Product-oriented chemical surface modification of a levansucrase (SacB): Via an ene-type reaction

Article abstract of DOI:10.1039/c8sc01244j

Carbohydrate processing enzymes are sophisticated tools of living systems that have evolved to execute specific reactions on sugars. Here we present for the first time the site-selective chemical modification of exposed tyrosine residues in SacB, a levansucrase from Bacillus megaterium (Bm-LS) for enzyme engineering purposes via an ene-type reaction. Bm-LS is unable to sustain the synthesis of high molecular weight (HMW) levan (a fructose polymer) due to protein-oligosaccharide dissociation events occurring at an early stage during polymer elongation. We switched the catalyst from levan-like oligosaccharide synthesis to the efficient production of a HMW fructan polymer through the covalent addition of a flexible chemical side-chain that fluctuates over the central binding cavity of the enzyme preventing premature oligosaccharide disengagement.

Full text of DOI:10.1039/c8sc01244j

View Article Online
View Journal
Chemical
Science
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: M. E. Ortiz-Soto,
J. Ertl, J. Mut, J. Adelmann, T. A. Le, J. Shan, J. Tessmar, A. Schlosser, B. Engels and J. Seibel, Chem. Sci.,
2018, DOI: 10.1039/C8SC01244J.
This is an Accepted Manuscript, which has been through the
Volume
7 Number 1 January 2016 Pages 1–812
Royal Society of Chemistry peer review process and has been
accepted for publication.
Chemical
Science
Accepted Manuscripts are published online shortly after
www.rsc.org/chemicalscience
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
author guidelines.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the ethical guidelines, outlined
in our author and reviewer resource centre, still apply. In no
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.
ISSN 2041-6539
EDGE ARTICLE
Francesco Ricci et al.
Electronic control of DNA-based nanoswitches and nanodevices
rsc.li/chemical-science

Please do not adjust margins
Chemical Science
Page 1 of 11
View Article Online
DOI: 10.1039/C8SC01244J
Chemical Science
ARTICLE
Product-Oriented Chemical Surface Modification of a
Levansucrase (SacB) via an Ene-type Reaction
Received 00th January 20xx,
Accepted 00th January 20xx
a
b
Maria Elena Ortiz-Soto, a Julia Ertl, Jürgen Mut, a Juliane Adelmann, a Thien Anh Le, Junwen
Shan,c Jörg Teßmar, c Andreas Schlosser, d Bernd Engels b and Jürgen Seibel a*
DOI: 10.1039/x0xx00000x
Carbohydrate processing enzymes are sophisticated tools of living systems that have evolved to execute specific reactions
on sugars. Here we present for the first time the site-selective chemical modification of exposed tyrosine residues in SacB,
a levansucrase from Bacillus megaterium (Bm-LS) for enzyme engineering purposes via an Ene-type reaction. Bm-LS is
unable to sustain the synthesis of high molecular weight (HMW) levan (a fructose polymer) due to protein-oligosaccharide
dissociation events occurring at an early stage during polymer elongation. We switched the catalyst from levan-like
oligosaccharide synthesis to the efficient production of a HMW fructan polymer through the covalent addition of a flexible
chemical side-chain that fluctuates over the central binding cavity of the enzyme preventing premature oligosaccharide
disengagement.
