Efficient access to l-phenylglycine using a newly identified amino acid dehydrogenase from: Bacillus clausii

Article abstract of DOI:10.1039/c6ra17683f

An amino acid dehydrogenase from Bacillus clausii (BcAADH) was identified and overexpressed in Escherichia coli BL21(DE3) for the preparation of l-phenylglycine from benzoylformic acid. Recombinant BcAADH was purified to homogeneity and characterized. BcAADH could catalyse reductive amination and oxidative deamination at optimum pHs of 9.5 and 10.5. Furthermore, BcAADH has a broad substrate spectrum, displaying activities toward various aromatic and aliphatic keto acids. When coexpressed with glucose dehydrogenase from Bacillus megaterium, the potential application of BcAADH in the preparation of l-phenylglycine was investigated at a high substrate loading and low biocatalyst addition. As much as 400 mM benzoylformic acid could be fully reduced into l-phenylglycine within 6 h at >99.9% ee. With merely 0.5 g DCW L^-1, 200 mM benzoylformic acid was completely reduced, resulting in a substrate to biocatalyst ratio of 60 g g^-1, environmental factor of 4.7 and 91.7% isolation yield at gram scale. This study provides guidance for the application of BcAADH in the synthesis of chiral non-natural amino acids.

Full text of DOI:10.1039/c6ra17683f

View Article Online
View Journal
RSC Advances
This article can be cited before page numbers have been issued, to do this please use: J. Cheng, G. Xu,
R. Han, J. Dong and Y. Ni, RSC Adv., 2016, DOI: 10.1039/C6RA17683F.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. This Accepted Manuscript will be replaced by the edited,
formatted and paginated article as soon as this is available.
You can find more information about Accepted Manuscripts in the
Information for Authors.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the Ethical guidelines still
apply. In no event shall the Royal Society of Chemistry be held
responsible for any errors or omissions in this Accepted Manuscript
or any consequences arising from the use of any information it
contains.
www.rsc.org/advances

Page 1 of 7
RSC Advances
View Article Online
DOI: 10.1039/C6RA17683F
RSC Advances
RSCPublishing
ARTICLE
Efficient access to L-phenylglycine using a newly
identified amino acid dehydrogenase from Bacillus
Cite this: DOI: 10.1039/x0xx00000x
clausii
Jun Cheng, Guochao Xu, Ruizhi Han, Jinjun Dong and Ye Ni*
Received 00th January 2012,
Accepted 00th January 2012
An amino acid dehydrogenase from Bacillus clausii
overexpressed in Escherichia coli BL21(DE3) for the preparation of
(
BcAADH) was identified and
ꢀphenylglycine from
L
DOI: 10.1039/x0xx00000x
benzoylformic acid. Recombinant BcAADH was purified to homogeneity and characterized.
BcAADH could catalyse reductive amination and oxidative deamination at optimum pHs of 9.5
and 10.5. Furthermore, BcAADH has a broad substrate spectrum, displaying activities toward
various aromatic and aliphatic keto acids. When coexpressed with glucose dehydrogenase from
www.rsc.org/
Bacillus megaterium, the potential application of BcAADH in the preparation of
Lꢀ
phenylglycine was investigated at high substrate loading and low biocatalyst addition. As
much as 400 mM benzoylformic acid could be fully reduced into Lꢀphenylglycine within 6 h at
>99.9% ee. With merely 0.5 g DCW·L–1, 200 mM benzoylformic acid was completely reduced,
resulting in substrate to biocatalyst ratio of 60 g·g–1, environmental factor of 4.7 and 91.7%
isolation yield at gram scale. This study provides guidance for the application of BcAADH in
the synthesis of chiral nonꢀnatural amino acids.
alcohols, amines and amino acids, as well as nonꢀnatural amino acid
Introduction
have been successfully accomplished using these multiꢀenzymatic
cascades.[23,24] A threeꢀenzyme cascade reaction has been developed
Optically active nonꢀnatural amino acids are important
compounds, and widely used as vital building blocks for
pharmaceuticals and agrochemicals.[1–4] Due to their multifunctional
structure, nonꢀnatural amino acids could also be applied in the
synthesis of structural motifs of peptides and peptidomimetics.[5–7]
There has been an increasingly demand for the nonꢀnatural amino
by Fan and coworkers employing Dꢀmandelate dehydrogenase from
Lactobacillus brevis, mandelate racemase from Pseudomonoa putida
and leucine dehydrogenase from Exiguobacterium sibircum for the
synthesis of L
ꢀphenylglycine.[24] Under optimized condition, 0.2 M
mandelic acid was converted into Lꢀphenylglycine, with 96.4%
conversion and >99% ee. However, this bioprocess requires large
loading of biocatalysts. Consequently, there is a constant demand for
enzymes with high efficiency, stability and enantioselctivity for
scaleꢀup production of amino acids.[28–30]
In this study, a novel leucine dehydrogenase (BcAADH)
was identified and cloned from Bacillu sclausii, with 50.6%
identity to phenylalanine dehydrogenase from Rhodococcus sp..
