan-1-ol (1.02 mmol) in dichloromethane (5.00 mL)
was added and then the mixture was stirred at room temperature for overnight. The reaction was
diluted with dichloromethane (15 mL) and washed with water (3×20 mL). The organic phases
were dried over anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by using
column chromatography to afford the corresponding product.
4-(Dimethylamino)butyl (4-((1-oxo-4-(pyrimidin-5-yl)phthalazin-2(1H)-yl)methyl)phenyl)carb
amate (14a)
1
Yellow solid (62mg, 42%, 2 steps). H NMR (400 MHz, CDCl3) δ 9.38 (s, 1H), 9.02 (s, 2H),
8.58 (dd, J = 6.3, 2.8 Hz, 1H), 7.87 – 7.83 (m, 2H), 7.67 (dd, J = 6.6, 2.6 Hz, 1H), 7.49 (d, J = 8.5
Hz, 2H), 7.41 (d, J = 8.5 Hz, 2H), 5.44 (d, J = 5.7 Hz, 2H), 4.20 (t, J = 6.2 Hz, 2H), 2.85 – 2.78 (m,
2H), 2.63 (s, 6H), 1.87 (d, J = 7.3 Hz, 2H), 1.77 (dd, J = 13.6, 6.6 Hz, 2H). MS (ESI) calcd for
C26H29N6O3 [M+H]+ 473.2, found 473.2
4-(Dimethylamino)butyl (4-((1-oxo-4-(pyridin-4-yl)phthalazin-2(1H)-yl)methyl)phenyl)carba
mate (14b)
1
Yellow solid (59mg, 36%, 2 steps). H NMR (400 MHz, CDCl3) δ 8.81 (dd, J = 4.5,
1.5 Hz, 2H), 8.58 – 8.53 (m, 1H), 7.85 – 7.77 (m, 2H), 7.74 – 7.70 (m, 1H), 7.55 (dd,
J = 4.4, 1.6 Hz, 2H), 7.49 (d, J = 8.5 Hz, 2H), 7.36 (d, J = 8.0 Hz, 2H), 5.43 (s, 2H),
4.16 (dd, J = 6.5, 4.2 Hz, 2H), 2.32 – 2.29 (m, 2H), 2.22 (s, 6H), 1.68 (d, J = 5.8 Hz,
2H), 1.57 (d, J = 7.2 Hz, 2H). 13C NMR (126 MHz, CDCl3) δ 160.76, 155.43, 152.13,

