Synthesis and Biological Evaluation of Ascorbyl-Conjugated Peptide Derivatives as Collagen Synthesis Stimulating Agents in Human Skin Fibroblasts

Article abstract of DOI:10.1007/s10989-020-10041-7

Vitamin C (ascorbic acid) is a widely used agent for anti-aging and whitening in the field of cosmetics. It affects collagen production in skin cells, inhibits melanin synthesis, displays anti-oxidant activity, and improves the immune system. However, vitamin C has limitations in cell permeability and environmental condition such as heating and lighting decrease its stability. Thus, vitamin C derivatives are being developed to overcome these problems. In this study, we synthesized vitamin C derivatives with a succinoyl group at the 2-position and peptides in the form of ester bonds. We then evaluated the cytotoxicity and collagen synthesis activity of these new compounds in human skin fibroblasts. Vitamin C-conjugated peptides were also synthesized in ether and carbamate forms, and the optimal combination conditions of vitamin C and peptides were identified. In addition, collagen synthesis-stimulating activity of vitamin C-conjugated peptides was also evaluated and compared to the effects of vitamin C alone. Based on these results, we confirmed that the ester-bonded vitamin C-conjugated peptide GEKG showed more stimulating effect on the production of collagen and related gene expression than either vitamin C or GEKG alone. This study will provide important information for developing skin health products and other topical cosmetics using vitamin C and peptides.

Full text of DOI:10.1007/s10989-020-10041-7

International Journal of Peptide Research and Therapeutics
https://doi.org/10.1007/s10989-020-10041-7
Synthesis and Biological Evaluation of Ascorbyl-Conjugated Peptide
Derivatives as Collagen Synthesis Stimulating Agents in Human Skin
Fibroblasts
Kyeong‑Yong Park1 · Jiyeon Kim2
Accepted: 30 January 2020
© Springer Nature B.V. 2020
Abstract
Vitamin C (ascorbic acid) is a widely used agent for anti-aging and whitening in the feld of cosmetics. It afects collagen
production in skin cells, inhibits melanin synthesis, displays anti-oxidant activity, and improves the immune system. However,
vitamin C has limitations in cell permeability and environmental condition such as heating and lighting decrease its stability.
Thus, vitamin C derivatives are being developed to overcome these problems. In this study, we synthesized vitamin C deriva-
tives with a succinoyl group at the 2-position and peptides in the form of ester bonds. We then evaluated the cytotoxicity
and collagen synthesis activity of these new compounds in human skin fbroblasts. Vitamin C-conjugated peptides were also
synthesized in ether and carbamate forms, and the optimal combination conditions of vitamin C and peptides were identi-
fed. In addition, collagen synthesis-stimulating activity of vitamin C-conjugated peptides was also evaluated and compared
to the efects of vitamin C alone. Based on these results, we confrmed that the ester-bonded vitamin C-conjugated peptide
GEKG showed more stimulating efect on the production of collagen and related gene expression than either vitamin C or
GEKG alone. This study will provide important information for developing skin health products and other topical cosmetics
using vitamin C and peptides.
Keywords Vitamin C · Collagen · Human skin fbroblast · Peptide · CCK-986sk
Introduction
key enzymes, prolyl and lysyl hydroxylases, for the hydrox-
ylation of proline and lysine (Peterkofsky and Udenfriend
1965). The hydroxylation of proline and lysine stabilizes the
tertiary structure of the collagen molecule; synthesis of col-
lagen proceeds by activation of collagen gene expression in
skin (Miller et al. 1979; Kivirikko et al. 1989; Pihlajaniemi
et al. 1991; Parsons et al. 2006). Collagen formation occurs
mainly in fbroblasts in the dermis, providing a matrix of
dermal collagen (Duarte et al. 2009). During the skin regen-
eration process, vit C increases the proliferation and mRNA
expression of procollagen and elastin in skin fbroblasts
(Geesin et al. 1988; Davidson et al. 1997). Not only does
vit C act as a scavenger of free radicals, the availability of
vit C in skin fbroblasts refects the status of collagen syn-
thesis activity and human skin health (Parsons et al. 2006).
