Enzymatic preparation of optically pure t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate by a novel alcohol dehydrogenase discovered from Klebsiella oxytoca

Article abstract of DOI:10.1016/j.procbio.2017.03.019

Alcohol dehydrogenases can catalyze the inter-conversion of aldehydes and alcohols. The t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate is a key chiral intermediate in the synthesis of statin-type drugs such as Crestor (rosuvastatin calcium) and Lipitor (atorvastatin). Herein, a novel alcohol dehydrogenase (named as KleADH) discovered from Klebsiella oxytoca by a genome mining method was cloned and characterized. The KleADH was functionally overexpressed in Escherichia coli Rosetta (DE3) and the whole cell biocatalyst was able to convert t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate to t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate with more than 99% diastereomeric excess (de) and 99% conversion in 24?h without adding any expensive cofactors. Several factors influencing the whole cell catalyst activity such as temperature, pH, the effects of metal ions and organic solvent were determined. The optimum enzyme activity was achieved at 30?°C and pH 7.0 and it was shown that 1?mM Fe³⁺ can increase the enzyme activity by 1.2 times. N-hexane/water and n-heptane/water biphasic systems can also increase the activity of KleADH. Substrate specificity studies showed that KleADH also exhibited notable activity towards several aryl ketones with high stereoselectivity. Our investigation on this novel alcohol dehydrogenase KleADH reveals a promising biocatalyst for producing chiral alcohols for preparation of valuable pharmaceuticals.

Full text of DOI:10.1016/j.procbio.2017.03.019

Accepted Manuscript
Title: Enzymatic preparation of optically pure t-butyl
6
-chloro-(3R,5S)-dihydroxyhexanoate by a novel alcohol
dehydrogenase discovered from Klebsiella oxytoca
Authors: Tingting Xu, Can Wang, Shaozhou Zhu, Guojun
Zheng
PII:
S1359-5113(17)30043-0
DOI:
Reference:
http://dx.doi.org/doi:10.1016/j.procbio.2017.03.019
PRBI 10978
To appear in:
Process Biochemistry
Received date:
Revised date:
Accepted date:
9-1-2017
10-3-2017
21-3-2017
Please cite this article as: Xu Tingting, Wang Can, Zhu Shaozhou, Zheng
Guojun.Enzymatic preparation of optically pure t-butyl 6-chloro-(3R,5S)-
dihydroxyhexanoate by a novel alcohol dehydrogenase discovered from Klebsiella
oxytoca.Process Biochemistry http://dx.doi.org/10.1016/j.procbio.2017.03.019
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.

Enzymatic preparation of optically pure t-butyl 6-chloro-
3R,5S)-dihydroxyhexanoate by a novel alcohol
dehydrogenase discovered from Klebsiella oxytoca
(
*
*
Tingting Xu, Can Wang, Shaozhou Zhu and Guojun Zheng
State Key Laboratory of Chemical Resources Engineering, Beijing University of Chemical
Technology, Beijing, People's Republic of China
*
Correspondence
Shaozhou Zhu, E-mail: zhusz@mail.buct.edu.cn
Guojun Zheng, E-mail: zhenggj@mail.buct.edu.cn
State Key Laboratory of Chemical Resources Engineering, Beijing University of Chemical
Technology, Beijing, People's Republic of China
Tel: +86 10 64437507.
Graphical abstract
Highlights
•
Discover a novel alcohol dehydrogenase (named as KleADH) from Klebsiella
oxytoca by a genome mining method.
•
First alcohol dehydrogenase from proteobacterial that could convert t-butyl 6-chloro-
5S)-hydroxy-3-oxohexanoate to t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate with
high enantioselectivity by whole cells.
(
•
A systematic study of several factors influencing the whole-cell catalyst activity
such as temperature, pH, the effects of metal ions and organic solvent was performed.
•
KleADH exhibited notable activity towards several aryl ketones with high
stereoselectivity.
1

Abstract
Alcohol dehydrogenases can catalyze the inter-conversion of aldehydes and
alcohols. The t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate is a key chiral
intermediate in the synthesis of statin-type drugs such as Crestor (rosuvastatin
calcium) and Lipitor (atorvastatin). Herein, a novel alcohol dehydrogenase
(named as KleADH) discovered from Klebsiella oxytoca by a genome mining
method was cloned and characterized. The KleADH was functionally
overexpressed in Escherichia coli Rosetta (DE3) and the whole cell biocatalyst
was able to convert t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate to t-butyl 6-
chloro-(3R,5S)-dihydroxyhexanoate with more than 99% diastereomeric excess
(de) and 99% conversion in 24 h without adding any expensive cofactors. Several
factors influencing the whole cell catalyst activity such as temperature, pH, the
effects of metal ions and organic solvent were determined. The optimum enzyme
3
+
activity was achieved at 30 °C and pH 7.0 and it was shown that 1 mM Fe can
increase the enzyme activity by 1.2 times. N-hexane/water and n-heptane/water
biphasic systems can also increase the activity of KleADH. Substrate specificity
studies showed that KleADH also exhibited notable activity towards several aryl
ketones with high stereoselectivity. Our investigation on this novel alcohol
dehydrogenase KleADH reveals a promising biocatalyst for producing chiral
alcohols for preparation of valuable pharmaceuticals.
Keywords: Alcohol dehydrogenase, T-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate,
Klebsiella oxytoca, Whole-cell biocatalyst, rosuvastatin, atorvastatin
1. Introduction
Coronary heart disease is one of the most fateful diseases in the world. Past
epidemiological studies have confirmed that the coronary heart disease is closely
related to hypercholesterolemia[1, 2]. One widely used treatment method for
2