Recombinant BcAADH was purified and the enzymatic
properties such as optimum temperature and pH, substrate
specificity and kinetic parameters were studied. To our
knowledge, few AADHs have been applied in the preparation
acids, especially
functional groups (aromatic, carboxylic and chiral amine groups),
L
ꢀphenylglycine.[8] Ascribing to their various
chiral
Lꢀphenylglycine and derivatives are important blocks of
antibiotics such as penicillin,[9] pristinamycin I,[10] and the antitumor
Taxol,[11] antiplatelet inhibitors Clopidogrel.[12]
Various chemical routes have been developed for the synthesis of
nonꢀnatural amino acid using asymmetric reaction. However, the
utilization of environmentally harmful organic solvents and toxic
reagents such as cyanides are disadvantageous for industrial
14]
production.[13,
Moreover, the relatively low enantioselectivity
could not satisfy the optical purity requirement for
pharmaceuticals.[15] In comparison, biological methods, using
microbes and enantioselective enzymes, have also been established
and are preferable for the production of nonꢀnatural amino acid.[15, 16]
Through metabolic engineering and pathway recombination,
phenylalanine and ꢀphenylglycine could be produced through
fermentation.[17] However, the metabolic pathways is complex which
of
Lꢀphenylglycine. The potential of this newly identified
BcAADH in the synthesis of
Lꢀphenylglycine was also
investigated. Our results suggest that BcAADH could not only
tolerate high substrate loading, but also display high substrate
to biocatalyst ratio.
Lꢀ
L
might influence the normal growth of microbes, and the product Lꢀ
Results and discussion
phenylglycine is hard to be recovered from natural αꢀamino acids.[18,
19]
Enzymatic synthesis approach is a green alternative for the
Genome mining for amino acid dehydrogenases
preparation of optically active nonꢀnatural amino acids considering
its environmental benignity and high enantioselectivity.[20] Amino
acid dehydrogenases are regarded as a group of enzymes capable of
producing amino acids. Catalytic tandem reaction participated by
various biocatalysts in one pot is an elegant way for the synthesis of
enantiomeric pure compounds.[21,22] Asymmetric synthesis of chiral
To find efficient aryl amino acid dehydrogenases (AADHs),
genome data mining was adopted. Four potential AADHs were
selected from genome database using the amino acid sequence of
phenylalanine dehydrogenase from Rhodococcus sp. (PheDH，
Q59771.2) as probe. After heterogeneously expressed in E. coli
BL21(DE3), the reductive amination activity of AADHs toward
This journal is © The Royal Society of Chemistry 2013
RSC Advances, 2016, 00, 1-3 | 1

RSC Advances
Page 2 of 7
View Article Online
ARTICLE
RSC Advances
DOI: 10.1039/C6RA17683F
benzoylformic acid was investigated. One AADH from Bacillus indicating BcAADH was stable than at operational temperature.[31]
clausii NRRL Bꢀ23342 (BcAADH) under accession No.Q5WF72 The halfꢀlives of amino acid dehydrogenases from Sporosarcina
was proved to be efficient in the asymmetric reduction reaction of psychrophila DSM3 and Exiguobacterium sibircum ECU9271 at
benzoylformic acid. This newly identified AADH displays 50.6% 50°C were 0.5 h and 11 h.[31,33] Effect of pH ranging from 7.5 to 11.0
identity with the amino acid sequence of PheDH. Sequence and on the reductive amination and oxidative deamination activities of
phylogenetic analysis reveal that BcAADH belongs to the BcAADH were also investigated (Figure 3B). For reductive
Glu/Leu/Phe/Val dehydrogenase family and displays high similarity amination, the most suitable pH was pH 9.5. While for the oxidative
with leucine dehydrogenase from Exiguobacterium sibiricum[31] and deamination, BcAADH displays the maximum activity at pH 10.5.
valine dehydrogenase from Bacillus badius[33] as shown in Figure 1. Competing reductive and oxidative activities of BcAADH indicate
Alignment of BcAADH and other amino acid dehydrogenases from the dualꢀfunction of amino acid dehydrogenases in the synthesis of
different origins indicate that conserved residue and domains were amino acids.
also found in BcAADH (Figure S1), including catalytic K80 and
NADH binding domain of GVGNVAY (180–186).
(A) 100
80
Bacillus cereus
26
18
Bacillus subtilis
60
40
20
0
Bacillus stereothermophilus
Moorella thermoacetica
Bacillus sphaericus
27
100
47
85
Sporosarcina psychrophila
Laceyella sacchari
100
99
Thermoactinomyces intermedius
Bacillus clausii
100
15 20 25 30 35 40 45 50 55
Temperature /oC
62
Exiguobateriumsibiricum
Bacillus badius
Labrenzia aggregate
Natronobacteriummagadii MS-3
(B)
100
80
60
40
20
0
0.1
Fig.
1
Phylogenetic analysis of BcAADH and other amino acid
dehydrogenases.