Since the amount of vit C in plasma is sometimes too low
to afect the dermal collagen synthesis, topical applications
using formulations of cream or serum containing vit C can
be used on the skin to augment collagen formation (Nusgens
et al. 2001; Humbert et al. 2003; Sauermann et al. 2004;
Pullar et al. 2017).
Vitamin C (ascorbic acid, vit C) plays an essential role in
the biosynthesis and maintenance of collagen formation in
humans (Al-Niaimi and Chiang 2017; Pullar et al. 2017). In
normal skin, high concentration of vit C in localized intra-
cellular compartments act as an essential cofactor of two
Electronic supplementary material The online version of this
article (https://doi.org/10.1007/s10989-020-10041-7) contains
supplementary material, which is available to authorized users.
* Jiyeon Kim
yeon@dankook.ac.kr
Kyeong-Yong Park
pky@chamc.co.kr
1
Department of Integrated Material’s Development, CHA
Meditech Co., Ltd, Daejeon 34025, Republic of Korea
2
Department of Medical Laboratory Science, College
of Health Science, Dankook University, 119, Dandae-ro,
Dongnam-gu, Cheonan 31116, Republic of Korea
Vol.:(0123456789)
1 3

International Journal of Peptide Research and Therapeutics
Collagen has been used in many industrial applications to
develop nutrient supplements and therapeutic agents. Espe-
cially, the amount of collagen in skin plays a pivotal role in
determining the elasticity and the production of wrinkles.
Therefore, many cosmetic research facilities have investi-
gated new activating methods of collagen synthesis in skin
to improve the skin regeneration. A previous study intro-
duced a novel ascorbyl-conjugated peptide and its collagen
synthesis stimulating efects in human skin fbroblasts (Choi
et al. 2009). This report reported that vit C-linker conju-
gated peptide enhanced the collagen biosynthesis stimulat-
ing efect of vit C in skin fbroblasts. Oligopeptides of fewer
than 10 amino acids were involved in various physiological
processes and they acted as messengers, stimulators, or neu-
rotransmitters which may infuence cellular processes such
as proliferation, diferentiation, and digestion (Loren et al.
1987). Especially, a tri-, tetra-, or hexa-peptide containing
Gly-Lys-His, Gly-His-Lys, or Gly-Pro-Hyp (hydroxyproline)
are known to enhance the synthesis of collagen and glycosa-
minoglycan in the skin regeneration process (Loren et al.
1987). The outcome of these earlier studies on the synthesis
of collagen has led to in-depth investigations of other types
of vit C-linker conjugated peptides.
Inc. (USA). The Total Collagen Assay Kit was purchased
from BioVision, Inc. (USA).
Cell Culture and Cell Viability Assay
Human skin normal fbroblast CCD-986sk cells were main-
tained in Iscove’s Modifed Dulbecco’s Medium (IMEM)
containing 10% FBS and 1% antibiotics in a humidifed
atmosphere of 5% CO2 at 37 °C. To determine cell viabil-
ity, CCD-986sk cells (passage 12) (4 × 103 cells/well) were
seeded in a 96-well plate for 24 h and then treated with pep-
tides for 72 h in culture media. Cell viability was assessed
using the Cell Counting Kit-8 (Dojindo Molecular Tech-
nologies, Kumamoto, Japan) according to the manufacturer’s
instructions. The absorbance was measured with a Multi-
scan™ FC microplate photometer (Thermo Fisher Scientifc,
Boston, MA, USA). Cell viability is reported as % of control
(untreated cells). Experiments were performed in triplicate.
Measurement of Collagen in Culture Medium
CCD-986sk cells (4 × 103 cells/well) (passage 12) were
seeded in a 96-well plate and incubated for 24 h. Cells were
treated with peptides in culture media containing 10% FBS
for 72 h. The amount of collagen in the collected culture
media was measured using a Total Collagen Assay Kit (Bio-
Vision, Inc., USA). The absorbance was measured with a
Multiscan™ FC microplate photometer (Thermo Fisher Sci-
entifc, Boston, MA, USA). We calculated the total collagen
concentration in all samples according to the manufacturer’s
procedures. Experiments were performed in triplicate.
