Synthesis and biological evaluation of rhein amides as inhibitors of osteoclast differentiation and bone resorption

Article abstract of DOI:10.1016/j.ejmech.2016.08.004

Approaches of targeting excessive activation and differentiation of osteoclasts were considered as an effective treatment option for osteoporosis or osteopenia. In the present work, a series of rhein derivatives were synthesized and employed for their cytotoxicity screening against bone marrow-derived macrophages cells (BMMs) and their inhibition effects on osteoclasts activation and differentiation in?vitro using an MTT assay and a TRAP activity assay respectively. Two rhein derivatives d6 and d11 inhibited BMMs activation and differentiation with 98% and 85% inhibitory activity respectively, without showing any cytotoxicity on BMMs. Subsequently, the most potent compound d6 was further validated for its inhibitory effects on the formation of TRAP-positive multinucleated cells and bone resorption as evaluated by TRAP staining and bone resorption assay. The regulation by d6 of osteoclast marker genes assay revealed that treatment of BMMs with M-CSF and RANKL resulted in the stimulation of mRNA expressions of NFATc1, c-fos, TRAP, MMP-9 and cathepsin K which were highly related with osteoclast activation and differentiation, while d6 decreased mRNA expressions of these genes. It was indicated that d6 might regulate osteoclasts activity through RANKL/RANK/NFATc1 pathway. Thus our current work is expected to provide a highly promising approach for the development of a new type of anti-osteoporosis agent.

Full text of DOI:10.1016/j.ejmech.2016.08.004

Accepted Manuscript
Synthesis and biological evaluation of rhein amides as inhibitors of osteoclast
differentiation and bone resorption
Xing Xu, Xueyu Qi, Yufei Yan, Jin Qi, Niandong Qian, Lei Guo, Changwei Li, Fei
Wang, Ping Huang, Hanbing Zhou, Min Jiang, Chunhao Yang, Lianfu Deng
PII:
S0223-5234(16)30647-X
10.1016/j.ejmech.2016.08.004
EJMECH 8800
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 18 June 2016
Revised Date: 2 August 2016
Accepted Date: 4 August 2016
Please cite this article as: X. Xu, X. Qi, Y. Yan, J. Qi, N. Qian, L. Guo, C. Li, F. Wang, P. Huang, H.
Zhou, M. Jiang, C. Yang, L. Deng, Synthesis and biological evaluation of rhein amides as inhibitors of
osteoclast differentiation and bone resorption, European Journal of Medicinal Chemistry (2016), doi:
10.1016/j.ejmech.2016.08.004.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT
Synthesis and biological evaluation of rhein amides as inhibitors of osteoclast
differentiation and bone resorption
Xing Xu,a‡ Xueyu Qi,b‡ Yufei Yan,a Jin Qi,a Niandong Qian,a Lei Guo,a Changwei
Li,a Fei Wang,a Ping Huang,a Hanbing Zhou,a Min Jiang, a* Chunhao Yang b* and
Lianfu Deng a
a
Shanghai Key Laboratory for Bone and Joint Diseases, Shanghai Institute of Traumatology
and Orthopaedics, Shanghai Ruijin Hospital, Shanghai Jiaotong University School of Medicine,
Shanghai, 20025, China
b
State Key Laboratory of Drug Research, Department of Medicinal Chemistry, Shanghai
Institute of Materia Medica, Chinese Academy of Sciences, 555 Zu Chong Zhi Road, Shanghai
201203, China; University of Chinese Academy of SciencesꢀNo.19A Yuquan Road, Beijing
100049, China
‡ These authors contributed equally to this work.
Abstract:
Approaches of targeting excessive activation and differentiation of osteoclasts were
considered as an effective treatment option for osteoporosis or osteopenia. In the
present work, a series of rhein derivatives were synthesized and employed for their
cytotoxicity screening against bone marrow-derived macrophages cells (BMMs) and
their inhibition effects on osteoclasts activation and differentiation in vitro using an
MTT assay and a TRAP activity assay respectively. Two rhein derivatives d6 and d11
inhibited BMMs activation and differentiation with 98% and 85% inhibitory activity
respectively, without showing any cytotoxicity on BMMs. Subsequently, the most
potent compound d6 was further validated for its inhibitory effects on the formation
of TRAP-positive multinucleated cells and bone resorption as evaluated by TRAP
staining and bone resorption assay. The regulation by d6 of osteoclast marker genes
assay revealed that treatment of BMMs with M-CSF and RANKL resulted in the