www.rsc.org/
candidates for achieving selectivity, since they occur less
frequently in proteins and are often entirely or partially buried
when localized at protein surfaces.10-15
Introduction
Substantial efforts are devoted to customize enzyme’s
properties not only with the aim of optimizing a given reaction
Here we explore the tyrosine-specific chemical engineering of
a levansucrase from Bacillus megaterium (Bm-LS). Bm-LS (from
glycoside hydrolase family GH68)16 synthesizes
in
a laboratory-scale but considering the needs of the
a wide
industrial processes in which the biocatalysts may be
employed.1 In this direction molecular engineering was
successfully applied to a number of enzymes aiming for
activity, specificity and stability improvements.2 Installation
and functionalization of unnatural amino acids in proteins built
on the pioneer work of Schultz3, 4 sample a much wider range
of functionalities outside the natural evolutionary boundaries
of the 20 canonical amino acids.5-7
distribution of fructooligosaccharides of various lengths using
sucrose as donor/acceptor of the fructosyl moiety.17 The
fructose units are connected via β(2→6) linkages producing
levan-type oligosaccharides (fructans). Levan is a functional
polymer produced by a reduced number of plants and various
microorganisms.18 Application of levan and levan-like
oligosaccharides in the cosmetic, medical and food industries
is contingent on their molecular weight.18-21 Contrary to most
Gram-positive GH68 enzymes the signal peptide deleted,
heterologously expressed levansucrase from Bacillus
megaterium produces exclusively small oligosaccharides with a
degree of polymerization (DP) of 2-20 fructose units (Scheme
1).22
Albeit providing multiple possibilities for fundamental
research, incorporation of unnatural amino acids is not
customary and requires specialized expression systems.8 In this
regard chemical modification of native proteins remains an
alternative to gain access to sufficient amounts of protein
conjugates for large-scale applications. Unlike nucleophilic
amino acids that are traditionally chosen for protein
bioconjugation (i.e. cysteine, threonine, serine and lysine),9
aromatic residues tyrosine and tryptophan are suitable
Scheme 1. Reaction products of Bm-LS from sucrose.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 1
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 2 of 11
View Article Online
DOI: 10.1039/C8SC01244J
ARTICLE
Journal Name
Bm-LS contains 25 tyrosine residues with different solvent
While site-directed mutagenesis proved successful at accessibility (Figure 1B and Supporting Information, Figure S1).
narrowing the number and size of synthesized products,23 Residues 41, 196, 247, 281 and 446 are the most solvent
structural manipulation of oligosaccharide synthesizing GH68 exposed tyrosines, with Y247 taking part in oligosaccharide
enzymes to promote the synthesis of HMW polymer is, to the elongation.23 Accessibility, location and structural function
best of our knowledge, unexplored.
make chemical modification of positions 196 and 247
for studying and manipulating
Previous experiments involving GH68 enzymes payed appealing
particular attention to the residues involved in contacts with oligosaccharide/polymer elongation. Third shell solvent-
sucrose or with short polymerization starters (oligosaccharide exposed amino acids D248 and E314 as well as F445 were
chains of up to DP9), which grow in a clockwise motion.17, 23 exchanged by tyrosine and the effect of their chemical
These residues are localized in the so-called first and second modification was also studied in variants containing the double
shells of the central pocket of GH68 enzymes (Figure 1A), and mutation Y196F/Y247F.
mutations at these positions lead to changes in activity and/or Cyclic diazodicarboxamides such as 4-phenyl-3H-1,2,4-triazole-
oligosaccharide size.17, 19, 22, 24 We hypothesized that altering 3,5(4H)-dione (PTAD)
1 and its derivatives are powerful
residues of the third shell might have an impact on the electrophile modification reagents that can react in an Ene-
25, 26
“assembly line” of larger polysaccharide products. Amino acids type reaction with tyrosine residues (Scheme 2A).12,
from the second and third shells are the subject of this paper, Reactivity and stability of these compounds are strongly
with the focus on native tyrosines 196 and 247 (Figure 1A).
dependent on the R group and their oxidation immediately
prior to use is needed.27 We followed the strategy based on
tyrosine modification reported by Sato et al,27 which relies on
in
situ
oxidation
of
the
luminol
derivatives
(diazodicarboxyamides) in the presence of hemin and
hydrogen peroxide at ambient aqueous conditions.