In this study, we synthesized a vit C-linker conjugated
peptide and its derivatives. The efects of the vit C-linker
conjugated peptides were determined by measurement of
cell viability, collagen synthesis activity, and the levels of
mRNA and proteins related to genes that control skin col-
lagen synthesis in human skin fbroblast CCD-986sk cells.
These results demonstrated that an ester-bound vit C-succi-
noyl linker conjugated peptide GEKG has potent anabolic
activity toward collagen synthesis in human skin fbroblasts.
This peptide increased the mRNA expression of the gene
related to collagen synthesis as well as total collagen con-
tent released into the medium of skin fbroblasts. Based on
this study, we expect that the use of vit C-linker conjugated
peptides could be a new strategy for the development of
cosmetics or medicinal agents targeting the stimulation of
collagen synthesis in skin.
Quantitative Real‑Time PCR (qRT‑PCR) Analysis
CCD-986sk cells (passage 12) were treated for 72 h with
peptides in culture media containing 10% FBS. Total RNA
was isolated using the AccuPrep® RNA Extraction Kit
(Bioneer Corp., Daejeon, Korea) and the cDNA synthesized
from 1 µg of total RNA using oligo (dT) primers (Bioneer
Corp., Daejeon, Korea) and the RocketScript™ Reverse
Transcriptase Kit (Bioneer Corp., Daejeon, Korea). qRT-
PCR was performed with the ExcelTaq 2X Q-PCR Master
Mix (SMOBiO, Hsinchu, Taiwan) and the CFX96™ Real-
Time System (Bio-Rad, USA). The cycling conditions were
as follows: 95 °C for 3 min followed by 40 cycles at 95
°C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. The primer
sequences used in this study are shown in Table 1. All reac-
tions were run in triplicate, and data were analyzed using the
2−ΔΔCT (Livak and Schmittgen 2001). The internal standard
was GAPDH, and statistical signifcance was determined
Materials and Methods
Materials
Vit C-linker conjugated peptide derivatives (10 mM stock
solution in sterile distilled water) were synthesized by KY
Park, a principal researcher of CHA Meditech Co., Ltd
(Daejeon, Korea). Human skin fbroblast CCD-986sk cells
(KCLB No. 21947) was purchased from Korean Cell Line
Bank. Fetal bovine serum (FBS), Iscove’s Modifed Dulbec-
co’s Medium (IMEM), and antibiotics (100 U/mL penicillin
and 100 µg/mL streptomycin) were purchased from Corning
with the Student’s t-test with GAPDH-normalized 2−ΔΔC
T
values (Livak and Schmittgen 2001).
1 3

International Journal of Peptide Research and Therapeutics
Table 1 Sequences of primers
Target gene
Forward (5′–3′)
Reverse (5′–3′)
used in this study.
COL1A1
ELN
CTGGGGCAAGACAGTGATTG
CAAGACCTGGCTTCGGATTG
TGACTTTCCTGGAATTGGCC
GAGTCAACGGATTTGGTCGT
GGGTTCAGTTTGGGTTGCTT
TTTCCTTGCCCTGTGGATCT
TTTCCTGCAGTTGAACCAGC
GATCTCGCTCCTGGAAGATG
MMP-1
GAPDH
mixture was stirred for 4 h and the organic layer was washed
with brine (X2) and dried over Na2SO4. The solution was
evaporated and purifed by silica gel fash column chroma-
tography to obtain a vitamin C derivative (4). Preparation
of vitamin C derivative (6); A solution of vitamin C deriva-
tive (3) (20 mmol) in CH3CN (80 mL) was added K2CO3
(30 mmol, 1.5 equiv.). After stirring for 10 min, methyl
bromo acetate (80 mmol, 4 equiv.) was added. The result-
ing mixture was heated at 60 °C for 4 h, and the solvent was
removed under reduced pressure. The residue was treated
with brine and extracted with EtOAc. The organic layer
was concentrated in vacuo and purifed by silica gel fash
column chromatography to obtain a vitamin C derivative
(5). To a solution of vitamin C derivative (5) (16 mmol) in
THF was added MeOH:H2O=1:1:1 (v/v/v, 60 mL) K2CO3
(64 mmol, 4 equiv.). Stir at room temperature for 4 h. The
mixture solution was concentrated and washed with EtOAc.
