Two-step enzymatic synthesis of UDP-N-acetylgalactosamine

Article abstract of DOI:10.1016/j.bmcl.2005.08.088

UDP-GalNAc has been synthesised with high yield from GalNAc, UTP and ATP using recombinant human GalNAc kinase GK2 and UDP-GalNAc pyrophosphorylase AGX1. Both enzymes have been prepared in one step from 1 L cultures of transformed Escherichia coli and the UDP-GalNAc produced has been purified by a simple procedure. The method described is a rapid and efficient means to produce UDP-GalNAc as well as analogues like UDP-N-azidoacetylgalactosamine (UDP-GalNAz).

Full text of DOI:10.1016/j.bmcl.2005.08.088

Bioorganic & Medicinal Chemistry Letters 15 (2005) 5459–5462
Two-step enzymatic synthesis of UDP-N-acetylgalactosamine
*
´
Vanessa Bourgeaux, Friedrich Piller and Veronique Piller
´
´
`
´
´
`
Centre de Biophysique Moleculaire CNRS UPR4301 affiliee a lÕUniversite dÕOrleans et a lÕINSERM,
´
rue Charles Sadron, F-45071 Orleans Cedex 02, France
Received 6 June 2005; revised 11 August 2005; accepted 30 August 2005
Available online 3 October 2005
Abstract—UDP-GalNAc has been synthesised with high yield from GalNAc, UTP and ATP using recombinant human GalNAc
kinase GK2 and UDP-GalNAc pyrophosphorylase AGX1. Both enzymes have been prepared in one step from 1 L cultures of trans-
formed Escherichia coli and the UDP-GalNAc produced has been purified by a simple procedure. The method described is a rapid
and efficient means to produce UDP-GalNAc as well as analogues like UDP-N-azidoacetylgalactosamine (UDP-GalNAz).
ꢀ 2005 Elsevier Ltd. All rights reserved.
UDP-GalNAc is the donor substrate of many N-acetyl-
galactosaminyltransferases, enzymes which transfer
GalNAc from the nucleotide sugar to a saccharide or
peptide acceptor. Glycoconjugates synthesised by those
enzymes are of particular interest in therapeutic
approaches which require the production of blood
group or tumour antigens or of glycosaminoglycans.1
Understanding the precise mechanism of action of N-
acetylgalactosaminyltransferases would facilitate the
production of glycans with GalNAc residues crucial
for their biological activity. However, the main limita-
tion to most studies is the limited availability of labelled
sugar nucleotides and of sugar nucleotide analogues and
derivatives due to the difficulty of their synthesis.
NH2-1-P) although with low yield.5 Then the GalNH2-
1-P is purified and can be coupled to UDP chemically2
or enzymatically6 using a yeast UDP-Glc uridyltransfer-
ase. In both cases, the UDP-GalNH2 formed has still to
be chemically N-acetylated and moderate overall yields,
not exceeding 20% of the starting product, are obtained
after purification. Another chemoenzymatic synthesis
was reported from UMP, sucrose, and GalNH2-1-P
through the help of seven enzymes and two cofactors
and a final step of N-acetylation.7 Besides the require-
ment of many enzymes, the overall yield was only
34%. Finally, an enzymatic method using a partially
purified GalNAc kinase (GK2) from pig kidney allowed
GalNAc-1-P formation with good yield.8 But the subse-
quent use of a bacterial GlcNAc pyrophosphorylase
(GlmU) with a poor specificity for GalNAc-1-P gave
only 10% UDP-GalNAc.