ACCEPTED MANUSCRIPT
146.28, 144.77, 139.55, 135.08, 133.70, 133.46, 131.66, 130.30, 130.19, 129.55, 127.65, 12
5.99, 120.53, 67.02, 61.15, 56.48, 47.37, 28.73, 25.97. MS (ESI) calcd for C27H30N5O3 [M
+H]+ 472.2, found 472.2.
4-(Dimethylamino)butyl (4-((1-oxo-4-(pyridin-3-yl)phthalazin-2(1H)-yl)methyl)phenyl)carba
mate (14c)
1
Yellow solid (66mg, 40%, 2 steps). H NMR (400 MHz, CDCl3) δ 9.38 (s, 1H), 9.02 (s, 2H),
8.58 (dd, J = 6.3, 2.8 Hz, 1H), 7.87 – 7.83 (m, 2H), 7.67 (dd, J = 6.6, 2.6 Hz, 1H), 7.49 (d, J = 8.5
Hz, 2H), 7.41 (d, J = 8.5 Hz, 2H), 5.44 (d, J = 5.7 Hz, 2H), 4.20 (t, J = 6.2 Hz, 2H), 2.85 – 2.78 (m,
2H), 2.63 (s, 6H), 1.87 (d, J = 7.3 Hz, 2H), 1.77 (dd, J = 13.6, 6.6 Hz, 2H). MS (ESI) calcd for
C27H30N5O3 [M+H]+ 472.2, found 472.2.
4-(Dimethylamino)butyl (4-((4-(1-methyl-1H-pyrazol-4-yl)-1-oxophthalazin-2(1H)-yl)methyl)
phenyl)carbamate (14d)
Yellow solid (70mg, 42%, 2 steps) 1H NMR (400 MHz, CDCl3) δ 8.53 (dd, J = 6.0, 3.3 Hz, 1H),
7.98 (dd, J = 6.3, 3.0 Hz, 1H), 7.85 (s, 1H), 7.83 – 7.78 (m, 2H), 7.76 (s, 1H), 7.48 (d, J = 8.5 Hz,
2H), 7.38 (d, J = 7.7 Hz, 2H), 5.40 (s, 2H), 4.18 (t, J = 5.9 Hz, 2H), 4.04 (s, 3H), 2.69 (d, J = 8.1
Hz, 2H), 2.54 (s, 6H), 1.74 (d, J = 6.1 Hz, 4H). MS (ESI) calcd for C26H31N6O3 [M+H]+ 475.2,
found 475.2.
4-(Dimethylamino)butyl(4-((1-oxo-4-phenylphthalazin-2(1H)-yl)methyl)phenyl)carbamate(14e
)Yellow solid (66mg, 40%, 2 steps) 1H NMR (400 MHz, CDCl3) δ 8.54 (d, J = 7.2 Hz, 1H), 7.76
(dt, J = 12.7, 3.9 Hz, 3H), 7.62 – 7.47 (m, 7H), 7.37 (d, J = 8.0 Hz, 2H), 5.44 (s, 2H), 4.17 (t, J =
6.3 Hz, 2H), 2.44 – 2.38 (m, 2H), 2.31 (s, 6H), 1.65 (ddd, J = 26.7, 11.1, 5.6 Hz, 4H). MS (ESI)
calcd for C28H31N4O3 [M+H]+ 471.2, found 471.2.
4-(Dimethylamino)butyl (4-((4-(4-methoxyphenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)c
arbamate (14f)
Yellow solid (90mg, 52%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.56 – 8.49 (m, 1H), 7.78 –
7.73 (m, 3H), 7.55 – 7.46 (m, 4H), 7.35 (d, J = 8.0 Hz, 2H), 7.08 – 7.04 (m, 2H), 5.41 (d, J = 8.6
Hz, 2H), 4.16 (t, J = 6.5 Hz, 2H), 3.90 (s, 3H), 3.56 (d, J = 5.5 Hz, 2H), 2.26 (s, 6H), 1.67 (dd, J =
4.7, 2.4 Hz, 4H). MS (ESI) calcd for C29H33N4O4 [M+H]+ 501.2, found 501.2.
4-(Dimethylamino)butyl(4-((4-(4-cyanophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carba
mate (14g)
Yellow solid (80mg, 46%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.58 – 8.54 (m, 1H), 7.86 –
7.76 (m, 4H), 7.75 – 7.72 (m, 2H), 7.66 (dd, J = 7.4, 1.7 Hz, 1H), 7.48 (d, J = 8.5 Hz, 2H), 7.37 (d,
J = 8.2 Hz, 2H), 5.42 (s, 2H), 4.17 (t, J = 6.3 Hz, 2H), 2.44 – 2.38 (m, 2H), 2.32 (s, 6H), 1.73 –
1.68 (m, 2H), 1.63 (dd, J = 10.3, 5.4 Hz, 2H). MS (ESI) calcd for C29H30N5O3 [M+H]+ 496.2,
found 496.2.
4-(Dimethylamino)butyl (4-((1-oxo-4-(4-(trifluoromethyl)phenyl)phthalazin-2(1H)-yl)methyl)
phenyl)carbamate (14h)
Yellow solid (66mg, 35%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.57 – 8.54 (m, 1H), 7.82 (s,
1H), 7.80 (d, J = 2.6 Hz, 2H), 7.78 (dd, J = 8.0, 1.7 Hz, 1H), 7.74 (d, J = 2.6 Hz, 1H), 7.72 (s, 1H),
7.68 (dd, J = 7.4, 1.8 Hz, 1H), 7.49 (d, J = 8.5 Hz, 2H), 7.38 (dd, J = 12.6, 7.2 Hz, 2H), 5.43 (s,
2H), 4.17 (t, J = 6.6 Hz, 2H), 2.28 (d, J = 9.0 Hz, 2H), 2.22 (s, 6H), 1.68 (dd, J = 14.8, 6.8 Hz, 2H),
1.56 (td, J = 8.2, 4.3 Hz, 2H). MS (ESI) calcd for C29H30F3N4O3 [M+H]+ 539.2, found 539.2.
4-(Dimethylamino)butyl (4-((4-(3-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carb
amate (14i)