The aqueous layer was acidifed with 2N HCl and extracted
with IPA:CH2Cl = 1:3 (v/v) (× 3). The organic layer was
concentrated in vacuo and purifed by silica gel fash column
chromatography to obtain a vitamin C derivative (6).
Statistical Analysis
Data are presented as the mean SD of at least three inde-
pendent experiments. Signifcant diferences were evaluated
by the one-way ANOVA with post-hoc Tukey HSD Test,
with comparisons indicated as follows: #P<0.01 (versus the
control) and *P<0.05; **P<0.01 (versus cells treated with
A.A alone).
Results
Synthesis of Vitamin C‑Conjugated Peptide
Derivatives
For the synthesis of vitamin C-conjugated peptides
(10a‒10g), the vitamin C derivatives (4, 6) were synthesized
through 2 processes (Scheme 1). The Vitamin C derivatives
(4) and (6) were synthesized by sequential 5,6-O-isopro-
pylidination (2), 3-O-benzylation (3), 2-O-succinylation (4)
and 2-O-alkylation (5), and a fnal basic hydrolysis (6).
Preparation of vitamin C derivative (4); Succinic anhy-
dride (22 mmol, 1.5 equiv.) was added to a solution of
vitamin C derivative (3) (20 mmol) and DMAP (30 mmol,
1.5 equiv.) in CH2Cl2 (80 mL) at room temperature. The
The peptide (7a‒7e) bound to the 2-Cl-trityl resin was
prepared by the Fmoc solid phase peptide synthesis (SPPS)
method in the presence of HOBt and HBTU (Scheme 2).
Vitamin C conjugated peptides (8a‒8e) with vitamin C
Scheme 1 Synthesis of l-ascorbic acid derivatives
1 3

International Journal of Peptide Research and Therapeutics
Scheme 2 Solid phase synthesis of l-ascorbic acid-peptide conjugates
derivative 4 and collagen stimulating peptides (7a‒7e) in
the form of an ester bond were synthesized by method A
(Scheme 2). Also, vit C conjugated peptides (8f, 8g) in the
carbamate and ether forms were synthesized by methods B
and C. In particular, the carbonyl imidazole group was intro-
duced into the peptide binding resin (7f) as a CDI (1,1′-car-
bonyldiimidazole) reagent, and then a vitamin C derivative
(3) was added to synthesize 8f. Vit C-conjugated derivatives
(9a‒9g) were obtained by separating them from the resin
with TFA/H2O (95:5 = v/v). Finally, 3-O-dibenzylation in
the presence of Pd/C provided the desired vitamin C-conju-
gated peptides (10a‒10g) (Scheme 2). Detailed characteri-
zation of vit C-conjugated peptides are described in Figs.
S1‒S14.
no signifcant cytotoxicity was observed with any of the ester
bonded vit C-succinoyl linker conjugated peptide deriva-
tives, even when the treatment concentration was increased
to 1 mM.
The Ester Bonded Vit C‑GEKG Derivatives Stimulated
Collagen Synthesis in Human Skin Fibroblasts
Collagen, as one of the major substrates in the extracellular
matrix, is produced in the skin fbroblasts. The roles of col-
lagen include mechanical durability of the skin, resistance
of connective tissues, binding force of tissues, support of
cell adhesion, and induction of cell division and diferentia-
tion (Al-Niaimi and Chiang 2017; Pullar et al. 2017). Since
wrinkle formation is related to the amount of collagen in
the skin, materials promoting collagen synthesis can be
used as components for cosmetics that function by improv-
ing wrinkles and creating more elastic skin (Duarte et al.