ACCEPTED MANUSCRIPT
stimulation of mRNA expressions of NFATc1, c-fos, TRAP, MMP-9 and cathepsin K
which were highly related with osteoclast activation and differentiation, while d6
decreased mRNA expressions of these genes. It was indicated that d6 might regulate
osteoclasts activity through RANKL/RANK/NFATc1 pathway. Thus our current work
is expected to provide a highly promising approach for the development of a new type
of anti-osteoporosis agent.
Key words:
Osteoclast, rhein derivatives, bone resorption, inhibitor, RANKL/RANK/NFATc1
pathway
1. Introduction
Bone is a highly dynamic tissue that undergoes significant modifications. Bone
metabolism consists of a life-long remodeling process which is mediated by the
balance between bone resorption by osteoclasts and bone formation by osteoblasts [1-5]
An imbalanced bone remodeling is involved in many diseases such as osteoporosis
.
[6-7], rheumatoid arthritis [8-9], multiple myeloma [10] and Paget’s disease [11]
.
The functional role of osteoclasts generated from bone marrow-derived
macrophages cells (BMMs) is to resorb bone matrix through secreting acid and
proteases to dissolve the organic and mineral components of bone [12]. Osteoblasts
derived from mesenchymal stem cells (MSCs) mediate the main part in bone
formation [13]. Osteoblasts, stromal cells and osteocytes express receptor activators of
the nuclear factor-κb (NF-κB) ligand (RANKL) and macrophage colony-stimulating

ACCEPTED MANUSCRIPT
[14-15]
factor (M-CSF) which are essential factors for the osteoclast differentiation
.
RANKL is a member of the tumor necrosis factor (TNF) family and binds to the
RANK receptor expressed in osteoclast precursor cells [12]. After the activation of
RANKL–RANK signaling transduction cascades, various downstream signaling are
triggered including nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1) /
c-fos pathway. Furthermore, genes such as tartrate-resistant acid phosphatase (TRAP),
matrix metalloprotein-9 (MMP-9) and cathepsin K are highly expressed in the mature
[16]
osteoclast
which are directly regulated by NFATc1. Currently, searching for
osteoclast activation and differentiation inhibitors via RANKL signaling has turned to
be a promising strategy for the development of antiresorptive agents.
Currently, bisphosphonates have been the most commonly used medications in
the treatment of osteoporosis and prevention of fracture in osteoporotic patients.
However, it is also reported that bisphosphonates have serious adverse effects such as
osteonecrosis of the jaw and subtrochanteric fractures which are partly attributed to its
promoting effects on osteoclasts apoptosis [17]. Another first-line therapy-ERT
(estrogen-replacement therapy) increases the risk of breast cancer, stroke, clots and
heart attack [18]. Hence, we need to develop more small molecules that regulate
osetoclast activity and differentiation to improve the treatment of bone loss.
Natural products have made a significant contribution to drug discovery, and
nearly half of the new drugs introduced into the market are natural products or their
derivatives [19]. To develop novel inhibitors on RANKL induced osteoclast formation
with more favorable pharmacological properties, we began to focus on natural

ACCEPTED MANUSCRIPT
products because they were evolved to interfere and interact with their biological
targets in vivo. Numerous natural products have been reported as potential
osteoclastgenesis inhibitors such as paeonol[20], magnolol[21], halenaquinone[22] and
emodin[23] (Fig. 1). As a privileged structure of medicinal chemistry, polyol
anthraquinones have drawn high attention because of their extensive application in the
biological areas [24, 25, 26, 27]. Particularly, emodin was reported to regulate bone
remodeling by inhibiting osteoclastogenesis and stimulating osteoblast formation both
in vitro and in vivo [23]. Moreover, diacerein inhibited the expressions of bone
resorption enzymes and reduced osteoclastic differentiation in osteoarthritic
subchondral bone [28]. Diacerein has been used for the treatment of osteoarthritis in
Egypt and the Middle East as a prodrug of rhein. In addition, the bone affinity of rhein
had been confirmed by hydroxyapatite affinity experiment and rhein hybrid
compounds had been developed as bone-targeting agents [29, 30]
(Fig 1)
.
In the present work, we developed a series of novel rhein amide derivatives (Fig.
2). All compounds were also tested for their cytotoxicity on BMMs by MTT assay.
The inhibitory activities of synthesized compounds with no cytotoxicity toward
osteoclast were evaluated by TRAP activity assay on RANKL-induced osteoclastic
activation and differentiation from BMMs. Based on this screen, we identified
1,8-dihydroxy-3-(4-morpholinopiperidine-1-carbonyl)anthracene-9,10-dione (d6) can
effectively inhibit RANKL-induced osteoclastogenesis. Furthermore, d6 was further
validated to inhibit RANKL-induced osteoclast formation and bone resorption by

ACCEPTED MANUSCRIPT
suppressing osteoclast marker genes through RANK/RANKL/NFATc1 pathway
without any cytotoxicity on MC3T3-E1 osteoblast cells and MSCs. Detailed
illustration of the synthetic procedure, biological experiments is presented as follows.
(Fig 2)
2. Chemistry
The compounds were synthesized as shown in Scheme 1. Commercially
available rhein (a) was subjected to o-acetylation with acetic anhydride.[31] The
diacerein (b) was transformed into the corresponding acid chloride using excess oxalyl
chloride, and the acid chloride was reacted with aromatic or aliphatic amine to give the
corresponding amides (c) with moderate to good yields. The compounds d were
generated by hydrolysis of amides (c).
(Scheme 1)
3. Biological results and discussion
3.1 MTT assay for cytotoxicity
In order to confirm that the anti-osteoclastogenic effects of compounds are not
attributable to cellular toxicity, twenty rhein derivatives, along with rhein and its
analogue emodin were assessed their cytotoxic effects against BMMs in vitro at a
concentration of 5 ꢀM by performing MTT assay firstly. As shown in Table 1, the
viability of untreated cells was set as 100%, the lead compound rhein and emodin
displayed neither proliferation nor cytotoxicity on BMMs. Among these derivatives,
the results showed that five compounds such as c1, c2, d1, d3, d5 dramatically
decreased the viability of BMMs, while six compounds, such as c7, d2, d4, d6, d11,