UDP-GalNAc can be prepared in several ways. The
pure chemical approach2,3 is long, fastidious and yields
are low. As an alternative, enzymatic biosynthesis
avoids the use of protection and deprotection steps re-
quired for chemical synthesis and circumvents the diffi-
culties inherent to the formation of a pyrophosphate
bond. One of the enzymatic routes used starts from
UDP-GlcNAc which is converted into UDP-GalNAc
by a mammalian Gal-4 epimerase.4 The main drawback
of this method is the rather low yield (30% at the equi-
librium) and the difficulty to separate UDP-GalNAc
from the excess UDP-GlcNAc. Another biosynthetic
route starts from galactosamine and uses yeast moult
galactokinase to form galactosamine-1-phosphate (Gal-
In order to obtain substantial amounts of UDP-Gal-
NAc, we developed a new low-cost strategy easier and
more efficient than the previous ones. Starting from Gal-
NAc, ATP and UTP we combined the activities of three
enzymes. The mammalian GK2 catalyses the phosphor-
ylation of GalNAc using ATP as phosphate donor.
Then, the mammalian UDP-GalNAc pyrophosphory-
lase (AGX1) uses UTP to convert GalNAc-1-P into
UDP-GalNAc. Yeast inorganic pyrophosphatase
(PPA) drives UDP-GalNAc production forward
(Scheme 1) by preventing the reverse reaction.
While PPA is commercially available, the two other en-
zymes have been produced by bioengineering. GK2 of
human or porcine origin had been previously extracted
Keywords: UDP-GalNAc; Enzymatic synthesis.
*
Corresponding author. Tel.: +33 238 257 643; fax: +33 238 257
807; e-mail: pillere@cnrs-orleans.fr
0960-894X/$ - see front matter ꢀ 2005 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmcl.2005.08.088

5460
V. Bourgeaux et al. / Bioorg. Med. Chem. Lett. 15 (2005) 5459–5462
Table 1. Km of the recombinant enzymes
2Pi
PPi
UTP
ATP
ADP
PPA
Km (mM)
Specific activity (nmol/lg/min)
+
Mg2
+
Mg2
GK2
AGX1
0.22 (0.14)10
0.67 (1.1)12
1.80 (1.40)10
29.0 (14.9)12,13
UDP-GalNAc
GalNAc
GalNAc-1-P
GK2
AGX1
Values from the literature are in parentheses.
Scheme 1. Two-step enzymatic synthesis of UDP-GalNAc.
chromatography. The optimal quantity of PPA was
determined to be 2 U/mL. Another adjustment was nec-
essary due to the difference in Km values (Table 1).
Experiments presented in Figure 2 indicate that the opti-
mal concentration of GalNAc engaged in the mixture is
3 mM. In addition, we determined optimal quantities of
enzymes for maximal formation of UDP-GalNAc in 6 h:
0.8 lg/mL AGX1 and 6.0 lg/mL GK2.
from tissues or expressed in Saccharomyces cerevisiae.9–11
In this study, we expressed the GK2 of human origin
in Escherichia coli as a tagged protein which allows its
rapid and efficient purification. For AGX1, previous
studies had established that addition of a tag to the re-
combinant form of the enzyme reduced its activity and
expression without tag imposed the use of several protein
purification steps.12–14 Here, we describe the expression
of AGX1 in E. coli as a tagged protein which is as active
as the enzyme isolated from tissues and which was easily
purified through its tag.
Finally, we evaluated optimal concentrations of other
substrates and found out that 3 mM GalNAc, 3 mM
ATP and 3 mM UTP were the lowest concentrations re-
quired to obtain after purification maximal amounts of
UDP-GalNAc. Apparition kinetics of UDP-GalNAc
under those conditions are presented in Figure 3. A
2 mL production of UDP-GalNAc was performed start-
ing from 1.33 mg GalNAc.18 Both purified enzymes
were incubated with substrates, necessary cofactors
and PPA for 6 h. After a two-step purification by ion ex-
change and gel filtration, the pure desired product,
UDP-GalNAc ammonium salt, was characterised by
mass spectrometry and NMR spectroscopy.19
Both cDNAs encoding the enzymes GK2 and AGX1
were cloned into a high expression plasmid, the proteins
were expressed in E. coli and purified by Ni-NTA affin-
ity chromatography.15 SDS-PAGE (Fig. 1) and Western
blot analysis (not shown) confirmed that the main pro-
teins obtained after purification were the expected ones
with an apparent molecular weight of 57 kDa for GK2
and of 61 kDa for AGX1. From 1 L cultures we ob-
tained 2.2 mg GK2 (82% purity) and 3.4 mg AGX1
(70% purity).