Purification and characterization of BcAADH
Recombinant BcAADH with Nꢀterminal Hisꢀtaq was purified by
nickel affinity chromatography. After desalting and concentration,
purified BcAADH was obtained and analyzed by SDSꢀPAGE. As
shown in Figure 2, BcAADH was migrated a single band at about
45 kDa, in agreement with its theoretical value. In addition, gel
exclusion chromatography revealed that the molecular weight was
90 kDa, indicating BcAADH is a homodimeric enzyme consisting of
two identical subunits. Specific activity of purified BcAADH toward
benzoylformic acid was 17.7 U·mg–1, 2.1 folds higher than that of
the crude extract.
7
8
9
10
11
12
pH
Fig. 3 Effects of temperature and pH on the activity of BcAADH. (A)
Temperature profile of BcAADH. (B) pH profiles of the reductive and
oxidative activities of BcAADH, blue line: reductive profile, green line:
oxidative profile.
Effects of various metal ions on the activity of BcAADH were
also studied (Table S3). The enzyme activity was obviously
inhibited by the addition of 1 mM Li+, Fe3+ and Ag+, while Mg2+ and
Co+ could promote the activity of BcAADH to 108.3% and 113.5%
respectively. EDTA is a metal ions chelator, which could eliminate
the metal ions from enzyme. As a result, the metal ion dependent
enzyme could be deactivated or lose some activity. However, EDTA
had none influence on the activity of BcAADH. Consequently,
BcAADH is presumed to be a metal ionꢀindependent amino acid
dehydrogenase.
Substrate spectrum of BcAADH toward various keto acids and Lꢀ
amino acids with different substituents was investigated. As shown
in Table 1, BcAADH preferred aliphatic to aromatic keto acids in
the asymmetrically reductive amination reaction. Moreover, most of
the tested aromatic keto acids could be reduced by BcAADH,
especially benzoylformic acid (17.7 U·mg–1). The highest activity
was observed with 4ꢀmethylꢀ2ꢀoxopentanoic acid (96.1 U·mg–1),
Fig. 2 SDSꢀPAGE of analysis of purified BcAADH and coexpression of
BcAADH and BmGDH. (A) lane 1: protein molecular marker, lane 2: crude
extract, lane 3: purified BcAADH; (B) lane 1: protein molecular marker,
lanes 2&5, 3&6, 4&7: supernatant and precipitant of recombinant E. coli
BL21(DE3) harboring pACYCDuetꢀBmGDH, pET28ꢀBcAADH and
pACYCDuetꢀBmGDH/pET28ꢀBcAADH.
which could be reduced into
oxidative deamination, BcAADH could also catalyse the oxidative
deamination reaction of aromatic amino acids, such as
phenylglycine (0.11 U·mg–1). However, higher activity was found
with aliphatic amino acids, especially
ꢀleucine (0.59 U·mg–1),
Lꢀleucine by BcAADH. For the
Enzyme activities at different temperatures of 20–50°C were
investigated. As illustrated in Figure 3A, BcAADH shows the
highest activity at around 30°C. Halfꢀlives of BcAADH were 315,
85.6 and 4.5 h at 30, 40 and 50°C (Figure S2), respectively,
Lꢀ
L
2 | RSC Advances, 2016, 00, 1-3
This journal is © The Royal Society of Chemistry 2012

Page 3 of 7
Journal Name
RSC Advances
View ArticAle ROnTliInCeLE
DOI: 10.1039/C6RA17683F
which might be ascribed to its lower steric hindrance and similarity stability and activity, low side reaction, low price and favorable
to leucine dehydrogenase from Bacillus sphaericus ATCC4525.[37] thermodynamic.[38,39] By the reduction of NAD+ along with the
Our results indicate BcAADH has a wide substrate spectrum.
Table 1 Substrate specificity of purified BcAADH.
oxidation of glucose, NADH and gluconic acid are produced.
Among various GDHs, the GDH from Bacillus megaterium
(BmGDH) displays excellent activity and high soluble expression
level in E. coli BL21(DE3).[32] Consequently, BmGDH was chosen
for the regeneration of NADH. BmGDH was coexpressed with
BcAADH in E. coli BL21(DE3) harboring both plasmids pET28ꢀ
BcLeuDH and pACYCDuetꢀBmGDH. As illustrated in Figure 2B,
GDH and BcAADH were successfully coexpressed in E. coli
BL21(DE3). Activities of BcAADH and BmGDH in dry cells were
determined to be 5.53 and 3.84 U·mg–1 DCW, respectively.
Relative
activity
[%]
Relative
activity
[%]
Substrate
Substrate
Reductive amination
Oxidative deamination
100a
5.88
100b
<0.1
To establish an efficient biocatalytic process, various influential
factors, including temperature, substrate/biocatalyst loading and
NAD+ addition, were investigated. The reaction was optimized to
improve the substrate loading and productivity as shown in entries
1–6 in Table 3. Within 0.5 h, 50 mM (7.5 g·L–1) benzoylformic acid
<0.1
0.23
346
318
could be fully reduced into
L
ꢀphenylglycine using 10 g·L–1
biocatalyst (dry cells) at 30°C and 120 rpm with substrate to
biocatalyst ratio of 0.75 g·g–1 and >99.9% ee. Under the same
condition, when substrate loading was increased to 200 mM (30 g·L–
1), the conversion could only reach 88.9% even after 24 h (entry 3).