ACCEPTED MANUSCRIPT
d12, had slight or no effect on cell viability at a concentration of 5 ꢀM which
indicated these compounds had no cytotoxicity toward osteoclast precursor cells. The
effects of all derivatives on BMMs viability were summarized in Table 1.
(Table 1 )
3.2 Effects of the rhein amide derivatives on RANKL-induced osteoclastogenesis
Our study was designed to identify a new class of safe and effective small
molecules that blocked bone resorption through inhibiting the activity and
differentiation of osteoclast, not promoting its apoptosis. Therefore our subsequent
evaluation was focused on compounds c7, d2, d4, d6, d11, d12 which showed
ineffective activities on the viability of osteoclast. TRAP activity assay was conducted
to investigate the activity of TRAP in BMMs osteoclastgenesis induced by M-CSF
and RANKL. TRAP is an established marker for osteoclast and its activity is highly
related with osteoclast differentiation and bone resorption. As shown in Table 2,
compounds c7, d2 and d4 did not exhibit any inhibitory effects, whereas compounds
d6, d11 and d12 dramatically inhibited TRAP activity with 98%, 85% and 65%
inhibitory activity respectively. It was suggested that compounds d6, d11 and d12
were potent in inhibiting osteoclast activation and differentiation, which were more
effective than rhein and emodin.
(Table 2)
Compounds d6 and d11 were the most potent compounds among 20 derivatives.
In view of the relatively high activity and low cytotoxicity, we were determined to
further investigate the effects of d6 on osteoclast activation and differentiation. As

ACCEPTED MANUSCRIPT
shown in Fig 3A, compound d6 strongly inhibited TRAP activity in a dose dependent
manner especially at the concentrations of 5 ꢀM and 7.5 ꢀM. This compound showed
no cytotoxicity even at 7.5 ꢀM (Fig 3B).
(Fig 3)
Once BMMs were differentiated into mature osteoclasts, monocytes integrated
into TRAP-positive multinucleated cells induced by M-CSF and RNAKL. We thus
examined the effects of compound d6 on the formation of TRAP-positive
multinucleated cells. As shown in Fig. 3C-D, M-CSF and RANKL induced the
formation of TRAP-positive multinucleated cells, while treatment of compound d6
(5ꢀM) significantly reduced osteoclast formation. Emodin exhibited relatively low
inhibitory effects compared with compound d6, while rhein did not show any effects
on the formation of TRAP-positive osteoclast. These results indicated that compound
d6 could significantly inhibit the differentiation of osteoclast and d6 was more
effective than its lead compound rhein.
3.3 Effects of d6 on RANKL-induced bone-resorbing activity of osteoclasts
Bone resorption assay was further used to investigate the inhibitory effects of
compound d6 on osteoclast activity of bone resorption. BMMs were plated on to bone
slices and compound d6 was subjected to interfere bone resorption of mature
osteclasts induced by M-CSF and RANKL. As shown in Fig 4A, osteoclastic bone
resorption was almost completely inhibited after treatment with 5ꢀM compound d6 as
d6 treatment substantially reduced bone resorption area. The areas were also
calculated in Fig 4B. Collectively, all above-mentioned results supported that
compound d6 could negatively regulate osteolclasts formation and osteoclastic bone

ACCEPTED MANUSCRIPT
resorption activity in vitro.
(Fig 4)
3.4 Effects of d6 on osteoclastogenesis-specific marker genes during the
RANKL-induced osteoclast development
Osteoclasts activation and differentiation are associated with the up-regulation of
specific genes such as the master regulators of osteoclast NFATc1 and c-fos, as well as
bone resorption-related genes TRAP, MMP-9 and Cathepsin K responding to RANKL
stimulation. As compound d6 had been determined as an inhibitor of osteoclasts
activation and differentiation, we next assessed the inhibitory effects of compound d6
on the mRNA expressions of osteoclastogenesis-related genes to elucidate the
mechanism underlying the inhibition of compound d6 on osteoclastogenesis. In the
assay, BMMs were treated with M-CSF and/or RANKL alone or combination with
5ꢀM compound d6. As shown in Fig. 5, RANKL substantially induced the mRNA
expressions of osteogenesis-related genes including NFATc1, c-fos, TRAP, MMP-9
and Cathepsin K as evaluated by qRT-PCR. In contrast, compound d6 strongly
suppressed the expressions of all studied genes. Here, we suggested that compound d6
might regulate the RANKL induced osteoclast differentiation and bone resorption
activity in vitro through regulating the expressions of NFATc1, c-fos, TRAP, MMP-9
and Cathepsin K.
(Figure5)
4. Conclusions
In the current study, we focused on a natural product rhein aiming to develop