ACCEPTED MANUSCRIPT
1
Yellow solid (65mg, 38%, 2 steps). H NMR (400 MHz, CDCl3) δ 8.54 (dd, J = 6.7,
2.1 Hz, 1H), 7.80 – 7.71 (m, 3H), 7.50 (dd, J = 11.4, 5.0 Hz, 3H), 7.34 (ddd, J = 10.9,
10.2, 4.7Hz, 5H),7.23 (td, J = 8.4, 1.7 Hz, 1H), 5.43 (s, 2H), 4.17 (t, J = 6.5 Hz, 2H),
2.31 – 2.26 (m, 2H), 2.22 (s, 6H), 1.72 – 1.67 (m, 2H), 1.59 – 1.52 (m, 2H). MS (ESI)
calcd for C28H30FN4O3 [M+H]+ 489.2, found 489.2.
4-(Dimethylamino)butyl (4-((4-(3-methoxyphenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)c
arbamate (14j)
Yellow solid (72mg, 41%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.52 (d, J = 7.8 Hz, 1H),
7.76 (t, J = 6.8 Hz, 3H), 7.47 (t, J = 8.1 Hz, 3H), 7.44 – 7.40 (m, 2H), 7.16 (d, J = 7.5 Hz, 1H),
7.11 (s, 1H), 7.06 (d, J = 8.1 Hz, 1H), 5.42 (s, 2H), 4.16 (t, J = 6.0 Hz, 2H), 3.88 (s, 3H), 2.82 –
2.74 (m, 2H), 2.59 (s, 6H), 1.83 (d, J = 7.7 Hz, 2H), 1.74 – 1.69 (m, 2H). MS (ESI) calcd for
C29H33N4O4 [M+H]+ 501.2, found 501.2.
4-(Dimethylamino)butyl (4-((4-(3-cyanophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carb
amate (14k)
Yellow solid (85mg, 49%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.58 – 8.54 (m, 1H), 7.91 (t,
J = 1.4 Hz, 1H), 7.87 – 7.79 (m, 4H), 7.71 – 7.67 (m, 1H), 7.66 – 7.62 (m, 1H), 7.48 (d, J = 8.6 Hz,
2H), 7.36 (d, J = 8.3 Hz, 2H), 5.43 (s, 2H), 4.17 (t, J = 6.6 Hz, 2H), 2.32 – 2.27 (m, 2H), 2.23 (d, J
= 2.8 Hz, 6H), 1.74 – 1.65 (m, 2H), 1.60 – 1.51 (m, 2H). MS (ESI) calcd for C29H30N5O3 [M+H]+
496.2, found 496.2.
4-(Dimethylamino)butyl (4-((1-oxo-4-(3-(trifluoromethyl)phenyl)phthalazin-2(1H)-yl)methyl)
phenyl)carbamate (14l)
Yellow solid (85mg, 45%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.58 – 8.53 (m, 1H), 7.87 (s,
1H), 7.82 – 7.75 (m, 4H), 7.71 – 7.63 (m, 2H), 7.49 (d, J = 8.5 Hz, 2H), 7.37 (d, J = 8.2 Hz, 2H),
5.43 (s, 2H), 4.17 (t, J = 6.4 Hz, 2H), 2.41 – 2.35 (m, 2H), 2.29 (s, 6H), 1.70 (dt, J = 12.8, 6.5 Hz,
2H), 1.65 – 1.57 (m, 2H). 13C NMR (126 MHz, CDCl3) δ 158.89, 153.56, 145.51, 137.63, 136.01,
133.11, 132.89, 131.77, 131.66, 131.28, 131.02, 129.71, 129.21, 128.79, 128.44, 127.56, 126.38
(d, J = 3.7 Hz), 126.05, 125.89 (d, J = 3.6 Hz), 123.90 (q, J = 272.5 Hz), 118.75, 64.87, 58.99,
54.58, 45.10, 26.68 , 23.66 . MS (ESI) calcd for C29H30F3N4O3 [M+H]+ 539.2, found 539.2.
HRMS (ESI) calcd for C29H30F3N4O3 [M+H]+ 539.2265, found 539.2270.
4-(Dimethylamino)butyl (4-((4-(2-fluorophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carb
amate (14m)
Yellow solid (68mg, 40%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.58 – 8.53 (m, 1H), 7.87 (s,
1H), 7.82 – 7.75 (m, 4H), 7.71 – 7.63 (m, 2H), 7.49 (d, J = 8.5 Hz, 2H), 7.37 (d, J = 8.2 Hz, 2H),
5.43 (s, 2H), 4.17 (t, J = 6.4 Hz, 2H), 2.41 – 2.35 (m, 2H), 2.29 (s, 6H), 1.70 (dt, J = 12.8, 6.5 Hz,
2H), 1.65 – 1.57 (m, 2H). 13C NMR (126 MHz, CDCl3) δ 162.19 (d, J = 249.3 Hz), 160.99 ,
144.58 , 139.42 , 134.85 , 133.75 , 133.43 , 133.23 (d, J = 8.0 Hz), 131.52 , 131.35 , 129.91 ,
128.96 , 128.30 , 126.54 (d, J = 3.4 Hz), 124.98 , 124.86 , 120.58 , 118.04 , 117.87 , 66.87 , 61.01 ,
56.50 , 47.17 , 28.65 , 25.74 .MS (ESI) calcd for C28H30FN4O3 [M+H]+ 489.2, found 489.2.
4-(Dimethylamino)butyl (4-((4-(2-methoxyphenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)c
arbamate (14n)
Yellow solid (96mg, 55%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.48 (d, J = 7.8 Hz, 1H),
7.70 (dt, J = 13.7, 6.5 Hz, 2H), 7.54 – 7.45 (m, 3H), 7.39 – 7.31 (m, 4H), 7.13 (t, J = 7.4 Hz, 1H),
7.06 (d, J = 8.3 Hz, 1H), 5.55 (d, J = 13.8 Hz, 1H), 5.30 (d, J = 13.2 Hz, 1H), 4.17 (t, J = 6.4 Hz,