coronary heart disease was using statins class of drugs such as Crestor (rosuvastatin)
and Lipitor (atorvastatin), which are good inhibitors of cholesterol synthesis enzyme.
These drugs specifically inhibit the hydroxylmethylglutaryl coenzyme A (HGM-CoA)
reductase which catalyzes the reductive conversion of HMG-CoA into mevalonate, an
early and rate-limiting step in cholesterol biosynthesis[3-6]. By far, statins are still
top-selling drugs in the world. However, chemical synthesis of the chiral side chain of
statins, which is a 3,5-dihydroxyacid derivative consisting of two asymmetric centers,
needs to be performed at extreme temperature (-78 °C) and produces large amount of
toxic waste[7-9]. Therefore, producing statins in industrial scale is challenging and far
from being economical. In contrast, biocatalytic method is advantageous and several
processes have been developed for the synthesis of statin side chains[10-18]. Among
them, one of the most prominent process for producing the target chiral alcohols was
using alcohol dehydrogenase for the asymmetric reduction of the achiral ketones (Fig.
1
). One advantage of this process is that there is no loss of substrate, unlike racemic
separation using hydrolases. What is more, this biocatalytic process is more
environmentally sustainable and thus more attractive for pharmaceutical
manufacturing[7, 14, 16, 18].
Alcohol dehydrogenases exist widely in various kinds of microorganisms and
play an important role in the process of primary and secondary metabolism[19, 20]. It
could be generally divided into three categories including zinc-dependent ADHs,
short-chain ADHs and iron-activated ADHs[21]. Alcohol dehydrogenases that come
from Rhodococcus erythropolis[22], Lactobacillus brevis[23], Thermobacterium
brocki[21, 24] and Saccharomyces cerevisiae[25, 26] have already been
commercialized and widely used in the asymmetric reduction of ketones.
Generally, the exogenous addition of nicotinamide cofactors (such as NADH and
NADPH) is necessary for the alcohol dehydrogenase mediated reduction reactions[12,
2
0]. The high cost of cofactors makes efficient cofactor regeneration a prerequisite for
industrial applications[27]. One possibility to circumvent the cofactor challenge is
using the whole cells as the biocatalyst which could harbor an efficient cofactor-
regenerating system. Moreover, the cells can be removed from the reaction mixtures
by a simple centrifugation step[11, 28]. Thus, a whole-cell catalysis system for
alcohol dehydrogenases is more economical and convenient.
3

In this study, a new alcohol dehydrogenase (KleADH) was discovered from
Klebsiella oxytoca via a genome mining method. The KleADH gene was cloned and
functionally overexpressed in E. coli Rosetta. The recombinant whole cells were
found to be an excellent biocatalyst for several ketone reduction reactions.
Specifically, it could be used in the enantioselective reduction of t-butyl 6-chloro-
(
5S)-hydroxy-3-oxohexanoate to t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate with
more than 99% diastereomeric excess and 99% conversion. Taken together, our
findings provide another efficient process for preparation of statin side chains.
2. Material and methods
2
.1 Materials
K. oxytoca was purchased from China General Microbiological Culture
Collection Center (CGMCC). T-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate were
purchased from Changzhou pharmaceutical factory (China). E. coli DH5α and Rosetta
(DE3) cells (TransGen Biotech, China) were used for cloning and expression,
respectively. Restriction enzymes (EcoRI and XhoI), rTaq DNA polymerase and T
DNA ligase were purchased from Takara. The expression vector pET-28(+) was
purchased from Invitrogen. The gel extraction kit was purchased from Qiagen
4
(Germany). The plasmid extraction kit and genomic DNA purification kit were from
Tiangen (China). Primers were synthesized by Sangon Biotech (Beijing, China).
Kanamycin was added to the medium at a final concentration of 50 μg/mL for
recombinant plasmids selection. DNA dideoxy sequencing by Ruibio Biotech (China)
confirmed the identity of all plasmids. Other general chemicals were purchased from
Sigma-Aldrich. All the chemicals used in the present study were in analytical grade
and obtained from commercial sources.
2
.2 Generation of expression constructs for KleADH
To identify a potential alcohol dehydrogenase that could be used for preparation
of statin side chains, a genome mining method was applied. A Blast (Basic Local
Alignment Search Tool) using the alcohol dehydrogenase from S. cerevisiae (GenBank
accession: NP_010159) as a template was performed in NCBI (National Center for
Biotechnology Information). A hypothetical protein (GenBank accession:
4

WP_064378515.1) was found from K. oxytoca. This gene encoding KleADH was
then amplified by polymerase chain reaction (PCR) from genomic DNA of K.
oxytoca. The forward primer KleADH-FP and reverse primer KleADH-RP (Table. 1)
were utilized for PCR reactions (the EcoRI and XhoI restriction site are introduced,
respectively). PCR fragments were purified by Gel Extraction Kit. Purified PCR
products and pET-28a (+) were then digested with restriction endonucleases EcoRI
and XhoI and ligated with T DNA ligase to yield an expression plasmid containing
4
KleADH gene (pET28-KleADH). After transforming into E. coli DH5α cells,
plasmids were prepared from individual transformants and confirmed by DNA
sequencing. All of the alanine scanning mutants of KleADH: Asp44Ala, Tyr49Ala,
Lys74Ala and His107Ala were created by QuickChange PCR method with the
template pET28-KleADH[29]. All the primers were listed in Table. 1.
2
.3 Expression of KleADH in E. coli
E. coli Rosetta (DE3) cells were retransformed with the expression construct and
cultured in 5 mL lysogeny broth (LB) medium containing kanamycin (50 µg/mL) and
chloramphenicol (34 µg/mL) at 37 °C with shaking. 5 mL of the overnight culture of
E. coli Rosetta (DE3) cells was then inoculated into 50 mL fresh LB medium
supplemented with the same antibiotics and cultivated at 37 °C on a rotary shaker
(220 rpm). When OD600 value of the culture reached 0.8–1.0, isopropyl-β-D-
dthiogalactopyranoside (IPTG, final concentration of 0.1 mM) was added to induce
the expression. The cultures were cultivated at 30 °C for a further 15 h and then
harvested by centrifugation (6000 rpm for 10 min at 4 °C). The expression of target
protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE).
2
.4 Structure analysis
Homology model of KleADH was constructed with the structure of the reductase
from Yersinia pestis (PDB: 4MHB_A, 90% identities, 100% confidence). The 2D
structure of t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate and NADH were created
using ChemDraw, minimized and saved as a pdb file. The docking experiments were
5