ACCEPTED MANUSCRIPT
novel inhibitors on osteoclasts activation and differentiation with more favorable
pharmacological properties. Therefore, a series of rhein derivatives were designed and
synthesized. Screening by MTT assay, it was found that there were four compounds
showing none cytotoxicity while other compounds showing moderate or significant
cytotoxicity against BMMs among these twenty derivatives. The identified novel
osteoclast inhibitor d6 through TRAP activity assay was determined to be highly
potent compared to the lead compound rhein. Consequently, compound d6 was
further investigated for its effects on osteoclasts activation and differentiation using
TRAP staining and bone resorption assay.
Chemokines such as M-CSF and RANKL induced osteoclast activation and
differentiation by regulating the activity of nuclear receptor NFATc1 and c-fos and
then controlled the expressions of bone resorption enzymes such as TRAP, MMP-9
and cathepsin K. Based on the current finding that d6 repressed gene expressions of
NFATc1, c-fos, TRAP, MMP-9 and cathepsin K induced by M-CSF and RANKL, we
determined that compound d6 might participate in osteoclastgenesis through
regulation of RANKL/RANK/NFATc1 pathway.
During the bone remodeling, bone continuously undergoes coupled resorption
and formation. Osteoclasts produced cytokines, chemokines and growth factors for
coupling with osteoblasts to maintain normal bone formation. Some antiresorptive
agents such as bisphosphonates may carry long-term risks, not only because of the
effects of inducing osteoclast apoptosis, but also inhibiting persistent osteoblasts
viability and cellular activity. Specifically, as shown in supplementary (S1),

ACCEPTED MANUSCRIPT
compound d6 at a concentration of 5 ꢀM showed none cytotoxicity on osteoblast cells
MC3T3-E1 and MSC survival as evaluated by MTT assay. The results above
suggested a potentially important difference between compound d6 and other
antiresorptive agents.
In summary, we designed and synthesized a series of rhein derivatives and
identified a novel compound d6 as an inhibitor of osteoclastgenesis. It effectively
inhibited the formation of TRAP-positive multinucleated cells and bone resorption
induced by RANKL. We also elucidated its mechanism on inhibiting osteoclast
function. Though SARs were not discernible in the present work, we are exploring
new rhein derivatives based on this study and SARs research is ongoing.Our current
work is expected to provide a highly promising approach for the development of a
new type of anti-osteoporosis agent.
5. Materials and methods
5.1 Chemistry
5.1.1 General information
Column chromatography was performed on silica gel (200~300 mesh). NMR
spectra were recorded on Brucker AVANCE 300 NMR spectrometer or Brucker
AVANCE III 400 NMR spectrometer or Brucker AVANCE III 500 NMR spectrometer
or Brucker AVANCE III 600 NMR spectrometer. Chemical shifts were reported in
parts per million (ppm, δ). Proton coupling patterns are described as singlet (s),
doublet (d), triplet (t), quartet (q), heptet (hept), multipet (m) and broad (br).
Low-resolution mass spectra (ESI) was obtained using Agilent HPLC-MS
(1260-6120B). UPLC spectra were recorded on WATERS ACQUITY UPLC H-Class.
5.1.2. The procedure for preparation of c1-c8

ACCEPTED MANUSCRIPT
The compound rhein (284 mg, 1 mmol) in acetic anhydride (612 mg, 6 mmol)
was added with Zn(CF3SO3)2 (2 mg, 0.005 mmol) and stirred at 130 ꢁ for 2 h. Then
the resulting yellow solution was poured into ice water, filtered and dried under
reduced pressure, and recrystallized from ethyl acetate to obtain pure
4,5-diacetoxy-9,10-dioxo-9,10-dihydroanthracene-2-carboxylic acid b. Oxalyl
chloride (3 mmol) was added to a solution of diacerein b (1 mmol) in DCM (20 mL)
dropwise with stirring and the mixture was added a catalytic amount of DMF. After 1
h, the mixture was distilled off under reduced pressure and the produced acid chloride
was collected. The acid chloride residue directly reacted with aromatic or aliphatic
amine (1.5 mmol) and N(Et)3 (2 mmol) in DCM (20 mL) and stirred at room
temperature (RT) for 3 h. The mixture was poured into water (30 mL), extracted with
DCM (20 mL×2), washed with brine (10 mL), dried over anhydrous Na2SO4, filtered
and concentrated in vacuo to give the crude product, which was further purified by
silica gel chromatography to afford the desired products c.
5.2 Biology
5.2.1 Biological materials
ɑ-Modified eagle’s medium (ɑ-MEM), fetal bovine serum (FBS), penicillin and
streptomycin (PS) were from Gibco. Dimethyl sulfoxide (DMSO), MTT, glucorticoid
dexamethasone, β-glycerophosphate, ascorbic acid and TRAP staining kit were
purchased from Sigma. M-CSF and RANKL were obtained from Peprotech. Reverse
transcript reagents and SYBR Green PCR Master Mix were from Takara. TRAP
activity assay kit and BCA protein assay kit were from Beyotime Biotechnology.
4-week-old male C57BL/6 mice were purchased from SLAC laboratory and
were maintained at 22°C-24°C and 55%–60% humidity in a room with a 12/12-h
light/dark cycle. All animal experiments were conducted according to the guidelines
of the humane use and care of laboratory animals and were approved by the Shanghai