Enzymatic assays16 indicated that the specific activities
of the recombinant enzymes and the Km values for sub-
strates were close to those described in the litera-
ture10,12,13 for the enzymes purified from tissues (Table
1). Both enzymes were kept at 0.5 mg/mL in a buffered
(pH 7.5) solution containing 30% glycerol and showed
no loss of activity after one year at ꢀ20 ꢁC.
50
40
30
20
1
The purified GK2 and AGX1 enzymes were used to syn-
thesise in one-pot UDP-GalNAc from GalNAc, ATP
and UTP. Small-scale assays were first performed to
optimise the reaction.17 The reaction catalysed by
AGX1 being reversible, addition of PPA was necessary
to drive the synthesis in the forward direction and to
reach maximum yield (68 10%) after ion exchange
0
0
1 2 3 4 5 6 7 8 9
GalNAc (mM)
Figure 2. Kinetics of GalNAc-1-P (open squares) and UDP-GalNAc
(filled squares) production as a function of GalNAc concentration.
70
60
UDP-GalNAc
50
40
30
20
10
0
GalNAc
6
GalNAc-1-P
0
2
4
8
10
Figure 1. Coomassie-stained gel after SDS-PAGE of the soluble
proteins extracted from transformed bacteria by gentle lysis (lanes 1
and 3) and purified on Ni-NTA resin (lanes 2 and 4). Lanes 1 and 2:
GK2; lanes 3 and 4: AGX1.
Incubation time (h)
Figure 3. Time kinetics of UDP-GalNAc (filled squares) and GalNAc-
1-P (open squares) formation and of GalNAc consumption (triangles).

V. Bourgeaux et al. / Bioorg. Med. Chem. Lett. 15 (2005) 5459–5462
5461
2. Moffat, J. G.; Khorana, H. G. J. Am. Chem. Soc. 1958, 80,
3756.
3. Lazarevic, D.; Thiem, J. Carbohydr. Res. 2002, 337, 2187.
4. Piller, F.; Eckhardt, A. E.; Hill, R. L. Anal. Biochem. 1982,
127, 171.
5. Carlson, D. M.; Swanson, A. L.; Roseman, S. Biochem-
istry 1964, 47, 402.
6. Heidlas, J.; Lees, J. W.; Whitesides, G. M. J. Org. Chem.
1992, 57, 152.
In order to test whether this enzymatic synthesis was
applicable to GalNAc derivatives, we chose N-azi-
doacetylgalactosamine (GalNAz)20 as starting sub-
strate since it was recently used to enable the
detection in the cells of mucin type GalNAc-bearing
glycoproteins.21 First, we determined the Km of GK2
for GalNAz to be 0.50 mM,16 a value in the same or-
der of magnitude as for GalNAc (0.22 mM). Under
the conditions described above18 GalNAz was very
efficiently converted into UDP-GalNAz (99% yield).
Previous studies had suggested21 that GalNAz was
processed in cells by the hexosamine salvage pathway
enzymes.11 Here, we provide evidence that GalNAz
and GalNAz-1-P, respectively, are substrates for
GK2 and AGX1 in vitro.
7. Bulter, T. C. W.; Elling, L. Carbohydr. Res. 1997, 305, 469.
¨
8. Sunthankar, P.; Pastuszak, I.; Rooke, A.; Elbein, A. D.;
van de Rijn, I.; Canfield, W. M.; Drake, R. R. Anal.
Biochem. 1998, 258, 195.
9. Lee, R. T.; Peterson, C. L.; Calman, A. F.; Herskowitz, I.;
OÕDonnell, J. J. Proc. Natl. Acad. Sci. U.S.A. 1992, 89,
10887.