2009). Collagens (type I, II, III, IV, and V) are synthesized
in the form of a precursor called pro-collagen containing
propeptide sequences at the N-terminal and C-terminal. The
collagen polymerization reaction is initiated with cutting and
separation of fbrils from the collagen molecule (Uitto and
Vit C‑Linker Conjugated Peptide Derivatives Do Not
Show Cytotoxicity in Human Skin Fibroblasts
First, we examined the cytotoxicity of ester bonded vit
C-succinoyl linker conjugated peptide derivatives 10a‒10g
(Schemes 1, 2) in CCD-986sk cells to determine if ester
bonded vit C-succinoyl linker conjugated peptide derivatives
afected cell proliferation. As shown in Fig. 1 and Table S1,
1 3

International Journal of Peptide Research and Therapeutics
Fig. 1 The efect of Vit C-linker
conjugated peptides on the
viability of CCD-986sk cells.
CCD-986sk cells were treated
with vit C-linker conjugated
peptides for 72 h. Cell viability
was evaluated using the CCK-8
assay. Detailed experimental
procedures are described in
the Materials and Methods.
Experiments were performed in
triplicate
Lichtenstein 1976; Parftt et al. 1987). Therefore, the level
of collagen biosynthesis can be determined by the meas-
urement of the propeptide levels in cell culture medium.
To determine the efect of the type of bond between vit C
and the peptide derivatives on the production of collagen in
cell culture medium, we measured the total collagen con-
tents in cell culture supernatants of CCD-986sk cells. As
shown in Fig. 2a, among the ester bonded vit C and peptide
Fig. 2 The ester bonded vit
C-GEKG stimulates the synthe-
sis of collagen in CCD-986sk
cells. a and b CCD-986sk cells
were seeded on 96-well plates
for 24 h. a After incubation,
cells were treated with indicated
concentrations of peptide
derivatives linked by an ester
bond for 72 h. b CCD-986sk
cells were treated with Vit
C-GEKG conjugated derivatives
containing either an ether link-
age (10g) or a carbamate link-
age (10f) for 72 h. Relative total
collagen concentration of each
well was measured by Total
Collagen Assay Kit (Biovision,
USA). Ascorbic acid (A.A)
was used as a positive control.
Data represents mean SD.
Experiments were performed
in triplicate. #P<0.01 (versus
the control) and *P<0.05;
**P<0.01 (versus cells treated
with A.A alone)
1 3

International Journal of Peptide Research and Therapeutics
derivatives, the GEKG- and AHK-conjugated groups, 10d
and 10e, had a greater stimulating efect on collagen synthe-
sis than did ascorbic acid (A.A) alone in CCD-986sk cells.
Especially, the ester bonded vit C-succinoyl linker-GEKG
showed a greater collagen synthesis stimulating efect com-
pared to other peptide conjugated groups. We also investi-
gated if the type of bonding, either with an ether bond or
a carbamate bond, had an efect on collagen production in
skin fbroblasts. We compared derivatives with mini-PEG
linkers and the combination of A.A and the peptide GEKG.
As shown in Fig. 2b, ether bonded vit C-GEKG (10g) and
carbamate bonded vit-GEKG (10f) did not show any sig-
nifcant increase in total collagen content. In addition, the
GEKG peptide alone and in combination with A.A showed
similar collagen stimulating efects compared to the fbro-
blasts treated with only A.A. These result indicate that an
ester bond between vit C and GEKG can be more easily
separated than ether or carbamate bonds and that vit C and
GEKG can exert a stronger stimulatory efect on collagen
synthesis fbroblast cells.
The Ester Bonded Vit C‑GEKG Upregulates the mRNA
and Protein Expression of Genes Related to Skin
Wrinkle Formation
Collagen accounts for about 90% of the connective tis-
sue and is degraded by collagenase (Soo Lee et al. 2003).
Among the major collagenases, the expression of matrix
metalloproteinase (MMP) results in the degradation of type
I collagen which infuences skin wrinkle formation and
aging through the decrease of collagen content (Shin et al.