ACCEPTED MANUSCRIPT
Jiao Tong University School of Medicine Animal Study Committee.
5.2.2 Cell culture
BMMs were isolated from 4-week-old male C57/BL6 mouse. MC3T3-E1
preosteoblast cell line was purchased from ATCC, and mouse mesenchymal stem cells
(MSCs) derived from C57BL/6 were from Cyagen Biosciences. All the cells were
cultured in ɑ-MEM containing 10% FBS, 100 U/ml penicillin and 100 µg/ml
streptomycin (full ɑ-MEM) at 37°C in a 5%-humidified CO2 incubator.
5.2.3 Primary bone marrow-derived macrophages cells isolation
BMMs isolated from a 4-week-old C57/BL6 mouse were prepared as previously
described[32]. Briefly, all the bone marrow cells in the femur and tibiae of mouse were
flushed out by ɑ-MEM and then incubated in full ɑ-MEM overnight. The cells in the
supernatant were collected and then cultured in full ɑ-MEM containing 30 ng/mL
M-CSF for proliferation. After reaching 90% confluence, cells adhering to the bottom
of the dish classified as BMMs were harvested by cell scraper. BMMs were induced
to osteoclasts by full ɑ-MEM plus M-CSF (30ng/mL) and RANKL (50ng/mL).
5.2.3 MTT assay
Effects of rhein derivatives on cell proliferation or cytotoxicity were determined
by MTT assay. BMMs were plated in 96-well plates in full medium plus 30ng/mL
M-CSF for proliferation at a density of 3×103 cells/well. The next day, cells were
treated with indicated concentrations of compounds in triplicate for two days. 10 ꢀL
MTT (5mg/mL) was then added to each well, and the plates were incubated at 37°C
for an additional 2 h. Then the supernatant were removed and 100ꢀL DMSO was

ACCEPTED MANUSCRIPT
added to each well to resolve the crystals, and the optical density (OD) was then
measured with an Infinite F200 PRO absorbance microplate reader (Tecan) at 570 nm.
Cell viability was calculated relative to the control.
5.2.4 Tartrate-Resistant Acid Phosphatase (TRAP ) Colorimetric Assay
BMMs were seeded in 96-well plates at a density of 3×103 cells/well. Cells
were exposed to in full medium plus 30ng/mL M-CSF and 50ng/mL RANKL in
combinations with indicated concentrations of compounds in triplicate for two days.
Cells were lysised and TRAP activity were measured by TRAP activity assay kit
according to the manufacturer’s instructions. Briefly, cell culture mediums were
removed and cells were washed by PBS for 3 times. Then cells were lysised by
passive lysis buffer (Promega) for 15min at 37°C and the supernatant were collected
and incubated with para-nitrophenylphosphate (p-NPP) in the presence of disodium
tartrate for 45min. The reaction was subsequently stopped with the addition of NaOH.
The TRAP activity was then quantified by measuring optical density at 405 nm with
Tecan absorbance microplate reader. The total protein levels were determined by BCA
protein assay kit and the TRAP activity was normalized to the protein levels.
5.2.5 In vitro osteoclastogenesis assay
BMMs were cultured in 96-well plates in full medium containing M-CSF and
allowed to adhere overnight. The medium was replaced and the cells were treated
with 30 ng/mL M-CSF and 50ng/mL RANKL for additional five days. The medium
was replaced for each two days. TRAP staining was then performed using a leukocyte
acid phosphatase kit (Sigma) according to the manufacturer’s instructions.

ACCEPTED MANUSCRIPT
TRAP-positive multinucleated cells (ꢂ3 nuclei) were scored as osteoclasts.
5.2.6 Bone resorption assay
For the bone resorption assay, BMMs were seeded on bovine femur bone slices
in 96-well plates and the next day cells were induced with 30ng/mL M-CSF and
50ng/mL RANKL in combination with indicated concentrations of compound for five
days. The medium was replaced for each two days. Cells were then fixed with 2.5%
glutaraldehyde. Bone slices were stained by 0.5% toluidine blue and then imaged
using an Olympus microscope with 200×magnification. Three view fields were
randomly selected for each bone slice for further pit area analysis which were
quantified using Image J software.
5.2.7 RNA isolation and quantitative real-time PCR (qRT-PCR)
Total RNA extraction and mRNA expression analysis by qRT-PCR were
performed as described previously. mRNA levels of NFATc1, c-fos, TRAP, MMP-9,
cathepsin K and β-actin were quantified by qRT-PCR using specific primers. The
primer sequences were summarized below (Table 3). All values were reported as
mean ± S.D. of triple measurements of each cDNA sample. mRNA levels were
normalized to β actin mRNA.
(Table 3)
5.2.8 Statistical analysis
All data were expressed as mean ± SD and presented as the mean of triplicate
points. Similar independent experiments were repeated three times with three
replicates. A two-tailed non-paired Student’s t test was used to compare differences,