ACCEPTED MANUSCRIPT
2H), 3.74 (s, 3H), 2.33 (d, J = 7.4 Hz, 2H), 2.26 (s, 6H), 1.69 (d, J = 7.2 Hz, 2H), 1.59 (d, J = 7.1
Hz, 2H). MS (ESI) calcd for C29H33N4O4 [M+H]+ 501.2, found 501.2.
4-(Dimethylamino)butyl (4-((4-(2-cyanophenyl)-1-oxophthalazin-2(1H)-yl)methyl)phenyl)carb
amate (14o)
Yellow solid (89mg, 51%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.55 (d, J = 7.5 Hz, 1H),
7.91 (d, J = 7.9 Hz, 1H), 7.79 (dd, J = 14.3, 7.9 Hz, 3H), 7.65 (dd, J = 16.8, 7.4 Hz, 2H), 7.52 (d, J
= 8.6 Hz, 2H), 7.45 (d, J = 8.2 Hz, 1H), 7.39 (s, 2H), 5.45 (s, 2H), 4.19 (s, 2H), 2.78 (s, 2H), 2.60
(s, 6H), 1.85 (s, 2H), 1.75 (s, 2H). MS (ESI) calcd for C29H30N5O3 [M+H]+ 496.2, found 496.2.
4-(Dimethylamino)butyl (4-((1-oxo-4-(2-(trifluoromethyl)phenyl)phthalazin-2(1H)-yl)methyl)
phenyl)carbamate (14p)
Yellow solid (81mg, 46%, 2 steps). 1H NMR (400 MHz, CDCl3) δ 8.47 (d, J = 5.9 Hz, 1H),
8.20 (s, 1H), 7.74 (dd, J = 14.5, 10.8 Hz, 3H), 7.59 (dd, J = 15.5, 10.5 Hz, 3H), 7.38 (d, J = 7.3 Hz,
1H), 7.20 (dt, J = 16.4, 8.2 Hz, 3H), 7.02 (d, J = 7.3 Hz, 1H), 5.40 (s, 2H), 3.16 (s, 2H), 2.75 (d, J
= 13.2 Hz, 2H), 2.59 (s, 6H), 1.70 (s, 2H), 1.49 (d, J = 6.2 Hz, 2H). MS (ESI) calcd for
C29H30F3N4O3 [M+H]+ 539.2, found 539.2.
4.12 Anti-DV2 activity test of SAR research
The antiviral activity of compound was tested using an clinical infectious DENV-2 virus strain
(D2Y98P strain, serotype Ⅱ).
Virus was propagated in C6/36 cells. C6/36 cells were cultured in RPMI-1640 medium with 5%
FBS, 28 ℃, 5% CO2. Cells were re-seeded into T75 flask before inoculated with virus for 2
hours. Medium was refreshed (5% FBS RPMI 1640) and infected cells were cultured under 33℃
for 6 days. Virus stock solution was purified and concentrated. Virus was tittered in BHK cells by
plaque formation assay.
For compound anti-DV2 test in Huh7 cells, which is a human hepatocarcinoma cell line. Huh7
cells were cultured in high glucose DMEM medium with 10% FBS, 37 ℃, 5% CO2. Before
compound anti-DV2 test, 4×104 Huh7 cells were seeded into 96 well plate with 2% FBS DMEM
and cultured overnight. Cells were then infected with DENV-2 virus at MOI=2 for 2 hrs.
Multiplicity of infection (MOI) is the ratio of infectious virus particles versus cell number,
therefore, MOI=2 means nearly all cells were infected by virus initially, this produces one round
of virus replication cycle in the cell culture, no second round infection by progeny virus. Virus
inoculation was washed out and replaced with fresh medium after initial infection and compounds
were added at demand concentration. After 48 hrs, cell culture supernatant were collected for viral
genomic RNA quantification by method described below. Cytotoxic effect of compounds were
assayed by MTT method which evaluated the reduction product of MTT by cellular
succinatedehydrogenase as an indicator of cell liability. CC50 indicates the concentration of
compound at which reducing the readout to half of the no compound control.
Supernatant DV2 viral genomic RNA was quantified by one-step qRT-PCR method. DV2 viral
genomic RNA in cell culture supernatant were first extracted by Qiasymphony SP/AS automatic
nucleic acid purification station (QIAsymphony Virus/Bacteria Mini Kit, Cellfree200 default IC
protocol, 110 µL eluent). One-step quantification PCR was set up using Quantitect Multiplex
RT-PCR kit according to manual. Pure viral RNA containing viral 3’UTR region obtained by in
vitro transcription from cloned plasmid was used as standard to evaluate absolute viral genomic
RNA quantity in cell culture supernatant. IC90 and IC50 are compound concentrations needed to