2019). Elastin is also a component of the connective tissue
with collagen which provides the strength of the crosslink
between the elastic fbers in dermal ECM (Uehara et al.
2017). Using real-time PCR and western blot analysis, we
further investigated whether the ester bonded vit C-GEKG
(10d) or –AHK (10e) could infuence the transcription of
mRNA of collagen I, elastin, and matrix metalloproteinase-1
(MMP-1) in CCD-986sk cells. As shown in Fig. 3a and b,
the treatment of GEKG-conjugated group (10d) increased
the mRNA expression of COL1A1 and ELN. In particular,
the 10d treated group showed the more enhanced COL1A1
mRNA expression compared to A.A alone at 1000 µM.
However, ether bonded vit C-GEKG (10g) and carbamate
bonded vit-GEKG (10f) did not increase the mRNA expres-
sion of COL1A1 and ELN compared to A.A (Fig. S15). In
addition, the mRNA expression of MMP-1 was inhibited
by 10d or 10e (Table 2). This result indicated that the ester
bonded vit C-GEKG derivatives had a stimulatory efect on
the mRNA transcriptional activity via genes related to con-
nective tissue formation in skin fbroblasts, and that these
efects exceeded the results from treatment with only A.A.
Fig. 3 The ester bonded vit C-GEKG enhances the mRNA expression
of collagen synthesis related genes. CCD-986sk cells were treated
with A.A or 10d or 10e for 72 h. The mRNA expression levels of
each gene were measured by qRT-PCR analysis, with GAPDH used
as an internal control. Detailed experimental procedures are described
in the Materials and Methods. Experiments were performed in tripli-
#
cate. P<0.01 (versus the control) and *P<0.05; **P<0.01 (versus
cells treated with A.A alone)
Table 2 Fold changes of gene expression in CCD-96sk cells
Compound name
Conc. (µM) COL1A1 ELN
MMP-1
Ascorbic acid (A.A)
100
1000
100
1000
100
7.43
9.84
9.16
14.96
6.68
7.97
6.31 0.35
10.10 0.14
9.00 0.31
9.81 0.16
6.96 0.25
9.30 0.18
10d
10e
1000
1 3

International Journal of Peptide Research and Therapeutics
of skin cells. Several reports investigated the therapeutic
potential of peptides as a modulator in skin regeneration
and tissue remodeling (Pickart 2008; Gorouhi and Mai-
bach 2009; Pickart et al. 2015). Our results also provide
useful information for the development of cosmetics or
skin regeneration relating products using ester bonded
vit C-linker conjugated peptides or derivatives as well as
treatment of connective tissue reducing diseases.Here, we
synthesized and evaluated the bioactivity of vit C-linker
conjugated peptide derivatives through examination of
collagen synthesis activity and expression of collagen
synthesis related genes in skin fibroblasts. Recently,
the ester-bonded vit C-GEKG (10d) has been patented
under the trade name CHA-Vitatide C (Korea patent No.
40-2019-0045398). Although we confrmed the activation
of collagen synthesis and the related gene expression of
ester-bonded vit C-GEKG, the detailed mechanism of col-
lagen synthesis and subsequent signaling pathways should
also be studied. We will also apply the ester-bonded vit
C-GEKG to skin aging prevention products such as cos-
metics and medical supplies to evaluate the efects of
stimulating collagen synthesis.