ACCEPTED MANUSCRIPT
and statistical significance was displayed as * P < 0.05 ** P < 0.01 or *** P < 0.001;
# P < 0.05 ## P < 0.01 or ### P < 0.001.
Acknowledgementsꢃ
This work was supported by the NSFC (No. 81321092, 81502902), Shanghai
Municipal Health Bureau young scientific research project (No. 20154Y0005, No.
20144Y0055 ), the Shanghai Committee of Science and Technology, China (No.
14ZR1437500, No. 16ZR1431900) and Funding of Shanghai Jiaotong University
School of Medicine (NO. 14XJ10043).
Supplementary Material
Rhein amide derivative d6 showed none cytotoxicity on MC3T3-E1 osteoblast
and MSCs.
Compound d6 at indicated concentrations were incubated with MC3T3-E1 (A) and
MSCs (B) for 2 days. Cell viability was then determined by MTT assay and ns
represents no significance.
Supplementary data related to this article can be found at

ACCEPTED MANUSCRIPT
References
[1] W.J. Boyle, W.S. Simonet, D.L. Lacey, Osteoclast differentiation and activation,
Nature, 423 (2003) 337-342.
[2] N.A. Sims, J.H. Gooi, Bone remodeling: Multiple cellular interactions required for
coupling of bone formation and resorption, Semin. Cell Dev. Biol. 19 (2008) 444-451.
[3] J.C. Crockett, M.J. Rogers, F.P. Coxon, L.J. Hocking, M.H. Helfrich, Bone
remodelling at a glance, J. Cell Sci. 124 (2011) 991-998.
[4] T.J. Martin, N.A. Sims, Osteoclast-derived activity in the coupling of bone
formation to resorption, Trends Mol. Med. 11 (2005) 76-81.
[5] C.-C. Lee, F.-L. Liu, C.-L. Chen, T.-C. Chen, D.-M. Chang, H.-S. Huang,
Discovery of 5-(2’4’-difluorophenyl)-salicylanilides as new inhibitors of receptor
activator of NF-κB ligand (RANKL)-induced osteoclastogenesis, Eur. J. Med. Chem.
98 (2015) 115-126.
[6] Y.Y. Kong, J.M. Penninger, Molecular control of bone remodeling and
osteoporosis, Exp. Gerontol. 35 (2000) 947-956.
[7] E. Seeman, Pathogenesis of bone fragility in women and men, Lancet, 359 (2002)
1841-1850.
[8] I.B. McInnes, G. Schett, The pathogenesis of rheumatoid arthritis, N. Engl. J. Med.
365 (2011) 2205-2219.
[9] K. Okamoto, H. Takayanagi, Osteoclasts in arthritis and Th17 cell development,
Int. Immunopharmacol. 11 (2011) 543-548.
[10] D.J. Heath, K. Vanderkerken, X. Cheng, O. Gallagher, M. Prideaux, R. Murali,
P.I. Croucher, An osteoprotegerin-like peptidomimetic inhibits osteoclastic bone
resorption and osteolytic bone disease in myeloma, Cancer Res. 67 (2007) 202-208.
[11] G.D. Roodman, J.J. Windle, Paget disease of bone, J. Clin. Invest. 115 (2005)
200-208.
[12] R. Thaler, A. Maurizi, P. Roschger, I. Sturmlechner, F. Khani, S. Spitzer, M.
Rumpler, J. Zwerina, H. Karlic, A. Dudakovic, K. Klaushofer, A. Teti, N. Rucci, F.
Varga, A.J. van Wijnen, Anabolic and antiresorptive modulation of bone homeostasis
by the epigenetic modulator sulforaphane, a naturally occurring isothiocyanate, J. Biol.
Chem. 291 (2016) 6754-6771.
[13] T.H. Kuo, T.H. Lin, R.S. Yang, S.C. Kuo, W.M. Fu, H.Y. Hung, Novel pyrazole
derivatives effectively inhibit osteoclastogenesis, a potential target for treating
osteoporosis, J. Med. Chem. 58 (2015) 4954-4963.
[14] H.B. Kwak, B.K. Lee, J. Oh, J.-T. Yeon, S.-W. Choi, H.J. Cho, M.S. Lee, J.-J.
Kim, J.-M. Bae, S.H. Kim, H.S. Kim, Inhibition of osteoclast differentiation and bone
resorption by rotenone, through down-regulation of RANKL-induced c-Fos and
NFATc1 expression, Bone, 46 (2009) 724-731.
[15] T. Nakashima, M. Hayashi, T. Fukunaga, K. Kurata, M. Oh-Hora, J.Q. Feng, L.F.
Bonewald, T. Kodama, A. Wutz, E.F. Wagner, J.M. Penninger, H. Takayanagi,
Evidence for osteocyte regulation of bone homeostasis through RANKL expression,
Nat. Med. 17 (2011) 1231-1234.