543
322
536
Additionally, much Lꢀphenylglycine was crystallized and attached to
<0.1
the reactor. Lower temperature is therefore presumed to be more
suitable for the biocatalytic reaction, due to the higher stability of the
enzymes. At 25°C, 200 mM benzoylformic acid could be fully
reduced. To test the maximum efficacy of BcAADH, the substrate
loading was further increased to 400 mM (60 g·L–1). Although 400
mM substrate could be completely reduced in 6 h under assistance of
2.86
8.96
a Specific activity toward benzoylformic acid was regarded as 100%, 17.7
0.3 mM NAD+, too much
Lꢀphenylglycine crystals were attached to
U·mg–1.
the reactor, leading to poor mass transfer. Consequently, further
optimization was conducted aiming at improving the efficiency of
BcAADH and substrate to biocatalyst ratio (S/B) as shown in entries
7–11 of Table 3. Under 5 g·L–1 biocatalyst, 200 mM benzoylformic
acid could not be fully reduced even after 12 h, with 92.7%
conversion. Addition of 0.3 mM NAD+ could however accelerate the
reaction, and 200 mM substrate could be reduced within 1 h (entry
8). The amount of biocatalyst was further reduced to 3, 1 and 0.5
g·L–1, the substrate could be fully reduced within 2, 6 and 12 h
respectively (entries 9–11). The S/B reached as high as 60 g·g–1
with >99.9% ee, ranking the highest level for the bioreductive
b
Specific activity toward
U·mg–1.
Lꢀphenylglycine was regarded as 100%, 0.11
Kinetic parameters of purified BcAADH toward several
preferred substrates were investigated (Table 2). The Km and kcat of
BcAADH toward aromatic amino acids, benzoylformic acid and 2ꢀ
chlorobenzoylformic acid, were 13 mM and 65.2 s–1, 6.33 mM and
1.56 s–1, respectively. BcAADH displays the highest affinity and
catalytic efficiency on 4ꢀmethylꢀ2ꢀoxopentanic acid (2.74 mM and
242 s–1). However, with regard to the substrates with smaller sideꢀ
chains, such as pyruvic acid and trimethylpyruvic acid, poor binding
affinity was observed, resulting in low kcat/Km (0.088 s–1 and 0.423 s–
preparation of L
ꢀphenylglycine.[34] Environmental factor (E factor)
was calculated to be 4.7, demonstrating a green bioprocess catalyzed
by BcAADH.[35] Enzyme consumption number (e. c. n.) was
calculated to be 0.018, illustrating an extremely low amount of
enzyme used in the bioprocess.[36] In addition, the crystallized
1
respectively), which were similar to other amino acid
dehydrogenases, such as EsAADH.[31]
Table 2 Steadyꢀstate kinetic constants of BcAADH.
product Lꢀphenylglycine could easily be isolated by adjusting the pH
Km
[mM]
13.0
6.33
2.74
13.9
37.2
25.7
0.373
kcat
kcat/Km
[s–1·mM–1]
5.02
0.246
88.3
Substrate
to dissolve the crystals, followed by boiling to remove the cells due
to the low biocatalyst loading, and then subjected to rotary
evaporation. To the best of our knowledge, this BcAADH catalyzed
[s–1]
65.2
Benzoylformic acid
2ꢀChlorobenzoylformic acid
4ꢀMethylꢀ2ꢀoxopentanoic acid
2ꢀKetobutyric acid
1.56
242
153
3.27
10.9
100
bioprocess for
Lꢀphenylglycine is ranking one of most efficient
bioprocess, considering its high substrate loading and biocatalysts
11.0
utilization efficiency.[24,40] Therefore, this newly mined BcAADH is
Pyruvic acid
Trimethylpyruvic acid
NADH
0.088
0.423
268
highly potential in the asymmetric preparation of Lꢀphenylglycine.
Preparation of
L
-phenylglycine at gram scale
ꢀphenylglycine was conducted
A gramꢀscale preparation of
L
Optimization of the asymmetric preparation of
L
-phenylglycine
using the recombinant whole cells of E. coli
BL21(DE3)/pET28ꢀBcAADH/pACYCDuetꢀBmGDH. In a 100ꢀ
mL reaction system, 3.0 g benzoylformic acid, 50 mg DCW of
whole cells, 0.3 mM NAD+ (final concentration) and 7.2 g
glucose were added. The reaction was performed at 25°C with
60 rpm mechanical agitation. The conversion of benzoylformic
To evaluate the potential of BcAADH in the asymmetric
preparation of ꢀphenylglycine, the reaction condition was
L
optimized. Firstly, to drive the reaction, cofactor regeneration system
was usually introduced to generate NADH for the reduction reaction.