The alkyne
experiments. The alkyne group can be further extended via
Cu(I)-catalyzed Huisgen-Meldal-Sharpless 1,3-dipolar
2 was synthesized and used in protein modification
cycloaddition (“click reaction”) for additional functionalization
(Scheme 2B).28
Time course samples of the tyrosine modification reaction
containing wild-type Bm-LS (Bm-LS-WT), hemin, H2O2 and the
alkyne
2 in phosphate buffer were analysed for enzymatic
activity (Supporting Information, Figure S2A). Time dependent
chemical modification was assessed by LC-MS analysis of the
full-length protein (Supporting Information, Figure S2B and
S3). A blank sample containing all the components except the
luminol derivative
2 was analysed in parallel to study the mere
influence of the oxidative damage on Bm-LS activity and
product specificity.
Tyrosine modification reaction proceeded almost to
completion within
4 h with only approximately 5% of
unmodified protein remaining after this time period
(Supporting Information, Figure S2B). After 24 h 61 and 39% of
the enzyme was modified once or twice with compound 2,
Figure 1. Surface illustration of Bm-LS (PDB 3om2). A) The central
pocket of Bm-LS coloured by substrate/products binding regions.
Residues in contact with sucrose and short oligosaccharide products
correspond to the first and second shells (purple and gold,
respectively). Residues expected to bind larger oligosaccharides are
respectively. Extended reaction times increased tyrosine
modification and reduced the enzymatic activity most likely
due to methionine oxidation (Supporting Information, Figure
S2A).
NanoLC-MS/MS analysis of elastase digested Bm-LS-WT-
2
depicted in cyan (third shell). A red arrow shows the direction of
17, 23
indicates that modification mainly took place on Y196 and
Y247 after 24 h reaction time. Other residues such as Y41,
Y109, Y439 and Y446 were modified to a lesser extent and
residues Y224, Y281 and Y288 were not significantly modified
(Supporting Information, Figure S4). Oxidation of methionine
residues was also confirmed.
oligosaccharides elongation.
Resides labelled in red were
submitted to mutagenesis and were chemically modified in this paper.
B) Tyrosine residues in Bm-LS: Front view. Tyrosine residues are
depicted in yellow and the substrate sucrose from PDB 1pt2 is shown
in the active site.
Tyrosine residues could be potentially modified in up to four
modes since isomers of compound 2 can react with C3 or C5 of
Results and discussion
2 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 3 of 11
View Article Online
DOI: 10.1039/C8SC01244J
Journal Name
ARTICLE
the tyrosine aromatic ring (Pose A and B, respectively. chromatography. Reactions were performed with the same enzymatic
Supporting Information, Scheme S1).
activity and stopped at equivalent sucrose conversion.
Because chemical modification preferentially happens at
residues Y196 and Y247, the contribution of such modification
R
O
N
A
to the product profile of Bm-LS-WT-2 was investigated. For this
NH
O
O
N
buffer pH 7.0,
OH
purpose, mutants Y196F, Y247F and Y196F/Y247F were
constructed and the products of unmodified and modified
variants were compared (Supporting Information, Figure S5).
This confirmed that changes in oligosaccharide/levan synthesis
can indeed be attributable to the exclusive modification of
MeCN (1:1)
N
N
OH
N
R
rt < 5min
71-96 % mod.
protein
protein
protein
O
1
R
O
B
O
buffer pH 7.4,
H2O2, hemin
OH
N
R
N
both residues. Changes in the fructan profile of Bm-LS-WT-
are the consequence of two different events. Modification of
Y196 with alkyne (variant Y247F- ) stimulates the synthesis
2
NH
rt, 1h
95 % mod.
N
O
OH
O
2
2
protein
of large oligosaccharides, which avoids the accumulation of
products of DP 12-20 (Figure 2 and Supporting Information,
Figures S5B and S6). On the contrary modification of Y247
(variant Y196F-2) hampers oligosaccharide growth,
accumulating short oligosaccharides more efficiently than both
R=
O
2
Scheme 2. Bioconjugation of tyrosine with A) PTAD
12, 27
derivative 2.