ACCEPTED MANUSCRIPT
[16] C. C. Lee, F.L. Liu, C.L. Chen, T.C. Chen, F.C. Liu, A.A. Ahmed Ali, D.M.
Chang, H.S. Huang, Novel inhibitors of RANKL-induced osteoclastogenesis: Design,
synthesis, and biological evaluation of 6-(2,4-difluorophenyl)-3-phenyl-2H-
benzo[e][1,3]oxazine-2,4(3H)-diones, Bioorg. Med. Chem. 23 (2015) 4522-4532.
[17] I.R. Reid, Bisphosphonates in the treatment of osteoporosis: a review of their
contribution and controversies, Skeletal Radiol. 40 (2011) 1191-1196.
[18] P.H.M. van de Weijer, Risks of hormone therapy in the 50-59 year age group,
Maturitas, 60 (2008) 59-64.
[19] D.J. Newman, G.M. Cragg, Natural Products as Sources of New Drugs from
1981 to 2014, J. Nat. Prod. 79 (2016) 629-661.
[20] H.Y. Tsai, H.Y. Lin, Y.C. Fong, J.B. Wu, Y.F. Chen, M. Tsuzuki, C.H. Tang,
Paeonol inhibits RANKL-induced osteoclastogenesis by inhibiting ERK, p38 and
NF-kappaB pathway, Eur. J. Pharmacol. 588 (2008) 124-133.
[21] S. Hasegawa, T. Yonezawa, J.Y. Ahn, B.Y. Cha, T. Teruya, M. Takami, K.
Yagasaki, K. Nagai, J.T. Woo, Honokiol inhibits osteoclast differentiation and
function in vitro, Biol. Pharm. Bull. 33 (2010) 487-492.
[22] S. Tsukamoto, T. Takeuchi, T. Kawabata, H. Kato, M. Yamakuma, K. Matsuo,
A.H. El-Desoky, F. Losung, R.E.P. Mangindaan, N.J. de Voogd, Y. Arata, H.
Yokosawa, Halenaquinone inhibits RANKL-induced osteoclastogenesis, Bioorg. Med.
Chem. Lett. 24 (2014) 5315-5317.
[23] J.Y. Kim, Y.H. Cheon, S.C. Kwak, J.M. Baek, K.H. Yoon, M.S. Lee, J. Oh,
Emodin regulates bone remodeling by inhibiting osteoclastogenesis and stimulating
osteoblast formation, J. Bone Miner. Res. 29 (2014) 1541-1553.
[24] M.B. Gholivand, S. Kashanian, H. Peyman, H. Roshanfekr, DNA-binding study
of anthraquinone derivatives using Chemometrics methods, Eur. J. Med. Chem. 46
(2011) 2630-2638.
[25] L.-M. Zhao, F.-Y. Ma, H.-S. Jin, S. Zheng, Q. Zhong, G. Wang, Design and
synthesis of novel hydroxyanthraquinone nitrogen mustard derivatives as potential
anticancer agents via a bioisostere approach, Eur. J. Med. Chem. 102 (2015) 303-309.
[26] Y.-K. Liang, Z.-Z. Yue, J.-X. Li, C. Tan, Z.-H. Miao, W.-F. Tan, C.-H. Yang,
Natural product-based design, synthesis and biological evaluation of
anthra[2,1-d]thiazole-6,11-dione derivatives from rhein as novel antitumour agents,
Eur. J. Med. Chem. 84 (2014) 505-515.
[27] X. Yang, G. Sun, C. Yang, B. Wang. Novel rhein analogues as potential
anticancer agents. ChemMedChem, 6 (2011) 2294-2301
[28] C. Boileau, S.K. Tat, J.-P. Pelletier, S. Cheng, J. Martel-Pelletier, Diacerein
inhibits the synthesis of resorptive enzymes and reduces osteoclastic
differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a
protective effect against subchondral bone remodelling, Arthritis Res. Ther. 10 (2008)
1-10.
[29] J. Cai, Y. Duan, J. Yu, J. Chen, M. Chao, M. Ji, Bone-targeting glycol and
NSAIDS ester prodrugs of rhein: Synthesis, hydroxyapatite affinity, stability,
anti-inflammatory, ulcerogenicity index and pharmacokinetics studies, Eur. J. Med.
Chem. 55 (2012) 409-419.

ACCEPTED MANUSCRIPT
[30] Y. Wang, L.Z. Li, Y.L. Zhang, W.J. Sun, Y.Q. Zhu, Y. Cui, L. Qi, LC, a novel
estrone-rhein hybrid compound, promotes proliferation and differentiation and
protects against cell death in human osteoblastic MG-63 cells, Mol. Cell. Endocrinol.
344 (2011) 59-68.
[31] V. Gonnot, S. Tisserand, M. Nicolas, R. Baati, C. Mioskowski, Total synthesis of
rhein and diacerhein via a directed ortho metalation of an aromatic substrate,
Tetrahedron Lett. 48 (2007) 7117-7119.
[32] Z.J. Zhai, H.W. Li, G.W. Liu, X.H. Qu, B. Tian, W. Yan, Z. Lin, T.T. Tang, A.
Qin, K.R. Dai, Andrographolide suppresses RANKL-induced osteoclastogenesis in
vitro and prevents inflammatory bone loss in vivo, Br. J. Pharmacol. 171 (2014)
663-675.