ACCEPTED MANUSCRIPT
reduce viral RNA quantities by 90% and 50% respectively. Primers and Taqman probes were
synthesized by Thermo using sequence listed below:
qDV2Lab3UTR/Sp: TGTAGCTCCACCTGAGAAGG
qDV2Lab3UTR/Asp: CATTGTTGCTGCGATTTGTA
qDV2Lab3UTR/Probe: FAM-CCATGGTTTGTGGCCTCCCA-BQ1
4.13 Experimental protocol for the pharmacokinetic study
Six naive male CD-1 mice weighing 18 to 22 g were divided randomly into 2 groups, Mice
were housed under standard conditions and had adlibitum access to water and a standard
laboratory diet.
Each mouse was housed individually in a mouse metabolic cage and was not restrained at
any time during the study. The mice were starved for 12 h before the experiments with the
exception of free access to water and were fed 2h after administration.
The oraling solution was prepared by dissolving appropriate amount in 0.5% MC (without
DMSO). For IV route, 14l was dissolved in 5% DMSO, then added respectively EtOH, PEG300
and saline (5/40/50, v/v/v) in the solution. The drug solution was sampled (before and after
administration, 50 µL mixed with 50 µL DMSO) to be measured.
Blood samples (25 µL each) were collected from the femoral vein at scheduled time point
(0.25, 0.5, 1, 2, 4, 8, 24 h for PO and at 3 min, 0.25, 0.75, 2, 4, 8, 24 h for IV) with EDTA as
anticoagulant. The blood was centrifuged immediately at 11000 rpm for 5 mins. 10 µL plasma was
transfered into a new centrifuge tube with a pre added PK-IS solution of 100 µL (methanol:
acetonitrile (1:1, v/v)) immediately, which was mixed well and stored at -20 oC to be measured.
Pharmacokinetic parameters including half-life (t1/2), maximum plasma time (tmax),
concentration (Cmax), area under concentration–time curve (AUClast and AUCInf), clearance (CL),
steady-state volume of distribution (Vss), bioavailability(F), pharmacokinetic parameters were
analyzed by non-compartmental method using WinNonlin Version 6.4 (Pharsight Corporation,
Mountain View, USA).
ACKNOWLEDGMENT. This work was supported by grants from National Key
Research and Development Program of China (2016YFC1200400),and Defense
Technology Innovation Fund, Chinese Academy of Sciences (CXJJ-17-Q147), and
National Natural Science Foundation of China(81502914).
References
[1] JG. Rigau-Pérez, GG. Clark, DJ. Gubler, P. Reiter, EJ. Sanders, AV. Vorndam, Dengue and
dengue haemorrhagic fever. Lancet. 352 (1999) 971-977.
[2] DJ. Gubler, The economic burden of dengue. Am. J. Trop. Med. Hyg. 86 (2012) 743-744.
[3] G. Screaton, J. Mongkolsapaya, S. Yacoub, C. Roberts. New insights into the
immunopathology and control of dengue virus infection. Nat Rev Immunol. 15 (2015)
745-59.
[4] KI. Hidari, T．Suzuki, Dengue virus receptor．Trop MedHealth. 39 (2011) 37-43．
[5] YY. Cheung, KC. Chen, H. Chen, EK. Seng, JJ. Chu. Antiviral activity of lanatoside C
against dengue virus infection. Antiviral Res. 111 (2014) 93-99.