Discussion
Previous reports showed that vit C-linker conjugated pep-
tides exert antioxidant and stimulating efects on collagen
synthesis and cell proliferation of human dermal fbro-
blasts (Choi et al. 2009; Stamford 2012). In our recent
study, the vit C-linker conjugated tripeptide AHK showed
osteogenic efects in BMP-2-induced osteoblast difer-
entiation of C2C12 cells (Jung et al. 2018). Vit C-linker
conjugated tripeptide AHK exerted a synergistic efect on
BMP-2-induced expression of alkaline phosphatase (ALP)
and osteogenic genes through the activation of Smad- and
non-Smad signaling pathways. Especially, combination of
the separated forms vit C and AHK showed no signifcant
cytotoxicity, and they did not promote viability and osteo-
blast diferentiation. Based on these results, we thought
that the conjugated form of vit C-linker-AHK may afect
the signal transduction associated with infltration into the
osteoblast. Thus, in the present study, we compared the
efects of linker bond types such as the ester bond, ether
bond, and carbamate bond between vit C and the peptide to
determine the bioactivity of vit C-linker conjugated pep-
tides in human cells. Linkers of succinoyl and mini-PEG
were used for the connection. We predicted that the nature
of the binding type would afect the collagen synthesis in
human skin fbroblasts.
Acknowledgements The present research was supported by the
research fund of Dankook University in 2019.
Compliance with Ethical Standards
First, we examined the cytotoxicity of vit C-linker con-
jugated peptide derivatives. Vit C-linker conjugated pep-
tide derivatives did not show cytotoxicity at 11000 µM in
skin fbroblasts. We also measured the amount of synthe-
sized collagen generated by peptide treated skin fbroblasts.
Among the ester bonded succinoyl linker conjugated peptide
derivatives, the GEKG-bound group showed increased total
collagen content as compared to that of the A.A alone group.
In addition, ester bonded vit C-succinoyl linker-GEKG stim-
ulated the mRNA expression of genes related to connective
tissue formation. Mini-PEG linkers were also used to test
the efects of binding type changes between vit C and pep-
tide GEKG on the ether bond (10g) or the carbamate bond
(10f), and the combination of vit C and GEKG. The change
of binding types did not increase total collagen contents
compared to the A.A alone group and the combination of
A.A and GEKG similarly activated the collagen synthesis
with the A.A or GEKG alone group. The strength of the
ester bond between vit C and peptide GEKG is relatively
weak compared to an ether bond and a carbamate bond. This
means that the ester bond between vit C and GEKG can be
more easily separated than ether or carbamate bonds and
that vit C and GEKG can exert enhanced collagen synthesis
stimulating efects in skin fbroblasts.
Conflict of interest All authors declare that they have no confict of
interest.
Ethical Approval This study was carried out through the cultivation of
an existing cell line, and no animals or no human specimens were used.
References
Al-Niaimi F, Chiang NYZ (2017) Topical vitamin C and the skin:
mechanisms of action and clinical applications. J Clin Aesthet
Dermatol 10:14–17
Choi HI, Kim HJ, Park JI, Shin EH, Kim DW, Kim SS (2009) Design
and efcient synthesis of novel ascorbyl conjugated peptide with
high collagen biosynthesis stimulating efects. Bioorg Med Chem
Lett 19:2079–2082
Davidson JM, LuValle PA, Zoia O, Quaglino D Jr, Giro M (1997)
Ascorbate diferentially regulates elastin and collagen biosynthe-
sis in vascular smooth muscle cells and skin fbroblasts by pre-
translational mechanisms. J Biol Chem 272:345–352
Duarte TL, Cooke MS, Jones GD (2009) Gene expression profling
reveals new protective roles for vitamin C in human skin cells.
Free Radic Biol Med 46:78–87
Geesin JC, Darr D, Kaufman R, Murad S, Pinnell SR (1988) Ascorbic
acid specifcally increases type I and type III procollagen mes-
senger RNA levels in human skin fbroblast. J Invest Dermatol
90:420–424
Many studies suggest that short peptides can exert
activating efects on the proliferation and diferentiation
Gorouhi F, Maibach HI (2009) Role of topical peptides in preventing
or treating aged skin. Int J Cosmet Sci 31:327–345
1 3

International Journal of Peptide Research and Therapeutics
Humbert PG, Haftek M, Creidi P, Lapière C, Nusgens B, Richard
A, Schmitt D, Rougier A, Zahouani H (2003) Topical ascorbic
acid on photoaged skin. Clinical, topographical and ultrastruc-
tural evaluation: double-blind study vs. placebo. Exp Dermatol
12:237–244
Pickart L, Vasquez-Soltero JM, Margolina A (2015) GHK pep-
tide as a natural modulator of multiple cellular pathways in
skin regeneration. Biomed Res Int 2015:648108. https://doi.