performed using Discovery Studio 2.5. Generally, 3D structures of the chiral ligands
were generated by the Build Fragment Tool through energy minimization which is
optimized by the Prepare Ligands Protocol in DS 2.5, and by adding force field for
docking. Model of KleADH were further prepared by the Clean Protein Tool to
remove H O molecular and other ions on the surface of protein, then a force field was
2
also added to prepare the receptor. The substrate cavity was selected as the binding
site by the Define Sphere Form Selection Tool. The NADPH was then docked into the
active sites of KleADH using the Dock Ligand Protocol. The docking poses selected
from this analysis were scored with Libdock score, where a higher score indicates
stronger ligand binding affinity to the receptor. The best docking result was got by
Analyze Ligand Poses Tool. Then the 6-chloro-(5S)-hydroxy-3-oxohexanoate
structure was docked into the active sites after NADPH, all the methods are the same
as above.
2
.5 Optimization of reaction conditions
Optimum reaction time was determined as following. In a typical assay, 400
mg/mL wet cells were incubated with 5 mg/mL t-butyl 6-chloro-(5S)-hydroxy-3-
oxohexanoate in 1 mL triethanolamine buffer (100 mM, pH 7.0). The reactions were
carried out at 30 °C at 220 rpm for different time. Then reaction mixtures were
extracted with 1 mL ethyl acetate, and analyzed by chiral GC.
To test the optimal concentration of wet recombinant cells used in the reaction,
different amount of wet cells were suspended in 1 mL triethanolamine buffer
containing 5 mg/mL substrates, other reaction conditions as above except the
incubation time was 24 h. After reaction, the mixtures were extracted and analyzed by
chiral GC.
The effect of temperature on the asymmetric catalysis was determined at various
temperatures ranging from 15 °C to 50 °C. The following condition was used: 250
mg/mL wet cells and 5 mg/mL t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate in 1 mL
triethanolamine buffer (100 mM, pH 7.0) were shaken at different temperature (220
rpm, 24 h). The effect of pH on the enzymatic activity was investigated at various pH
6

values ranging from 5.0 to 10.0 with a universal buffer (50 mM Tris, 50 mM boric
acid, 33 mM citric acid and 50 mM Na PO , pH was adjusted by NaOH or HCl). All
2
4
the reaction mixtures were extracted and analyzed by GC and the highest activity was
set as 100%.
The effect of substrate concentration on the activity of KleADH was examined at
different t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate concentrations from 3 to 21
mM, under the optimized pH value and temperature. Other conditions are similar as
2
+
2+
3+
2+
2+
2+
+
2+
+
above. The effects of metal ions (Ca , Cu , Fe , Fe , Zn , Mn , K , Ni , Li ,
2
+
2+
2+
+
Sn , Mg , Co and Na ) on activity were studied at a final concentration of 0.1 mM,
.5 mM and 1 mM under otherwise similar conditions. Last, the effects of organic
0
solvent/water (v/v=1/2) biphasic systems were investigated. 8 different kinds of
organic solvents including dichloromethane, toluene, methyl tert-butyl ether (MTBE),
aether, ethyl acetate, isopropyl ether, n-hexane, n-hepane were tested as organic
phases.
Generally, one Unit (1 U) of enzyme activity was defined as the amount of wet
cells required to reduce 1 µmol t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate or
produce 1 µmol t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate per minute at 30 °C, pH
7
.0.
2
.6 Analytical methods
The optical purity (de value) of the product was determined by a SHIMADZU
GC2014C Series gas chromatography (GC) equipped with a chiral G-TA column
length 10 m, Advanced Separation Technologies Co. Ltd.). The nitrogen flow-rate
was 5 ml/min. A temperature of 110 °C was held for 1 min, followed by a gradient of
.5 °C/min to 119 °C and a hold of 119 °C for 2 min, then up to 125 °C by a gradient
(
0
of 2 °C/min. Temperature of the injection chamber and detector was set to 200 °C.
The retention times were 16.056 min for (3R,5S) isomer, and 17.458 min for (3S,5S)
isomer, respectively.
2
.7 Substrate specificity
7