ACCEPTED MANUSCRIPT
[6] J. Whitehorn, CP. Simmons, The pathogenesis of dengue. Vaccine. 29 (2011) 7221-7228.
[7] MG. Guzman, M. Alvarez, SB. Halstead, Secondary infection as a risk factor for dengue
hemorrhagic fever/dengue shock syndrome: an historical perspective and role of
antibody-dependent enhancement of infection. Arch. Virol. 158 (2013) 1445-1459.
[8] The data was cited in the WHO website: http://www.who.int/mediacentre/factsheets/fs117/en/
[9] S. Bhakat, W. Karubiu, V. Jayaprakash, ME. Soliman. A perspective on targeting
non-structural proteins to combat neglected tropical diseases: Dengue, West Nile and
Chikungunya viruses. Eur. J. Med. Chem. 87 (2014) 677-702.
[10] H. Beesetti, N. Khanna, S. Swaminathan, Drugs for dengue: a patent review (2010 – 2014).
Expert. Opin. Ther. Pat. 24 (2014) 1171-1184.
[11] S. Kaptein and J. Neyts, Towards antiviral therapies for treating dengue virus infections. Curr.
Opin. Pharmacol. 30 (2016) 1-7.
[12] SP. Lim, QY. Wang, CG. Noble, YL. Chen, H. Dong, B. Zou, F. Yokokawa, S. Nilar, P. Smith,
D. Beer, J. Lescar, PY. Shi. Ten years of dengue drug discovery: progress and prospects.
Antiviral. Res. 100 (2013) 500-519.
[13] B. Chao, XK. Tong, W. Tang, DW. Li, PL. He, JM. Garcia, LM. Zeng, AH. Gao, L. Yang, J.
Li, FJ. Nan, M. Jacobs, R. Altmeyer, JP. Zuo, YH. Hu, Discovery and optimization of
2,4-diaminoquinazoline derivatives as a new class of potent dengue virus inhibitors. J. Med.
Chem. 55 (2012) 3135-3143.
[14] B. Zou, WL. Chan, M. Ding, SY. Leong, PY. Shi, PW. Smith, Lead optimization of
spiropyrazolopyridones: a new and potent class of dengue virus inhibitors. ACS. Med. Chem.
Lett. 6 (2015) 344-348.
[15] CS. Kounde, HQ. Yeo, QY. Wang, BK. Yeung, F. Yokokawa, Discovery of 2-oxopiperazine
dengue inhibitors by scaffold morphing of a phenotypic high-throughput screening hit.
Bioorg. Med. Chem. Lett. 27 (2017) 1385-1389.
[16] F. Benmansour, C. Eydoux, G. Querat, X. Lamballerie, B. Canard, K. Alvarez, JC. Guillemot,
K.
Barral,
Novel
2-phenyl-5-[(E)-2-(thiophen-2-yl)ethenyl]-1,3,4-oxadiazole
and
3-phenyl-5-[(E)-2-(thiophen-2-yl)ethenyl]-1,2,4-oxadiazole derivatives as dengue virus
inhibitors targeting NS5 polymerase. Eur. J. Med. Chem. 109 (2016) 146-156.
[17] A. Venkatesham, M. Saudi, S. Kaptein, J. Neyts, J. Rozenski, M. Froeyen, A.V. Aerschot.
Aminopurine and aminoquinazoline scaffolds for development of potential dengue virus
inhibitors. Eur. J. Med. Chem. 126 (2017) 101-109.
[18] AK. Timiri, BN. Sinha, V. Jayaprakash. Progress and prospects on DENV protease inhibitors.
Eur. J. Med. Chem. 117 (2016) 125-143.
[19] AJ. Stevens, ME. Gahan, S. Mahalingam, PA. Keller PA. The medicinal chemistry of dengue
fever. J. Med. Chem. 52 (2009) 7911-7926.
[20] MA. Behnam, C. Nitsche, V. Boldescu, CD. Klein. The Medicinal Chemistry of Dengue
Virus. J. Med. Chem. 59 (2016) 5622-5649.
[21] The data was updated in the Sanofi Pasteur official site: http://www.sanofipasteur.com/en/
[22] K. Monsieursa, P. Tapolcsányib, K. Loonesa, G. Neumajerb, J.A. Ridderc, K. Goubitzc, G.
Lemièrea, R. Dommissea, P. Mátyus, Is samoquasine A indeed benzo[f]phthalazin-4(3H)-one
Unambiguous, straightforward synthesis of benzo[f]phthalazin-4(3H)-one and its regioisomer
benzo[f]phthalazin-1(2H)-one. Tetrahedron. 63 (2007) 3870-3881.