10. Pastuszak, I.; Drake, R.; Elbein, A. D. J. Biol. Chem.
1996, 271, 20776.
The paper describes an efficient method for the enzymat-
ic synthesis of UDP-GalNAc (68 10%) from the inex-
pensive substrates GalNAc, ATP and UTP. With the
amount of enzymes isolated after 1 L E. coli cultures,
it is possible to obtain up to 500 mg of UDP-GalNAc.
The method proposed here was also successfully em-
ployed on GalNAz, showing that both GK2 and
AGX1 can accept substrates with modified N-acyl
groups. Surprisingly, GalNAz appeared to be an excel-
lent substrate for the three-enzyme system. Considering
the Km value of GK2 for GalNAz and the high specific-
ity of this enzyme for GalNAc, AGX1 must be respon-
sible for the high conversion into UDP-GalNAz
suggesting a broad acceptance for this latter enzyme.
Procedures using the same enzymatic system for the syn-
thesis of other UDP-GalNAc analogues are currently
under investigation. The same efficient method was also
applied to the synthesis of radioactive UDP-GalNAc, a
very useful substrate for enzymatic tests of N-acetyl-
galactosaminyltransferases and which is no longer com-
mercially available. By this procedure we have produced
[3H]-labelled UDP-GalNAc with the same overall yield
using [3H]GalNAc. It is noteworthy that the method
presented here offers, for the synthesis of radioactive
UDP-GalNAc, an appreciable alternative to a pure
chemical approach.
11. Pastuszak, I.; OÕDonnell, J.; Elbein, A. D. J. Biol. Chem.
1996, 271, 23653.
12. Szumilo, T.; Zeng, Y.; Pastuszak, I.; Drake, R.; Szumilo,
H.; Elbein, A. D. J. Biol. Chem. 1996, 271, 13147.
13. Wang-Gillam, A.; Pastuszak, I.; Elbein, A. D. J. Biol.
Chem. 1998, 273, 27055.
14. Peneff, C.; Ferrari, P.; Charrier, V.; Taburet, Y.; Monnier,
C.; Zamboni, V.; Winter, J.; Harnois, M.; Fassy, F.;
Bourne, Y. Embo J. 2001, 20, 6191.
15. DNAs encoding human GK2 and AGX1 were obtained
from Open Biosystems. The complete coding sequences
were amplified by PCR in order to create BamHI
restriction sites in 50 and 30 ends of both inserts. For
GK2 the primers used were 50GGATCCAATGGCTAC
AGAGAGCCCTG30, sense and 50GGATCCGGCCTC
AAGCAAAACC30, antisense. For AGX1 the primers
used were 50CGGGATCCAATGAACATTAATGACC
TCAAACTCCG30, sense and 50GCGGATCCTT
CAAATACCATTTTTCACCAGCTCATG30, antisense.
The PCR products were digested by BamHI, purified
and ligated into a similarly digested pTrcHisB vector
(Invitrogen). The resulting plasmids were used to trans-
form E. coli ER 2566 (NEB) for GK2 and RosettaTM
(Novagen) for AGX1. Selected clones were grown in
SOB medium at 37 ꢁC for GK2 and 15 ꢁC for AGX1 until
the OD 600 nm reached 0.5–0.8. Then, recombinant
protein syntheses were induced by addition of 0.5 mM
(for AGX1) or 1 mM (for GK2) IPTG and cells were
allowed to grow for an additional 5 h for GK2 and 23 h
for AGX1. The pellets obtained after centrifugation were
lysed in 2.5 mL/g pellet Y-PER plusTM (Pierce) containing
1 mM PMSF, 5 lg/mL DNAse, 10 lg/mL RNAse, and
0.5 mM DTT. After shaking at room temperature for
Acknowledgments
This work was supported by grants from the Ligue
20 min and centrifugation,
a second extraction was
´
´
Nationale contre le Cancer (comites departementaux
du Loiret et du Loir et Cher), the Centre National de
performed on the pellets. 6His-tagged recombinant pro-
teins recovered in the lysis supernatants were isolated by
affinity chromatography on Ni-NTA superflow beads
(Qiagen) after a 3-fold dilution in 50 mM sodium phos-
phate, pH 8.0, 300 mM NaCl, 10 mM imidazole, and
0.5 mM DTT (buffer A). After incubating for 2 h with the
beads at 4 ꢁC and three washes with buffer A, the proteins
were eluted with 250 mM imidazole, pH 7.0, 0.5 mM
DTT.