org/10.1155/2015/648108
Pihlajaniemi T, Myllylä R, Kivirikko KI (1991) Prolyl 4-hydroxylase
and its role in collagen synthesis. J Hepatol 13:S2–S7
Pullar JM, Carr AC, Vissers MCM (2017) The roles of vitamin C in
skin health. Nutrients 9:866
Jung JI, Park KY, Lee Y, Park M, Kim (2018) Vitamin C-linker-con-
jugated tripeptide AHK stimulates BMP-2-induced osteogenic
diferentiation of mouse myoblast C2C12 cells. Diferentiation
101:1–7
Sauermann K, Jaspers S, Koop U, Wenck H (2004) Topically applied
vitamin C increases the density of dermal papillae in aged human
skin. BMC Dermatol 4(1):13
Kivirikko KI, Myllylä R, Pihlajaniemi T (1989) Protein hydroxyla-
tion: prolyl 4-hydroxylase, an enzyme with four cosubstrates and
a multifunctional subunit. FASEB J 3:1609–1617
Shin EJ, Jo S, Choi HK, Choi S, Byun S, Lim TG (2019) Cafeic
acid phenethyl ester Inhibits UV-induced MMP-1 expression by
targeting histone acetyltransferases in human skin. Int J Mol Sci
20:3055
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expres-
sion data using real-time quantitative PCR and the 2(-Delta Delta
C(T)), method. Methods 25:402–408
Loren et al (1987) US Patent 4665:054
Soo Lee Y, Jin DQ, Beak SM, Lee ES, Kim JA (2003) Inhibition of
ultraviolet-A-modulated signaling pathways by asiatic acid and
ursolic acid in HaCaT human keratinocytes. Eur J Pharmacol
476:173–178
Miller RL, Elsas LJ, Priest RE (1979) Ascorbate action on normal
and mutant human lysyl hydroxylases from cultured dermal fbro-
blasts. J Invest Dermatol 72:241–247
Nusgens BV, Humbert P, Rougier A, Colige AC, Haftek M, Lambert
CA, Richard A, Creidi P, Lapière CM (2001) Topically applied
vitamin C enhances the mRNA level of collagens I and III, their
processing enzymes and tissue inhibitor of matrix metallopro-
teinase 1 in the human dermis. J Invest Dermatol 116:853–859
Parftt AM, Simon LS, Villanueva AR, Krane SM (1987) Procollagen
type I carboxy-terminal extension peptide in serum as a marker of
collagen biosynthesis in bone. Correlation with Iliac bone forma-
tion rates and comparison with total alkaline phosphatase. J Bone
Miner Res 2:427–436
Stamford NP (2012) Stability, transdermal penetration, and cutaneous
efects of ascorbic acid and its derivatives. J Cosmet Dermatol
11:310–317
Uehara E, Hokazono H, Hida M, Sasaki T, Yoshioka H, Matsuo N
(2017) GABA promotes elastin synthesis and elastin fber forma-
tion in normal human dermal fbroblasts (HDFs). Biosci Biotech-
nol Biochem 81:1198–1205
Uitto J, Lichtenstein JR (1976) Defects in the biochemistry of collagen
in diseases of connective tissue. J Invest Dermatol 66:59–79
Parsons KK, Maeda N, Yamauchi M, Banes AJ, Koller BH (2006)
Ascorbic acid-independent synthesis of collagen in mice. Am J
Physiol Endocrinol Metab 290:E1131–E1139
Publisher’s Note Springer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional afliations.
Peterkofsky B, Udenfriend S (1965) Enzymatic hydroxylation of pro-
line in microsomal polypeptide leading to formation of collagen.
Proc Natl Acad Sci USA 53:335–342
Pickart L (2008) The human tri-peptide GHK and tissue remodeling.
J Biomater Sci Polym Ed 19:969–988
1 3