ACCEPTED MANUSCRIPT
[23] W. Mederski, M. Lefort, M. Germann, D. Kux, N-aryl heterocycles via coupling reactions
with arylboronic acids. Tetrahedron. 55 (1999) 12757-3881.
[24] H. Lu, Z. Geng, J. Li, D. Zou, Y. Wu, Y. Wu, Metal-Free Reduction of Aromatic Nitro
Compounds to Aromatic Amines with B2pin2 in Isopropanol. Org. Lett. 18 (2016) 2774-2776.
[25] O. Trott, AJ. Olson, AutoDock Vina: improving the speed and accuracy of docking with a
new scoring function, efficient optimization, and multithreading. J Comput Chem. 31 (2010)
455-461.

ACCEPTED MANUSCRIPT
Table, Figure and Scheme Captions
Table 1. SAR study on A ring of phthalazinone core.
Table 2. SAR of substituents on benzyl moiety.
Table 3. SAR study on B ring of phthalazinone core.
Table 4. SAR study of substituents on phenyl moiety.
Table 5: In Vivo mice pharmacokinetic properties of compound 14l
Figure 1. Recently reported DENV inhibitors.
Figure 2. Structure of hit compound 10a.
Figure 3: The computerized docking modes of 14l with dengue NS3 protease. A: full view. B:
detailed view.
Scheme 1. Synthesis of 10a-10e.a
Scheme 2. Synthesis of 11a-11d. a
Scheme 3. Synthesis of 14a-14p. a

ACCEPTED MANUSCRIPT
Compd
R
CC50(µM)a
8.51
IC50(µM)b
0.64
IC90(µM)c
4.65
SId
10a
13.3
10b
10c
19.04
48.50
0.62
2.83
4.27
30.7
17.1
13.15
10d
10e
15.16
21.76
1.27
1.34
5.57
11.9
16.2
12.62
aCC50 is 50% cytotoxicity concentration in Huh 7 cells. bIC50 is 50% inhibitory concentration of cytoplasmic
DENV-RNA replication. cIC90 is 90% inhibitory concentration of cytoplasmic DENV-RNA replication.
dSelectivity index (SI) = CC50/IC50.
Table 1: SAR study on A ring of phthalazinone core.

ACCEPTED MANUSCRIPT
Compd
R
CC50(µM)a
IC50(µM)b
19.96
IC90(µM)c
SId
NH2
＞80
＞80
＞4.0
9c
11a
38.20
1.00
8.42
38.2
11b
11c
77.65
46.60
1.05
4.35
10.65
9.46
73.9
10.7
11d
19.5
1.4
＞80
14.3
aCC50 is 50% cytotoxicity concentration in Huh 7 cells. bIC50 is 50% inhibitory concentration of cytoplasmic
DENV-RNA replication. cIC90 is 90% inhibitory concentration of cytoplasmic DENV-RNA replication.
dSelectivity index (SI) = CC50/IC50.
Table 2: SAR of substituents on benzyl moiety.