´
la Recherche Scientifique: Proteomique et Genie des
Proteines and by the Groupement de Recherche: Geno-
´
´
´
´
´
mique et Genie des Glycosyltransferases. The award of a
fellowship to V.B. by the Region Centre and the CNRS
´
is gratefully acknowledged. The authors wish to thank
´
N. Bureaud for expert technical assistance, C. Bure for
MS spectra and H. Meudal for NMR spectra.
16. GK2 assays: unless otherwise stated, all products were
purchased from Sigma–Aldrich. Reaction mixtures
(25 lL) contained [3H]GalNAc (American Radiolabeled
Chemicals) adjusted to 1 mM and 1300 cpm/nmol, 5 mM
ATP, 5 mM MgCl2, 0.1 g/100 mL (0.1%) BSA and various
amounts of GK2 in 75 mM Tris–HCl, pH 8.8. After
15 min at 37 ꢁC, samples were diluted with 700 lL water/
methanol 50:50 and applied to a 0.5 mL DOWEX 1 · 8
References and notes
1. Varki, A.; Cummings, R.; Esko, J.; Freeze, H.; Hart, G.;
Marth, J. In Essentials of Glycobiology; Cold Spring
Harbor Lab Press: New York, 1999.

5462
V. Bourgeaux et al. / Bioorg. Med. Chem. Lett. 15 (2005) 5459–5462
anion exchange column. The column was washed with
various amounts of GK2 and AGX1 in 75 mM Tris–HCl,
pH 8.8. After 2 h, samples were diluted with water/
methanol 50:50 and applied to DOWEX 1 · 8, the column
washed with 25 mM NH4HCO3 (3 · 1.5 mL) to remove
unbound material, non-reacted GalNAc-1-P was eluted
with 100 mM NH4HCO3 and UDP-GalNAc with 300 mM
NH4HCO3.
25 mM NH4HCO3 (3 · 1.5 mL) to remove unbound
material, and then GalNAc-1-P was eluted with 250 mM
NH4HCO3 (3 · 1.5 mL). All fractions were analysed by
scintillation counting. For GalNAc-1-P preparation, the
same protocol as above was scaled up to 23 mL with
nonradioactive GalNAc; after DOWEX, fractions were
pooled, concentrated and applied to a gel filtration column
on G10 Sephadex (Amersham) gel (60 mL, flow rate
30 mL/h) before NMR analysis: GalNAc-1-P (53%,
3.59 mg). 1H NMR (500 MHz, D2O) d: 5.46 (dd; 1H;
JH-1,P = 7.5; J1,2 = 3.5; H-1); 4.205 (ddd; 1H; J2,3 = 11.0;
J2,P = 2.3; H-2); 4.155 (ddd; 1H; J5,6a = 7.5; J5,6b = 5.1; H-
5); 4.04 (d; 1H; J4,3 = 3.0; H-4); 3.96 (dd; 1H; J3,2 = 11.0;
J3,4 = 3.0; H-3); 3.785 (dd; 1H; J6a,6b = 11.9; J6a,5 = 7.5; H-
6a); 3.745 (dd; 1H; J6b,6a = 11.8; J6b,5 = 5.0; H-6b); 2.09 (s;
3H; CH3). For Km calculation, 70 ng of GK2 was used
with 5 mM ATP and various amounts of GalNAc from
25 lM to 1400 lM in 25 lL total volume. The same
method was used with GalNAz but with [32P]ATP
(Amersham). All assays were performed in triplicate.