Glucose dehydrogenase (GDH) is usually used as cofactor
regeneration system in the asymmetric bioreduction, due to its high
This journal is © The Royal Society of Chemistry 2012
RSC Advances, 2016, 00, 1-3 | 3

RSC Advances
Page 4 of 7
View Article Online
ARTICLE
RSC Advances
DOI: 10.1039/C6RA17683F
Table 3 Asymmetric synthesis of Lꢀphenylglycine with recombinant whole cells coexpressing BcAADH and BmGDH.
Substrate
[g·L–1]
7.5
15
Biocatalyst
S/Ba
[g·g–1]
0.75
1.5
3
3
6
6
6
Temperature
NAD+
[mM]
0
0
0
Time
[h]
0.5
2
24
4
24
6
12
1
Conversionb
[%]
eec
[%]
Entry
[g·L–1]
10
10
10
10
10
10
5
[°C]
30
30
30
25
25
25
25
25
25
25
25
1
2
3
4
5
6
7
8
9
>99
>99
88.9
>99
62.8
>99
92.7
>99
>99
>99
>99
>99.9
>99.9
>99.9
>99.9
>99.9
>99.9
>99.9
>99.9
>99.9
>99.9
>99.9
30
30
60
60
30
30
30
30
0
0
0.3
0
0.3
0.3
0.3
0.3
5
3
1
0.5
6
10
30
60
2
6
12
10
11
30
a S/B: substrate to biocatalyst ratio, g·g–1.
b Conversion was analysed by HPLC equipped with Diamonsil C18 column at 220 nm and flow rate of 0.6 mL·min–1 with 5% methanol, 95% KH2PO4 and
0.08% trifluoroacetic acid as mobile phase.
ee was determined by HPLC equipped with Chirobiotic T column at 220 nm and flow rate of 0.5 mL·min–1 with 20% methanol, 80% ddH2O and 0.1%
c
TFA as mobile phase.
disrupted by a ATS engineering AHꢀBASIC II homogenizer
acid reached 99% in 12 h. After rotary evaporation and
(Shanghai, China). And the recombinant BcAADH with N terminal
crystallization, 2.73 g optically pure L-phenylglycine was harvested,
his tag was purified as previously described [31]. Purified BcAADH
with 91% isolation yield and >99.9% ee. The product was also
was added with 30%(v/v) glycerol after desalting and concentration,
and subsequently stored at –80°C.
confirmed to be L-phenylglycine by LCꢀMS, 1HꢀNMR and 13Cꢀ
NMR as follows (Figure S3–S5): 1HꢀNMR (400 MHz, D2O), δ/ppm:
4.36 (s, 1H), 7.16–7.42 (m, 5H); 13CꢀNMR (100 MHz, D2O), δ/ppm:
Activity assays
60.5,126.8, 127.5, 128.8, 181.0.
The reductive amination and oxidative deamination activities of
BcAADH were determined by monitoring the change of NADH at
340 nm (ε= 6220 L·M−1·cm−1) using spectrophotometer. For the
reductive amination activity, 200 µL reaction mixture was consisted
of 0.5 mM NADH, 5 mM benzoylformic acid and appropriate
amount of BcAADH in NH4ClꢀNH3·H2O (pH 9.5, 0.5 M). For the
oxidative deamination activity, 200 µL reaction mixture was
Experimental
Strains and chemicals
Escherichia coli DH5ɑ and BL21(DE3) in this study were preserved
in our laboratory and used as the cloning and expression hosts
respectively. Plasmids pET28a and pACYCDuetꢀ1 were
commercially obtained from Novagen (Madison, WI, USA).
Benzoylformic acid, D/Lꢀphenylglycine and other substrates were all
purchased from Shanghai CIVI Chemical Technology co. Ltd
(shanghai, China).
consisted of 0.5 mM NAD+, 5 mM
Lꢀphenylglycine and appropriate
amount of BcAADH in NH4ClꢀNH3·H2O (pH 9.5, 0.5 M). One unit
of AADH or glucose dehydrogenase (GDH) was defined as the
amount of enzyme that catalyzes the reduction of phenylglycine or
oxidation of glucose to produce 1.0 µmol NAD+ or 1.0 µmol NADH
per minute. Activity of GDH was defined and determined as
previously reported. [32] All the assay was performed in triplicate.
Enzymatic characterization of purified BcAADH
Cloning, expression and purification of BcAADH
Gene coding for BcAADH was amplified from the genomic
DNA of Bacillus clausii NRRL Bꢀ23342 by PCR using primers (F:
CGCGGATCCATGGAATTATTTGCAAAGA,R:CCGCTCGAGT
TACTTTTTCCTCGAA) with BamHI and XhoI restriction sites.
PCR product and pET28a were double digested with BamHI and
XhoI. The resultant DNA fragments were recovered and ligated at
4°C for 12 h. Then the constructed plasmid pET28ꢀBcAADH was
transformed into E. coli DH5α. After verified by colony PCR, the
recombinant plasmid was extracted and further transferred into E.
coli BL21(DE3).