First, two different cofactors NADH and NADPH were tested using whole cells
biocatalysts to see which one could improve the activity of KleADH. Reactions were
conducted in 1 mL of triethanolamine buffer (100 mM, pH7.0) containing 10 mM
substrates, 10 mM cofactors, and 400 mg/mL recombinant wet cells at 30 °C with
vigorous shaking for 24 h. Then, a wide range of potential substrates were
investigated to explore the substrate specificity of KleADH. The substrates used in
this study were listed in Table. 2. Reactions were conducted in 1 mL of
triethanolamine buffer (100 mM, pH7.0) containing 10 mM substrates and 400
mg/mL recombinant wet cells at 30 °C with vigorous shaking for 24 h. Then the
aqueous phase was extracted by ethyl acetate and analyzed by chiral HPLC or GC[30,
3
1].
3. Results and discussion
3
.1 Identification of KleADH from K. oxytoca.
Currently, although several biocatalytic processes for the preparation of statin
side chains have been reported, only the α-keto reductase from S. cerevisiae is
promising for industrial application[12]. Past research has showed that this novel
NADPH-dependent α-keto reductase has strong activity on reducing t-butyl-6-cyano-
(
5R)-hydroxy-3-carboxylhexanoat with high enantiomeric excess (ee) and
diastereomeric excess (de) values[12, 32, 33]. We initiated our study with a Blast
search using the α-keto reductase from S. cerevisiae as a query. The position-specific
iterated model was applied and the organism was limited to K. oxytoca. By this
setting, a hypothetical reductase (KleADH, GenBank accession: WP_064378515.1)
with very low identities (32%) was found from K. oxytoca. It should be noted that S.
cerevisiae is an eukaryota while K. oxytoca belongs to prokaryote which makes this
genome mining strategy risky. However, this new reductase might be a novel family
of α-keto reductase and suitable to handle in E. coli for industrial application. Further
bioinformatics studies showed that KleADH is more like a 2,5-diketo-D-gluconic acid
reductase, which belongs to the short chain ADHs family. This family of enzyme
could catalyze stereospecific reduction of 2,5-diketo-D-gluconate (2,5-DKG) to 2-
8

keto-L-gulonate. Considering the similarity between 2,5-diketo-D-gluconate and t-
butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate, this enzyme could be potential
biocatalyst for the preparation of statin side chains.
3
.2 Heterelogous expression of KleADH in E. coli.
The KleADH gene of K. oxytoca was amplified by PCR reactions and inserted
into the IPTG inducible expression vector pET-28a (+). The vector could provide
recombinant proteins with both a N terminal and a C terminal His -tag. After the cells
6
containing the KleADH expression plasmids were induced overnight with the addition
of IPTG, all cells were harvested by centrifugation and resuspended in 40 mL binding
buffer (50 mM/L NaH
2
PO , 300 mM/L NaCl, and 10 mM/L imidazole; pHꢀ8.0) and
4
sonicated. Cell lysates were clarified by ultracentrifugation and both the supernatants
and pellets were analyzed by SDS-PAGE to monitor the expression of target protein.
SDS-PAGE analysis showed that this potential alcohol dehydrogenase was
successfully expressed in E. coli Rosetta with a high expression level. Even though
parts of proteins are in the insoluble pellets, the majority of the expressed protein
could be detected in the supernatant as a soluble form. The recombinant KleADH
showed a single band of approximately 30 kDa on the SDS-PAGE gel which is
corresponding to the predicted molecular mass of 32 kDa (Fig. 2).
A one-step purification procedure for the recombinant KleADH was then
employed by using immobilized Ni-NTA affinity chromatography to purify the
KleADH. SDS-PAGE analysis indicated that the purified enzyme was more than 95%
pure after elution from the affinity column, however, most of the proteins directly
precipitated after that and completely lost their bioactivity. To solve this problem,
different factors like buffer, pH and different fusion tags were investigated, but none
of them worked (data not shown). It seems that this alcohol dehydrogenase is very
sensitive outside the cells, and thus, the whole cells as the biocatalyst were selected
for future studies. The activity of KleADH was measured by chiral GC using t-butyl
6
-chloro-(5S)-hydroxy-3-oxohexanoate as the first attempt. Surprisingly, whole cells
of E. coli harboring KleADH showed a very high activity towards t-butyl 6-chloro-
9

(
5S)-hydroxy-3-oxohexanoate. As shown in Fig. 3, the other isomeride t-butyl 6-
chloro-(3S,5S)-dihydroxyhexanoate was not detected, showed that the diastereomeric
excess was more than 99%.
3
.3 Homology modeling and catalytic residues of KleADH
KleADH belongs to the aldo-keto reductase (AKR) family[34]. This family of
proteins consists of a group of diverse NAD(P)H-dependent oxidoreductases that
catalyze the reduction of a wide range of substrates, such as steroids, ketones and
aldehydes[34]. Generally, most of the AKR family has a common (α/β) -barrel fold
8
with 300 amino acids in length and a similar catalytic tetrad composed of a tyrosine, a
lysine, an aspartic acid and a histidine[35]. Despite these similarities, members of the
AKR family often exhibit little sequence similarity. However, bioinformatic studies
showed that KleADH has high levels of identity to a putative reductase from Y. pestis
(PDB: 4MHB_A, 90% identities). The structure of this reductase was release at 2013,
but none of its biochemical characterization, catalytic mechanism or any experimental
data have been published. Sequence alignments showed that amino acids known to be
involved in the activity of the aldo-keto reductase were generally conserved in both
reductases. Hence, a Phyre2 ( Protein Homology/analogY Recognition Engine V 2.0)
homology model of KleADH was constructed with the structure of the reductase from
Y. pestis (PDB: 4MHB_A, 90% identities, 100% confidence). Notably, homology to
another aldo-keto reductase Thermotoga maritima (PDB: 1VP5_A, 58% identities,
1
00% confidence) was also predicted with high confidence (100%). These two
modeling structures even though built on two different template are very similar to
each other.
As predicted, the conserved AKR catalytic tetrad for KleADH are Asp44, Tyr49,
Lys74, and His107 (shown in blue), permitting the transfer of a hydride ion from
NAD(P)H to the substrate. Based on the docking studies, the NADPH directly interact
with the substrate cavity formed by β1, β7, β8, α7 and α8. Compared with the known
reductase structure (PDB: 1VP5) from Thermotoga maritima where the NADPH
binds to a similar position, this docking result is quite convincing. The substrate t-
1
0

butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate, on the other hand, could only dock into
the left side of NADPH, which also directly interact with the conserved AKR catalytic
tetrad. However, detailed catalytic mechanism is still need further elucidated, the
docking studies could only give a limited speculation. To validate the catalytic tetrad,
we performed an alanine scan for those four residues. The mutants were transformed
and expressed in E. coli Rosetta (DE3) and assayed for the reductase activity using t-
butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate as the substrate again. As we expected,
the reductase activities of all the mutants were totally lost. These results confirmed
that Asp44, Tyr49, Lys74, and His107 are indeed involved in the catalytic tetrad.
3
.4 Effect of incubation time and wet cell weight in aqueous system
Since KleADH could be a very promising catalyst for industrial application, we
tried to further optimize the reaction condition for this biotransformation process. A
time course study was first performed using 5 mg/mL substrates and 400 mg/mL wet
cells. As shown in Fig. 5A, within the first 14 h, enzyme activity of KleADH was
quickly increased to the highest level. Compared to the reaction for 24 h, the
difference of the conversion rate is slight. Thus, the optimal incubation time was
determined as 14 h. We then turned to invest the effect of wet cell weight on the
biotransformation process. When 5 mg/mL of the substrate was used, the conversion
increased with the increment of wet cells (Fig. 5B). Conversion reached 98% when
4
00 mg/mL of wet cell was used.
3
.5 Effects of pH and temperature
Temperature and pH play important roles during the biotransformation process,
because of their impacts on enzyme’s activity and stability. The optimal temperature
for KleADH were measured at different temperatures ranging from 15 °C to 50 °C
using t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate as substrate. The conversion rate
gradually rose when temperature was elevated from 15 to 30 °C and significantly
dropped when temperature further went up to 35 °C. Therefore, the optimal
temperature for KleADH was determined as 30 °C (Fig. 6A).
11

The effect of pH on the activity of KleADH was examined in universal buffer
50 mM boric acid, 50 mM Tris, 50 mM Na HPO and 33 mM citric acid) with pH
varied from 5.0-10.0. The effect of pH on KleADH was significant. As shown in Fig.
B, KleADH exhibited over 90% of its maximum activity in the pH 7.0 to 9.0. Below
(
2
4
6
or above these range, the activity significantly dropped until it lost all the activity.
Thus, the pH 7.0 was used as the optimal pH for the biotransformation process.
3
.6 Effects of metal ions and organic solvents
The effects of metal ions were studied at a final concentration of 0.1 mM, 0.5
mM and 1 mM. The reaction was carried out under the standard conditions, and the
activity of the KleADH without the addition of metal ions was measured as a control
3
+
2+
group and set to 100%. Reaction mixtures containing 1 mM Fe or Fe displayed
2
+
1
20% and 110% activity respectively, while Cu had a significant inhibitory effect on
2
+
2+
+
enzyme activity, Zn , Ca and Li slightly decreased enzyme activity, and others
slightly promoted the activity (Fig. 7A). When we used lower concentration of metal
2
+
ions, the effects were similar. However, the inhibitory effect of Cu dropped. Based
on these result, KleADH is a metal ion independent enzyme and it indeed belongs to
the short chain ADHs family.
As the enzymatic reactions are usually carried out in aqueous system, the use of
organic solvents as co-solvent has been proved to be useful for expanding the
applicability of biocatalytic process for poor soluble substrate[36]. As shown in Fig.8,
dichloromethane, toluene, aether and ethyl acetate could greatly inhibit KleADH
activity at the concentration of 1/2 (v/v). Enzyme activity were partially reduced or
completely lost as the logP value varies between 0.785-2.720 when ethyl acetate and
toluene were used as co-solvent. On the other hand, in the relatively hydrophobic
alkane solvent n-hexane and n-heptane, the enzyme activity had a great improvement
up to 125% and 135% respectively.
3
.7 Substrate spectra
Two different cofactors were tested for KleADH. Results showed that both could
improve the bioactivity of KleADH indicating KleADH could use both cofactors. The
1
2

substrate spectrum of KleADH toward several types of ketones was examined using
the whole cells biocatalyst, as shown in Table 2. The enantiomeric excess of products
and conversion were determined by chiral GC or HPLC analysis. 6-chloro-(5S)-
hydroxy-3-oxohexanoate was chosen as the standard substrate, and the specific
activity of KleADH toward this substrate was set as 100%. Considering the
importance of aromatic chiral alcohols as useful blocks in pharmaceutical
applications, we also tested a series of acetophenone derivatives as substrates. As
shown in Table 2, KleADH well accepted acetophenone with substitutions at various
position on the aromatic ring with an activity range of 6.70% to 56.92% and high
stereoselectivity. Details are shown in Table 2. In summary, KleADH had a broad
substrate specificity, including aromatic ketones and alkane ketones, and could be a
very promising biocatalyst for further industrial application.
4. Conclusion
Enzymes are able to perform chemical reactions under mild conditions with
remarkable regio- and stereoselectivity[37]. Because of this feature, the number of
biocatalysts (including isolated enzymes and whole cells biocatalyst) used in organic
synthesis has rapidly increased during the last decades, especially for the production
of chiral compounds[38]. One of the most valued biotechnological process is the
production of chiral alcohols by reducing prochiral ketones using alcohol
dehydrogenases. For alcohol dehydrogenases, the use of whole cells as biocatalyst is
often preferred because these reactions are dependent on effective method for
regeneration of the consumed cofactors. In this study, we discovered a novel alcohol
dehydrogenase from K. oxytoca by a genome mining method. Even though we used a
query from eukaryote, we could still find the target enzyme from the prokaryote
source by this genome mining method. These two alcohol dehydrogenases showed
very low sequence similarity but had similar catalytic activities. This example proved
that the genome mining strategy is the most powerful strategy in looking for new
biocatalysts again.
The dehydrogenase KleADH was cloned and functionally expressed in E. coli
Rosetta. Soluble protein could be detected in the supernatant as an active form.
KleADH showed a high activity and stereoselectivity to 6-chloro-(5S)-hydroxy-3-
oxohexanoate and had different activity to other diverse aromatic ketones. The whole-
cell reaction avoided exogenous addition of nicotinamide cofactors and thus is
suitable for further application. The conversion and the enantiomeric selectivity can
1
3