1 and B) A luminol
its unmodified counterpart and variant Y247-
2 (Supporting
Information, Figure S5A). The latter is the predominant
behaviour observed for the modified wild-type enzyme. As
expected the product profile of the double variant
Chemical modification with molecule
synthesis of marginal amounts of HMW levan and restricts the
size of oligosaccharides (Figure 2). Bm-LS-WT- synthesizes
levan of 2.3 x 106 Da and fructans with an average molecular
weight of 1.6 kDa (DP 2-12), while the unmodified enzyme
produces only oligosaccharides of DP 2-20. Transfer/hydrolysis
partition remains unaffected in this process.
2 stimulates the
2
Y196F/Y247F-
2 remains unchanged (Supporting Information,
Figure S5C). Because protein conjugation with molecule
2
produces only a minor effect on the reaction products of Bm-
LS-WT (Figure 2 and Supporting Information, Figure S5) we
decided to investigate whether derivatization of the alkyne
group of compound
2 would enhance the effect of the luminol
derivative on the catalysis of Bm-LS.
To rule out the effect of chemical modification on residue Y247
experiments were carried out with single variant Y247F. In a
two-step modification process this variant was modified with
alkyne
2
at residue Y196 followed by a “click reaction” with 1-
-glucopyranoside (1AzGlc) (Figure and
azido-1-deoxy-β-
D
3
Supporting Information, Figure S7). The glucopyranoside
moiety was expected to interact with both, the growing
polymer and the protein. The latter due to the versatility of the
plus subsites (beyond subsite +1) to accommodate glucose and
fructose efficiently.
Y247F-2-1AzGlc showed in fact a dramatic shift from
oligosaccharide formation to the production of HMW polymer
(2.3 x 106 Da) (Figure 3), which was accompanied by a
concomitant 1.5-fold increase in the transfer/hydrolysis
partition compared to Y247F (Supporting information, Table
S1). The polymer was identified as levan by NMR analysis
(Supporting Information, Table S2 and Figures S8-11). Gel
Permeation Chromatography (GPC) profiles of products
synthesized by Y247F-2-1AzGlc and B. subtilis levansucrase (B.
subtilis-LS), an extensively characterized GH68 enzyme, are
presented for comparison (Supporting Information, Figure
S12). Bioconjugation of variant Y247F (at position Y196) with
alkyne
2 does not change the global KM for sucrose (Table 1)
and changes in activity may obey to the modification of other
tyrosine residues or to methionine oxidation. The extension of
Figure 2. Effect of the tyrosine chemical modification on the products
synthesized by Bm-LS. A) HPAEC-PAD chromatograms of
oligosaccharides synthesized by unmodified and modified enzyme with
compound
2 with 1AzGlc increased the KM of the variant by
almost 2-fold and its kcat value was slightly improved (Table 1).
2
.
B) Oligosaccharide/levan separation by gel permeation
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 3
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 4 of 11
View Article Online
DOI: 10.1039/C8SC01244J
ARTICLE
Journal Name
Chemical modification did not affect the optimal pH of the To gain insights into the nature of the protein-ligand
enzymes (Supporting Information, Figure S13). interactions of chemically modified proteins, the apparent
Double variant Y196F/Y247F- was modified with 1AzGlc and dissociation constant (Kd) of variants Y247F- and Y247F-2-
2
2
its reaction products analysed by GPG. The product profile of 1AzGlc for LMW levan (average MW = 1.4 kDa, average DP = 9)
this variant remained unaltered, confirming that modification were determined by Differential Scanning Fluorimetry (DSF).31
of Y196 and not that of other tyrosine residues is responsible The low affinity character of the binding made attempts to
for HMW levan synthesis (Supporting Information, Figure S14). measure interactions by Isothermal titration calorimetry (ITC)
unsuccessful. Binding constants obtained by DSF are based on
Table 1. Catalytic parameters of tyrosine-modified and unmodified changes in the apparent protein melting temperature, which is
(control) levansucrase variants using sucrose as substrate. Catalytic ligand concentration dependent (Supporting Information,
constants reflect the global activity (hydrolysis and transfer).