Recombinant strain E. coli BL21(DE3)/pET28ꢀBcAADH cell
was cultivated in 30 mL LB medium containing 50 µg/mL
kanamycin at 37°C and 180 rpm, until optical density at 600 nm
reached 0.6–0.8. Then 0.1 mM IPTG was added and the recombinant
strain was further cultivated at 25°C for 7 hours. Cells were
collected by centrifuging at 8000 × g for 10 min. Then the cells were
Optimum pH and temperature and thermostability
The optimum pH was determined by above mentioned standard
activity assay in different NH4ClꢀNH3·H2O buffers (pH 7.5–11.0).
The optimum temperature was determined at different temperature
range from 20°C to 50°C. The thermostability of BcAADH was
investigated by incubating the purified BcAADH (0.1 mg·mL–1) at
30, 40, and 50°C for certain period of time in 0.5 M NH4Clꢀ
NH3·H2O buffer (pH 9.5). The relative residual activity was detected
by standard assay protocol. The halfꢀlives of BcAADH were
calculated by the fitting curves of relative residual activity and time.
Effect of metal ions
Influence of metal ions on enzyme activity was studied by preꢀ
incubating the purified BcAADH with different metal ions (1 mM)
and EDTA for 30 min at 30 °C. The enzyme activity was determined
using the standard assay. Enzyme activity in the absence of metal
4 | RSC Advances, 2016, 00, 1-3
This journal is © The Royal Society of Chemistry 2012

Page 5 of 7
Journal Name
RSC Advances
View ArticAle ROnTliInCeLE
DOI: 10.1039/C6RA17683F
ions was expressed as control (100%). The promotion or inhibition
of metal ions were studied by comparison with the control. All the
activities were carried out in triplicate.
Conclusions
In summary, a novel amino acid dehydrogenase (BcAADH)
was identified from Bacillus clausii NRRL Bꢀ23342 with high
activity and enantioselectivity toward aromatic keto acids.
BcAADH belongs to Glu/Leu/Phe/Val dehydrogenase family
and could catalyse reductive amination and oxidative
deamination. The optimum pH for reduction and oxidation
were 9.5 and 10.5. Specific activities of BcAADH toward
benzoylformic acid and Lꢀphenylglycine were 17.7 and 0.11
U·mg–1. The Km and kcat were 13 mM and 65.2 s–1 toward
benzoylformic acid. BcAADH displays high efficiency in the
Substrate spectrum
Substrate specificity of purified BcAADH toward various
prochiral keto acids and amino acids was measured as shown in
Table 1. The specific activity of BcAADH toward benzoylformic
acid and
Kinetic analysis
Kinetic parameters of purified BcAADH toward various keto
ꢀphenylglycine, NADH and NAD+ were measured using
standard assay protocol. The concentrations were in range of 1–100
Lꢀphenylglycine was regarded as 100%.
acids,
L
asymmetric preparation of
with BmGDH from Bacillus megaterium
L
ꢀphenylglycine. When coexpressed
mM for keto acids and Lꢀphenylglycine, 0.025–1.0 mM for NADH
and NAD+. The Km and Vmax were calculated according to the
LineweaverꢀBurk plot.
,
200 mM
benzoylformic acid could be fully reduced using merely 0.5
g·L–1 dry cells, with 91% isolation yield and >99.9% ee. The
substrate to biocatalyst ratio and Environmental factor were 60
g·g–1 and 4.7. Our results indicate that BcAADH is a highly
potential and robust enzyme for the industrial production of
valuable nonꢀnatural amino acids.
Co-expression of BcAADH and GDH
Glucose dehydrogenase coding gene was cloned from Bacillus
megaterium and inserted into the BamHI and SalI restriction sites of
pACYCDuet using ClonExpressII one step clone kit (Vazyme Inc.,
Nanjing). The resultant plasmids pACYCDuetꢀBmGDH and pET28ꢀ
BcAADH were simultaneously transformed into E. coli BL21(DE3)
cells and spread on LB plates supplemented with kanamycin and Acknowledgements
chloramphenicol. E. coli BL21(DE3) harboring pET28ꢀBcAADH
and pACYCDuetꢀBmGDH was identified by colony PCR.
Recombinant coexpression cells were cultured and induced as
mentioned above. The cells was lyophilized to dry cells and stored at
4°C for further use.
We are grateful to National Natural Science Foundation of China
(21276112, 21506073), Natural Science Foundation of Jiangsu
Province (BK20150003), the Fundamental Research Funds for the
Central Universities (JUSRP51409B), the Program of Introducing
Talents of Discipline to Universities (111ꢀ2ꢀ06), and a project funded
Optimization of the asymmetrically reductive amination of by the Priority Academic Program Development of Jiangsu Higher
benzoylformic acid
Education Institutions for the financial support of this research.