reach more than 99% under the conditions of pH 7.0 and 30 °C. Additionally, our
investigations showed that appropriate metal ions and appropriate organic solvents
could enhance the activity of KleADH. Although KleADH is very sensitive out of
cells, the recombinant E. coli whole-cell with high catalytic activity is very promising
for the synthesis of various kinds of chiral alcohols, which were important
intermediates for many pharmaceuticals. Specifically, this study laid the foundation
for the production of optically pure t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate
which is a key chiral intermediate in the synthesis of statin-type drugs.
References
[1] M.A. Austin, C.M. Hutter, R.L. Zimmern, S.E. Humphries, Familial
hypercholesterolemia and coronary heart disease: a HuGE association review,
American Journal of Epidemiology 160(5) (2004) 421-9.
[
2] W.P. Castelli, Epidemiology of coronary heart disease: the Framingham study, The
American Journal of Medicine 76(2A) (1984) 4-12.
3] S. Xingyuan, S. Hanbing, B. Hongxia, O. Zhimin, Bioconversion process for
[
synthesis of tert-butyl (3R,5S)-6-chloro-3,5-dihydroxyhexanoate using liquid-core
immobilized Saccharomyces cerevisiae CGMCC No 2233, Korean Journal of
Chemical Engineering 30(1) (2013) 166-171.
[
4] Y. Wu, F.-J. Xiong, F.-E. Chen, Stereoselective synthesis of 3-hydroxy-3-
methylglutaryl–coenzyme A reductase inhibitors, Tetrahedron 71(45) (2015) 8487-
510.
5] Y. Huang, N. Liu, X. Wu, Y. Chen, Dehydrogenases Reductases for the Synthesis
of Chiral Pharmaceutical Intermediates, Current Organic Chemistry 14 (2010) 1447-
460.
6] E.S. Istvan, J. Deisenhofer, Structural mechanism for statin inhibition of HMG-
CoA reductase, Science 292(5519) (2001) 1160-4.
7] A. Liljeblad, A. Kallinen, L.T. Kanerva, Biocatalysis in the Preparation of the
Statin Side Chain, Current Organic Synthesis 6(4) (2009) 362-379.
8] W. Schmidt, T.M. Schulze, G. Brasse, E. Nagrodzka, M. Maczka, J. Zettel, P.G.
8
[
1
[
[
[
Jones, J. Grunenberg, M. Hilker, U. Trauer-Kizilelma, U. Braun, S. Schulz, Sigillin A,
a unique polychlorinated arthropod deterrent from the snow flea Ceratophysella
sigillata, Angewandte Chemie-International Edition 54(26) (2015) 7698-702.
[9] M. Wolberg, W. Hummel, C. Wandrey, M. Muller, Highly Regio- and
Enantioselective Reduction of 3,5-Dioxocarboxylates Angewandte Chemie-
International Edition 112(4476-4478) (2000).
[10] M. Amidjojo, E. Franco-Lara, A. Nowak, H. Link, D. Weuster-Botz, Asymmetric
synthesis of tert-butyl (3R, 5S) 6-chloro-dihydroxyhexanoate with Lactobacillus kefir,
Applied Microbiology and Biotechnology 69(1) (2005) 9-15.
1
4