AGX1 assays: reaction mixtures (25 lL) contained
[3H]UTP (ARC) adjusted to 4 mM and 250 cpm/nmol,
5 mM GalNAc-1-P, 5 mM MgCl2, 0.1% BSA and various
amounts of AGX1 in 75 mM Tris–HCl pH 8.8. After
30 min at 37 ꢁC, the samples were diluted with water/
methanol 50:50 and applied to DOWEX 1 · 8 as described
for GK2, except that UDP-GalNAc was eluted with
300 mM NH4HCO3 (10 · 1.5 mL) and non-reacted UTP
with 1 M NH4HCO3. All fractions were analysed by
scintillation counting. For Km calculations, 1.6 lg of
enzyme was used with 4 mM UTP and various amounts of
GalNAc-1-P from 0.275 mM to 6.6 mM in 25 lL total
volume. All assays were performed in triplicate.
18. For UDP-GalNAc synthesis a 2 mL reaction mixture
contained 3 mM GalNAc, 3 mM UTP, 3 mM ATP,
5 mM MgCl2, 0.1% BSA, GK2 (12 lg), AGX1 (1.6 lg)
and PPA (4 U) in 75 mM Tris–HCl, pH 8.8. The
reaction was left at 37 ꢁC for 6 h, stopped by addition
of methanol/water 50:50 (13 mL) and applied to DOW-
EX 1 · 8 (4 mL). After extensive washing first with
25 mM then with 100 mM NH4HCO3, UDP-GalNAc
was eluted with 300 mM NH4HCO3. After evaporation,
the sample was applied to a gel filtration column as
described in Ref. 16. Detection was performed by
absorbance reading at 260 nm.
19. UDP-GalNAc ammonium salt (68%, 2.62 mg). 1H
00 00
NMR (500 MHz, D2O) d: 7.96 (d; 1H; J6 ,5 = 8.1; H-
600); 5.98 (d; 1H; J1 ,2 = 4.8; H-10); 5.97 (d; 1H;
0
0
00
00 00
J5 ,6 = 8.1; H-5 ); 5.55 (dd; 1H; JH-1,P = 7.3; J1,2 = 3.3;
H-1); 4.45–4.3 (m; H-20; H-30); 4.3–4.16 (m; H40;
H50a; H50b; H2; H5); 4.05 (br d; 1H; J = 2.1; H-4);
3.97 (dd; 1H; J3,2 = 10.9; J3,4 = 3.0; H-3); 3.78 (dd; 1H;
J6a,6b = 11.8; J6a,5 = 7.3; H-6a); 3.73 (dd; 1H;
J6a,6b = 11.8; J6b,5 = 5.2; H-6b); 2.09 (s; 3H; CH3); MS
(ESI): (M+H)+, 608.13; (M+NH4)+, 625.25; (M+Na)+,
630.5; (M+K)+, 646.00.
20. GalNAz was synthesised according to Ref. 21. For UDP-
GalNAz formation, the same conditions were used as for
UDP-GalNAc.18 UDP-GalNAz was characterised directly
from the 25 lL reaction mixture after protein precipitation
in MeOH/H2O 50:50 by mass spectroscopy. MS (ESI):
(MꢀH)ꢀ 647.08.
17. Combined GK2-AGX1 assays: optimisation tests were
performed at 37 ꢁC. Reaction mixtures (25 lL) contained
[3H]GalNAc (3 mM, 50 cpm/nmol), 5 mM ATP, 4 mM
UTP, 5 mM MgCl2, 0.1% BSA, yeast PPA (0.05 U) and
21. Hang, H. C.; Yu, C.; Kato, D. L.; Bertozzi, C. R. Proc.
Natl. Acad. Sci. U.S.A. 2003, 100, 14846.