Optimization of the asymmetric amination of benzoylformic acid
was conducted in a 20ꢀmL reactor and magnetically stirred at 120
rpm and 30°C. Firstly, benzoylformic acid was dissolved by addition
of diluted NaOH (0.5 M), then NH4Cl and glucose were added into
the reactor. The pH of reaction mixture was adjusted to 8.5 with 0.5
M NH3·H2O. Finally the lyophilized cells of the recombinant E. coli
BL21(DE3) harboring pET28ꢀBcAADH and pACYCDuetꢀBmGDH
Keywords: Amino acid dehydrogenase, ꢀphenylglycine,
Asymmetric reduction, Substrate to catalyst ratio.
L
Notes and references
a
The Key Laboratory of Industrial Biotechnology, Ministry of Education,
were added to start the reaction. Amount of enzyme, reaction School of Biotechnology, Jiangnan University, Wuxi 214122, Jiangsu, China.
temperature and NAD+ were varied as shown in Table 3. Samples
*Corresponding author: Prof. Y. Ni, yni@jiangnan.edu.cn
were withdrawn from the reaction mixture to determine the
conversion and enantiomeric excess (ee) by HPLC analysis.
†
Footnotes should appear here. These might include comments
Conversion was monitored by HPLC equipping with Diamonsil C18
column (250 mm×4.6 mm, ID 5 mm, DIMKA), detecting at UV 220
nm and 30°C in the mobile phase including methanol 5%, KH2PO4
95% and trifluoroacetic acid 0.08% at a flow rate of 0.6 mL·min–1.
The ee of the Lꢀphenylglycine was measured by HPLC with a chiral
Astec column (Chirobiotic T, 150 mm × Ф 4.6 mm) at 220 nm, using
mobile phase consisted of methanol, ddH2O and TFA with a volume
ratio of 20:80:0.001. The flow rate was 0.5 mL·min–1. Retention
relevant to but not central to the matter under discussion, limited
experimental and spectral data, and crystallographic data.
Electronic Supplementary Information (ESI) available: [details of any
supplementary information available should be included here]. See
DOI: 10.1039/b000000x/
1
S.J. Zuend, M.P. Coughlin, M.P. Lalonde and E.N. Jacobsen. Nature
2009. 461, 968–970.
,
times of
respectively.
Gram-scale synthesis of
Lꢀ and Dꢀphenylglycine were 6.1 min and 8.6 min,
2
3
4
T. Lazar. ChemBioChem, 2005.
6, 1127–1128.
L
-phenylglycine
In a 100ꢀmL reaction system, 3.0 g benzoylformic acid was
dissolved in deionized water and adjusted to pH 8.5 with 0.5 M
NH3·H2O, then 2.675 g NH4Cl, 0.19 g NAD+, 7.2 g glucose and 0.05
g dry cells were added. The reaction pH was maintained at 8.5 by
titrating 0.5 M NH3·H2O. The reaction was conducted at 120 rpm
and 30°C. Samples were withdrawn to analyze the conversion and ee
as described above. Finally, reaction mixture was centrifuged (8000
× g, 15 minutes). The precipitation was dissolved with 1.0 M
NH3·H2O and subsequently boiled for 10 min to remove the
biocatalysts. The product was collected by rotary evaporation and
S.C. Stinson. Chem. Eng. News, 2001. 79, 79ꢀ97.
J. Altenbuchner, M. SiemannꢀHerzberg and C. Syldatk. Curr. Opin.
in Biotechnol., 2001. 12, 559–563.
5
6
S. Servi, D. Tessaro and G. PedrocchiꢀFantoni. Coordination Chem.
Rev., 2008. 252, 715–726.
T.K. Oost, C. Sun, R.C. Armstrong, A.S. AlꢀAssaad, S.F. Betz, T.L.
Deckwerth, H. Ding, S.W. Elmore, R.P. Meadows, E.T. Olejniczak,
A. Oleksijew, T. Oltersdorf, S.H. Rosenberg, A.R. Shoemaker, K.J.
Tomaselli, H. Zou and S.W. Fesik. J. Med. Chem., 2004. 47, 4417–
4426.
crystallization. The synthesized
Lꢀphenylglycine was verified by
LC/MS, 1HꢀNMR and 13CꢀNMR.
7
R. Williams. 1989, Pergamon Press: Oxford.
This journal is © The Royal Society of Chemistry 2012
RSC Advances, 2016, 00, 1-3 | 5

RSC Advances
Page 6 of 7
View Article Online
ARTICLE
RSC Advances
DOI: 10.1039/C6RA17683F
8
A. Perdih and M. Sollner Dolenc. Curr. Org. Chem., 2007. 11, 801– 38 J.C. Moore, D.J. Pollard, B. Kosjek and P.N. Devine. Acc. Chem.
832. Res., 2007, 40, 1412–1419.
L.M.V. Langen, F.V. Rantwijk, V.K. Švedas and R.A. Sheldon. 39 S. Broussy, R.W. Cheloha and D.B. Berkowitz. Org. Lett., 2009, 11
Tetrahedron:Asymmetry, 2000. 11, 1077–1083. 305–308.