[
11] Y. Chen, C. Chen, X. Wu, Dicarbonyl reduction by single enzyme for the
preparation of chiral diols, Chemical Society Reviews. 41(5) (2012) 1742-53.
12] X. Wu, X. Gou, Y. Chen, Enzymatic preparation of t-butyl-6-cyano-(3R, 5R)-
[
dihydroxyhexanoate by a whole-cell biocatalyst co-expressing carbonyl reductase and
glucose dehydrogenase, Process Biochemistry 50(1) (2015) 104-110.
[13] L. Álvarez, F. Acevedo, A. Illanes, Induction of NAD+ dependent alcohol
dehydrogenases with activity towards long chain aliphatic alcohols in mesophilic,
thermophilic and extreme thermophilic microorganisms, Process Biochemistry 46(6)
(2011) 1342-1349.
[14] Y. Yasohara, N. Kizaki, J. Hasegawa, M. Wada, M. Kataoka, S. Shimizu,
Stereoselective reduction of alkyl 3-oxobutanoate by carbonyl reductase from
Candida magnoliae, Tetrahedron: Asymmetry 12(12) (2001) 1713-1718.
[15] G. DeSantis, K. Wong, B. Farwell, K. Chatman, Z. Zhu, G. Tomlinson, H.
Huang, X. Tan, L. Bibbs, P. Chen, K. Kretz, M.J. Burk, Creation of a productive,
highly enantioselective nitrilase through gene site saturation mutagenesis (GSSM),
Journal of the American Chemical Society 125(38) (2003) 11476-7.
[16] X. Wu, N. Liu, Y. He, Y. Chen, Cloning, expression, and characterization of a
novel diketoreductase from Acinetobacter baylyi, Acta Biochimica et Biophysica
Sinica 41(2) (2009) 163-70.
[17] W.A. Greenberg, A. Varvak, S.R. Hanson, K. Wong, H. Huang, P. Chen, M.J.
Burk, Development of an efficient, scalable, aldolase-catalyzed process for
enantioselective synthesis of statin intermediates, Proceedings of the National
Academy of Sciences of the United States of America 101(16) (2004) 5788-93.
[18] X. Wu, L. Wang, S. Wang, Y. Chen, Stereoselective introduction of two chiral
centers by a single diketoreductase: an efficient biocatalytic route for the synthesis of
statin side chains, Amino Acids 39(1) (2010) 305-8.
[
(
19] S. Goldberg, Z. Guo, S. Chen, A. Goswami, R.N. Patel, Synthesis of ethyl-
3R,5S)-dihydroxy-6-benzyloxyhexanoates via diastereo- and enantioselective
microbial reduction: Cloning and expression of ketoreductase III from Acinetobacter
sp. SC 13874, Enzyme and Microbial Technology 43(7) (2008) 544-549.
[20] W. Kroutil, H. Mang, K. Edegger, K. Faber, Recent advances in the biocatalytic
reduction of ketones and oxidation of sec-alcohols, Current Opinion in Chemical
Biology 8(2) (2004) 120-6.
[
21] H. Radianingtyas, P.C. Wright, Alcohol dehydrogenases from thermophilic and
hyperthermophilic archaea and bacteria, FEMS Microbiology Reviews 27(5) (2003)
93-616.
22] K. Abokitse, W. Hummel, Cloning, sequence analysis, and heterologous
5
[
expression of the gene encoding a (S)-specific alcohol dehydrogenase from
Rhodococcus erythropolis DSM 43297, Applied Microbiology and Biotechnology
6
2(4) (2003) 380-6.
[23] K. Niefind, J. Müller, B. Riebel, W. Hummel, D. Schomburg, The Crystal
Structure of R-specific Alcohol Dehydrogenase from Lactobacillus brevis Suggests
the Structural Basis of its Metal Dependency, Journal of Molecular Biology 327(2)
(2003) 317-328.
1
5

[24] V.T.P.a.R.S. Phillips, Effects of Substrate Structure and Temperature on the
Stereospecificity of Secondary Alcohol Dehydrogenase from Thermoanaerobacter
ethanolicus, Journal of the American Chemical Society 112 (1990) 3629-3632.
[25] A. Matsuyama, H. Yamamoto, Y. Kobayashi, Practical Application of
Recombinant Whole-Cell Biocatalysts for the Manufacturing of Pharmaceutical
Intermediates Such as Chiral Alcohols, Organic Process Research & Development 6
(2002) 558-561.
[26] I.A. Kaluzna, T. Matsuda, A.K. Sewell, J.D. Stewart, Systematic Investigation of
Saccharomyces cerevisiae Enzymes Catalyzing Carbonyl Reductions, Journal of the
American Chemical Society 126 (2004) 12827-12832.
[
27] Y. Ni, J.-H. Xu, Biocatalytic ketone reduction: A green and efficient access to
enantiopure alcohols, Biotechnology Advances 30(6) (2012) 1279-1288.
28] A. Hibino, H. Ohtake, Use of hydrophobic bacterium Rhodococcus rhodochrous
[
NBRC15564 expressed thermophilic alcohol dehydrogenases as whole-cell catalyst in
solvent-free organic media, Process Biochemistry. 48(5-6) (2013) 838-843.
[29] H.H. Hogrefe, J. Cline, G.L. Youngblood, R.M. Allen, Creating randomized
amino acid libraries with the QuikChange Multi Site-Directed Mutagenesis Kit,
BioTechniques 33(5) (2002) 1158-60, 1162, 1164-5.
[30] X. Ye, X. Lei, Z. Chen, L. Zhang, A. Zhang, In Situ Measurement of the
Enantiomeric Excess of Alcohols and Amines under Asymmetric Reduction Reaction
by 1H NMR, Organic Letters 12(12) (2010) 3238-3241.
[31] M.L. Contente, F. Molinari, P. Zambelli, V. De Vitis, R. Gandolfi, A. Pinto, D.
Romano, Biotransformation of aromatic ketones and ketoesters with the non-
conventional yeast Pichia glucozyma, Tetrahedron Lett. 55(51) (2014) 7051-7053.
[32] K. Ishihara, H. Yamamoto, K. Mitsuhashi, K. Nishikawa, S. Tsuboi, H. Tsuji, N.
Nakajima, Purification and characterization of alpha-keto amide reductase from
Saccharomyces cerevisiae, Bioscience, Biotechnology, and Biochemistry 68(11)
(2004) 2306-12.
[33] Q. Chang, T.A. Griest, T.M. Harter, J. Mark Petrash, Functional studies of aldo-
keto reductases in Saccharomyces cerevisiae, Biochimica et Biophysica Acta (BBA) -
Molecular Cell Research 1773(3) (2007) 321-329.
[
(
[
34] E.M. Ellis, Microbial aldo-keto reductases, FEMS Microbiology Letters 216(2)
2002) 123-131.
35] S. Jeudy, V. Monchois, C. Maza, J.-M. Claverie, C. Abergel, Crystal structure of
Escherichia coli DkgA, a broad-specificity aldo-keto reductase, Proteins: Structure,
Function, and Bioinformatics 62(1) (2006) 302-307.
[36] Q. Xu, X. Xu, H. Huang, S. Li, Efficient synthesis of (R)-2-chloro-1-phenylethol
using a yeast carbonyl reductase with broad substrate spectrum and 2-propanol as
cosubstrate, Biochemical Engineering Journal 103 (2015) 277-285.
[
37] J.B.v. Beilen, Z. Li, Enzyme technology: an overview, Current Opinion in
Biotechnology 13(4) (2002) 338-344.
38] J. Tao, J.-H. Xu, Biocatalysis in development of green pharmaceutical processes,
Current Opinion in Chemical Biology 13(1) (2009) 43-50.
[
1
6