ACCEPTED MANUSCRIPT
Table 1 The effects of rhein derivatives on BMMs viability
Viabilitya（%）
Viabilitya（%）
Compounds
Compounds
control
100
24±3
17±2
103±2
15±1
92±2
53±1
62±3
57±2
49±3
8
37±1
28±1
28±1
51±3
75±1
35±1
79±1

ACCEPTED MANUSCRIPT
17±2
92±2
122±15
rhein
97±7
emodin
109±6
a Cell viability of tested compounds were determined relative to the control at 5 ꢀM by MTT
assay.
Table 2 The inhibitions of rhein derivatives on osteoclasts differentiation determined by TRAP
activity.
Compounds
Trap activities Inhibitiona
c7
d2
0
0
d4
0
d6
98%
85%
65%
47%
45%
d11
d12
rhein
emodin
a TRAP activity was determined with a commercially available kit .
Table 3: Sequences of all primers in quantitative RT-PCR analysis.
Gene
Primer sequence
NFATc1
Forward 5’ - ACCACCTTTCCGCAACCA - 3’
Reverse 5’ - TTCCGTTTCCCGTTGCA - 3’
Forward 5’ - AGGCCCAGTGGCTCAGAGA - 3’
Reverse 5’ - GCTCCCAGTCTGCTGCATAGA - 3’
Forward 5’ - TCCCCAATGCCCCATTC - 3’
Reverse 5’ - CGGTTCTGGCGATCTCTTTG - 3’
Forward 5’- CAAACCCTGCGTATTTCC - 3’
Reverse 5’ - AGAGTACTGCTTGCCCAGGA - 3’
Forward 5’ - GAAGAAGACTCACCAGAAGCAG - 3’
Reverse 5’ - TCCAGGTTATGGGCAGAGATT - 3’
Forward 5’ - CTGTCCCTGTATGCCTCTG - 3’
c-fos
TRAP
MMP-9
CtsK
β actin

ACCEPTED MANUSCRIPT
Reverse 5’ - ATGTCACGCACGATTTCC - 3’

ACCEPTED MANUSCRIPT
Figure Caption
Fig. 1. Chemical structures of natural osteoclast inhibitors.
Fig. 2. Novel rhein amide derivatives
Fig. 3. Rhein amide d6 inhibited the TRAP activity and the formation of osteoclast induced by M-CSF and
RANKL in BMMs without any cytotoxicity. (A) Effect of compound d6 on TRAP activity induced by
M-CSF and RANKL. Compound d6 in increasing dose, emodin and rhein at indicated concentrations were
incubated with BMMs for 2 days in combination with M-CSF and RANKL. Cell lysis was determined with
TRAP activity using a TRAP colorimetric assay. **P<0.01 and ***P<0.001vs control; (B) Effect of
compound d6 on BMMs proliferation. Compound d6 in increasing dose, emodin and rhein at indicated
concentrations were incubated with BMMs with M-CSF for 2 days. Cell viability was then determined by
MTT assay; (C) Effect of compound d6 on osteoclast activation and differentiation. BMMs were induced to
differentiate into osteoclasts by M-CSF and RANKL. Compound d6 in increasing dose, emodin and rhein at
indicated concentrations were incubated with BMMs for 5 days and then TRAP staining was applied to
identify TRAP-positive multinucleated cells which indicated mature osteoclasts; (D) The numbers of
TRAP-positive multinucleated cells of different treatments as shown in C were calculated and presented
graphically. The number of osteoclasts in control was set as 100%, the data was shown as the percents of the
control. All experiments were carried out at least three times. ***P<0.001vs control.
Fig. 4. Rhein amide derivative d6 inhibited bone resportion of osteoclasts induced by RANKL in BMMs. (A)
Effect of d6 on bone resorption of osteoclasts. BMMs were plated on bone slices in 96-well plate and then
differentiate into osteoclasts by M-CSF and RANKL. Compound d6 at indicated concentrations with BMMs
for 5 days and then bone slices were stained by 0.5% toluidine blue to identify bone resorption areas by
mature osteoclasts. Image was shown as 200×magnification; (B) The pit areas were quantified using Image J
software and presented graphically. The pit area in control was set as 100%, the data was shown as the
percents of the control. **P<0.001vs control.
Fig.. 5. Rhein derivative d6 decreased the mRNA expressions of osteoclast marker genes. Osteoclasts
marker gene levels of (A) NFATc1, (B) c-fos, (C) TRAP, (D) MMP-9, (E) cathepsin K were determined by
quantitative RT-PCR analysis of compound d6 at indicated concentrations in combination with M-CSF and
RANKL in BMMs. The results were normalized to β-actin expression and expressed as fold change relative
to gene expression in control cells. ***P<0.001 vs control.
Scheme Captions
Scheme 1. Synthesis of compounds c and d.. Reagents and conditions: (1) acetic anhydride,
Zn(CF3SO3)2, 130 ℃, 2 h; (2) i: oxalyl chloride, DMF, DCM, 1 h, rt; ii: various anilines/ aliphatic amines,
DCM, N(Et)3, 3 h, rt, ; (3) LiOH, H2O, MeOH, 40 ℃, 1 h.

ACCEPTED MANUSCRIPT
Fig. 1
Fig. 2
Fig. 3

ACCEPTED MANUSCRIPT
Fig. 4
Fig. 5

ACCEPTED MANUSCRIPT
Scheme 1

ACCEPTED MANUSCRIPT
Highlights:
1. 20 rhein derivatives were designed, synthesized and characterized;
2. Compounds were evaluated against osteoclast differentiation and bone resorption;
3. The most active compound d6 was reported with high activity and low toxicity.