10 Y. Zhao, R. Feng, G. Zheng, J. Tian, L. Ruan, M. Ge, W. Jiang and 40 S.P. Liu, R.X. Liu, A.A.M.M. ElꢀRotail, Z.Y. Ding, Z.H. Gu, L.
9
,
Y. Lu. J. Bacteriol., 2015. 197, 2062–2071.
Zhang and G.Y. Shi. J. Biotechnol., 2014, 30, 91–97.
11 R. Croteau, R.E.B. Ketchum, R.M. Long, R. Kaspera and M.R.
Wildung. Phytochem. Rev., 2006. 5, 75–97.
12 M.W. van der Meijden, M. Leeman, E. Gelens, W.L. Noorduim, H.
Meekes, W.J.P. van Enckevort, B. Kaptein, E. Vieg and R.M.
Kellogg. Org. Process Res. Dev., 2009. 13, 1195–1198.
13 D.J. Ager. Curr. Opin. Drug Discov. Dev., 2002. 5, 892–905.
14 M.A. Wegman, M.H.A. Janssen, F. van Rantwijk and R.A. Sheldon.
Adv. Syn. Catal., 2001. 343, 559–576.
15 J.B. Wang and M.T. Reetz. Nature Chem., 2015,
16 D.J. Ager and I.G. Fotheringham. Curr. Opin. Drug Discov. Dev.
2001. , 800–807.
7, 948–949.
,
4
17 P.P. Taylor, D.P. Pantalenone, R.F. Senkpeil and I.G. Fotheringham.
Trends Biotechnol., 1998. 16, 412–418.
18 R. McKenna and D.R. Nielsen. Metab. Eng., 2011. 13, 544–554.
19 S.P. Liu, R.X. Liu, A.A. EIꢀRotail, Z.Y. Ding, Z.H. Gu, L. Zhang and
G.Y. Shi. J. Biotechnol., 2014. 186, 91–97.
20 B.K. Hubbard, M.G. Thomas and C.T. Walsh. Chem. Biol., 2000. 7,
931–942.
21 F.G. Mutti, T. Knaus, N.S. Scrutton, M. Breuer and N.J. Turner.
Science, 2015. 349, 1525–1529.
22 A.S. Goldman, A.H. Roy, Z. Huang, R. Ahuja, W. Schinski and M.
Brookhart. Science, 2006. 312, 257–261.
23 D. Enders, M.R. Hüttl, C. Grondal and G. Raabe. Nature, 2006. 441
,
861–863.
24 C.W. Fan, G.C. Xu, B.D. Ma, Y.P. Bai, J. Zhang and J.H. Xu. J.
Biotechnol., 2015. 195, 67–71.
25 V. Resch, W.M.F. Fabian and W. Kroutil. Adv. Syn. Catal., 2010.
352, 993–997.
26 J.H. Sattler, M. Fuchs, K. Tauber, F.G. Mutti, K. Faber, J. Pfeffer, T.
Haas and W. Kroutil. Angew. Chem. Int. Ed., 2012. 51, 9156–9159.
27 M. Hall and A.S. Bommarius. Chem. Rev., 2011. 111, 4088–4110.
28 T. Rojanarata, D. Isarangkul, S. Wiyakrutta, V. Meevootisom and
J.M. Woodley. Biocatal. Biotransf., 2004. 22, 195–201.
29 W.M. Liu, H.M. Ma, J.X. Luo, W.H. Shen, X. Xu, S. Li, Y. Hu and
H. Huang. Biochem. Eng. J., 2014. 91, 204–209.
30 T. Ema, S. Ide, N. Okita and T. Sakai. Adv. Syn. Catal., 2008. 350
,
,
,
2039–2044.
31 J. Li, J. Pan, J. Zhang and J.H. Xu. J. Mol. Catal. B: Enzymatic
2014, 105, 11–17.
32 G.C. Xu, H.L. Yu, Y.P. Shang and J.H. Xu. RSC Adv., 2015,
5
22703–22711.
33 Y. Zhao, T. Wakamatsu, K. Doi, H. Sakuraba and T. Ohshima. J.
Mol. Catal. B: Enzymatic, 2012, 83, 65–72.
34 G.W. Zheng, J. Pan, H.L. Yu, M.T. NgoꢀThi, C.X. Li and J.H. Xu. J.
Biotechnol., 2010, 150, 108–114.
35 C. Wandrey, A. Liese and D. Kihumbu. Org. Process Res. Dev.
2000. , 286–290.
36 R.A. Sheldon. Green Chem., 2007.
,
4
9
, 1273–1283.
37 H.M. Li, D.M. Zhu, B.A. Hyatt, F.M. Malik, E.R. Biehl and L. Hua.
Appl. Biochem. Biotechnol., 2009, 158, 343–351.
6 | RSC Advances, 2016, 00, 1-3
This journal is © The Royal Society of Chemistry 2012

Page 7 of 7
RSC Advances
View Article Online
DOI: 10.1039/C6RA17683F