ACCEPTED MANUSCRIPT
Compd
B ring
CC50(µM)a
65.29
IC50(µM)b
0.60
IC90(µM)c
62.38
SId
14a
108.8
14b
14c
62.67
67.96
22.89
6.32
40.90
30.22
2.7
10.7
55.86
16.04
14d
14e
6.53
2.68
43.31
6.09
8.5
5.99
aCC50 is 50% cytotoxicity concentration in Huh 7 cells. bIC50 is 50% inhibitory concentration of cytoplasmic
DENV-RNA replication. cIC90 is 90% inhibitory concentration of cytoplasmic DENV-RNA replication.
dSelectivity index (SI) = CC50/IC50.
Table 3: SAR study on B ring of phthalazinone core.

ACCEPTED MANUSCRIPT
Compd
R
CC50(µM)a
19.04
IC50(µM)b
0.62
IC90(µM)c
4.27
SId
30.7
10b
4-F
14f
1.94
0.70
5.88
7.07
10.5
52.8
4-OCH3
4-CN
20.34
37.00
14g
14h
14i
1.47
1.51
0.34
1.72
0.13
1.32
1.40
5.52
1.99
6.61
8.24
1.58
5.09
1.15
8.79
5.44
12.42
3.37
2.3
4-CF3
3-F
3.36
24.7
51.8
10.0
89.2
39.8
32.0
16.4
18.0
37.39
17.63
17.18
11.59
52.50
44.75
90.71
35.72
14j
3-OCH3
3-CN
3-CF3
2-F
14k
14l
14m
14n
14o
14p
2-OCH3
2-CN
2-CF3
aCC50 is 50% cytotoxicity concentration in Huh 7 cells. bIC50 is 50% inhibitory concentration of cytoplasmic
DENV-RNA replication. cIC90 is 90% inhibitory concentration of cytoplasmic DENV-RNA replication.
dSelectivity index (SI) = CC50/IC50.
Table 4: SAR study of substituents on phenyl moiety.

ACCEPTED MANUSCRIPT
Dose
route
iv
CLplasma
Vss
Tmax
(h)
--
T1/2
(h)
Cmax
(ng/mL)
--
AUClast
(ng*h/mL)
505
F
%
(mL/kg/h) (mL/kg)
50.0
--
17137
--
4.33
2.91
--
po
8
94.5
883
34.9
a Experiments were carried out in SD mice (n = 3) Dose: iv, 2.0 mg/kg (5% DMSO, 10% solutol, 10% ethanol, and
75% saline); po,10.0 mg/kg (5% DMSO, 10% solutol, 10% ethanol, and 75% saline).
Table 5: In Vivo mice pharmacokinetic properties of compound 14l

ACCEPTED MANUSCRIPT
Figure 1: Recently reported DENV inhibitors.

ACCEPTED MANUSCRIPT
Figure 2: Structure of hit compound 10a.

ACCEPTED MANUSCRIPT
A:
B:
Figure 3: The computerized docking modes of 14l with dengue NS3 protease. A: full view. B:
detailed view.

ACCEPTED MANUSCRIPT
Scheme 1: Synthesis of 10a-10e.a
o
aReagents and conditions: (a) AcOH, 120 C, 5h; (b) (4-fluorophenyl)boronic acid, Pd(dppf)2Cl2,
Cs2CO3, dioxane:H2O = 5:1, 100 oC, overnight; (c) the corresponding bromides, Cs2CO3, DMF, 50
i
o
oC, overnight; (d) B2Pin2, KOtBu, PrOH, 110 C, overnight; (e) (i) triphosgene, Et3N,
anhydrous CH2Cl2, 0 oC, 10 min; (ii) 4-(dimethylamino)butan-1-ol, rt, overnight; (f)
(4-nitrophenyl)boronic acid, pyridine, Cu(OAc)2, DMF, rt, overnight.

ACCEPTED MANUSCRIPT
Scheme 2: Synthesis of 11a-11d.a
aReagents and conditions: (a) (i) 4-(dimethylamino)butanoic acid, (COCl)2, DMF(cat), anhydrous
CH2Cl2, rt, 3h; (ii) 9c, anhydrous THF, rt, overnight; (b) LiAlH4, anhydrous THF, reflux, 5h; (c) (i)
o
triphosgene, Et3N, 0 C, 10 min; (ii) butan-1-ol or N1,N1-dimethylbutane-1,4-diamine, rt,
overnight.