Figure legends
Fig. 1 Enzymatic preparation of t-butyl 6-chloro-(3R,5S)-dihydroxyhexanoate by
alcohol dehydrogenase for statins class of drugs.
Fig. 2 SDS-PAGE (12%) of KleADH expressed by E. coli Rosetta (DE3). Lane M,
the marker proteins with the relative molecular masses; Lane 1, crude protein extract
of E. coli Rosetta/pET28-KleADH before induction; Lane 2, crude protein extract of
E. coli Rosetta/pET28-KleADH after induction; Lane 3, insoluble fraction of crude
extract of induced recombinant E. coli Rosetta/pET28-KleADH; Lane 4, soluble
fraction of crude extract of induced recombinant E. coli Rosetta/pET28-KleADH.
Fig. 3 Chiral-GC analysis of the biocatalytic reaction catalyzed by KleADH. A,
Chiral-GC analysis the substrate t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate, the
retention time is 11.5 min；B, Chiral-GC analysis the product t-butyl 6-chloro-
(3R,5S)-dihydroxyhexanoate, the retention time is 16 min；
Fig. 4 Homology modelled three-dimensional structure of KleADH. Homology
modelling of the KleADH structure was performed using a putative reductase from
Yersinia pestis as a template. The conserved AKR catalytic tetrad was showed in
marine blue. The substrate（t-butyl 6-chloro-(5S)-hydroxy-3-oxohexanoate, green
stick）and NAPH (grey stick) were docking into the substrate cavity.
Fig. 5 A. Characterizations of the KleADH. The effect of reaction time on the
biocatalytic reaction. 400 mg/mL wet cells were incubated with 5 mg/mL t-butyl 6-
chloro-(5S)-hydroxy-3-oxohexanoate in 1 mL triethanolamine buffer (100 mM, pH
1
7

7
.0). KleADH activity was monitored at 30 °C at 220 rpm for different time; B. The
effect of wet cell weight on the biocatalytic reaction. Different amount of wet cells
were used in 1mL triethanolamine buffer containing 5 mg/mL substrates for 24 h and
KleADH activity was monitored. All measurements wereperformed in triplicate.
Fig. 6 Characterizations of the KleADH. A. The effect of temperature on the
biocatalytic reaction. The activity of the KleADH was measured at temperatures
ranging from 15 °C to 50 °C; B. The effect of pH on the biocatalytic reaction. The
activity of the KleADH was measured at pHs ranging from 5.0 to 10.0 at the optimal
temperatures. All measurements wereperformed in triplicate.
Fig. 7 Characterizations of the KleADH. A. The effect of metal ions on the activity of
the KleADH, Chlorates were used as the target metal ion donators. The KleADH
activity was monitored at 30 °C for 14 h in 1 mL triethanolamine buffer (100 mM, pH
7
.0) with 5 mg/mL substrate and 1 mM metal ions; B. The effect of organic solvents
on the activity of the KleADH. KleADH activity was monitored at 30 °C for 14 h
with with each organic solvent/water (v/v=1/2) biphasic systems. All measurements
wereperformed in triplicate.
1
8

Fig. 1
1
9

Fig. 2
2
0

Fig. 3
2
1

Fig. 4
2
2

Fig. 5
2
3

Fig. 6
2
4

Fig. 7
2
5

Table. 1 Primers used in this study
Name
DNA sequence (5’-3’)
Description
KleADH-FP
KleADH-RP
Asp44Ala-FP
CCGGAATTCATGCAAACTGTAAAACTG
KleADH amplification
upstream
CCGCTCGAGAACATCAAGTTTGC
KleADH amplification
downstream
GATACGGGATACCGCCTGATCGCGACCGCAGCGT
CATTCTGGTAAGACGCTGCGGTCGCGATCAGGCG
Asp44Ala mutation
upstream
Asp44Ala-RP
Tyr49Ala-FP
Asp44Ala mutation
downstream
CGCCTGATCGATACCGCAGCGTCTGCGCAGAATG
ATTCCCGACCTGGGTTTCATTCTGCGCAGACGCTGC
Tyr49Ala mutation
upstream
Tyr49Ala-RP
Lys74Ala-FP
Tyr49Ala mutation
downstream
GTAACGAGTTCTTTGTAACGACCGCGCTGTGGCT
AATTCGTATCCTGCAGCCACAGCGCGGTCGTTAC
ATTACGTTGACCTTTATCTGATTGCGCAACCTTAC
CCATGGACATCGCCGTAAGGTTGCGCAATCAGAT
Lys74Ala mutation
upstream
Lys74Ala-RP
His107Ala-FP
Lys74Ala mutation
downstream
His107Ala mutation
upstream
His107Ala-RP
His107Ala mutation
downstream
2
6

Table. 2. Substrate specificity of KleADH
NO.
substrate
product
relative activity e.e or d.e
OH
Cl
O
O
OH OH O
1
2
2
6
5
5
00%
＞99.5%
＞99.5%
78.07%
＞99.5%
＞99.5%
＞99.5%
n．d．
Cl
O
O
1
O
OH
4.23%
5.49%
.70%
.12%
6.92%
2
3
4
5
6
7
8
O
OH
F3C
F3C
CF3
CF3
O
O
OH
Cl
Br
Cl
OH
Br
O
OH
F
F
O
O
OH
O
OH
O
OH
n．d．
n．d．
F
F
F
F
O
O
OH
O
O
O
N
O
N
n．d．
2
7