Figure S17).31
kcat/KM
Enzyme
kcat
KM
[m
[m
M
S-
[s-1]
M]
1
]
WT-Control
247.8 ± 6.9
131.0 ± 5.0
254.2 ± 3.5
153.6 ± 3.7
172.1 ± 2.8
285.9 ± 2.8
173.3 ± 3.4
21.2 ± 2.7
19.2 ± 3.6
21.9 ± 1.3
24.5 ± 2.6
43.1 ± 2.8
29.8 ± 1.2
48.1 ± 3.6
11.7
6.8
WT-2
Y247F-Control
Y247F-2
11.6
6.26
3.9
Y247F-2-1AzGlc
Y196F-Control
Y196F-2
9.6
3.6
Y247F/Y196F-
Control
308.7 ± 6.7
204.9 ± 4.8
16.7 ± 1.7
17.6 ± 1.9
18.4
11.6
Y247F/Y196F-2
Binding of oligosaccharides to the protein surface is a pivotal
factor in levan synthesis as demonstrated with wild-type
levansucrases from Zymomonas mobilis and B. subtilis.29, 30 The
ability of soluble Z. mobilis levansucrase to synthesize
oligosaccharides can be altered through the pH-driven
formation of active protein microfibrils. The new scaffold
creates additional anchorage sites for growing acceptors and
enables the synthesis of large levan.30 Conversely the binding
of growing oligosaccharides to the surface of other B. subtilis-
LS molecules present in the reaction plays a detrimental role
for polymer elongation. The inter-molecular competition of
enzyme surfaces for non-productive oligosaccharides/levan
binding results in mixtures of low molecular weight (LMW) and
HMW levan. Accordingly only extremely low enzyme
concentrations would decrease the occurrence of protein-
protein encounters favouring the specific production of large
polymer.29
Figure 3. Effect of a two-step chemical modification of Y196 on the
product profile of variant Y247F. A) Unmodified Bm-LS-WT B) Y247F-2,
C) Y247F-2-1AzGlc. The protein engineering strategy is displayed in the
left panels. Gel permeation chromatograms of products are shown in
the right panels. Size of fructans is given in Da.
Although some protein aggregation occurs during the chemical
modification process attributable to the interaction of Bm-LS
with hemin, isolation and analysis of stable monomers allowed
us to establish that neither protein aggregation nor protein
concentration plays a role in the specificity of Y247, Y247F-
2
and Y247F-2-1AzGlc for the synthesis of either
Kd of both enzymes for LMW levan is around 8 m
M, indicating a
oligosaccharides or levan. (Supporting Information, Figure S15
and Figure S16).
weaker binding although in the same order of magnitude than
that of Bm-LS-WT (4.1 mM) and B. subtilis-LS (1.8 mM), the
latter for levan with an average DP of 16.29 Although the
4 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 5 of 11
View Article Online
DOI: 10.1039/C8SC01244J
Journal Name
ARTICLE
binding between variant Y247F-
2 and LMW levan was Information, Figure S19) revealing the need of larger azides to
seemingly not modified after the “click” reaction, the hinder oligosaccharide-enzyme dissociation.
possibility that little but significant changes in binding may The modification of triple variants Y196F/Y247F/D248Y,
have contributed to the formation of HMW levan by Y247F-
1AzGlc cannot be dismissed.
2-
Y196F/Y247F/E314Y and Y196F/Y247F/F445Y seems to support
the previous assumption. D248, E314 and F445 are located at
It is worth mentioning that the kind of interactions resulting the periphery (third shell) of the central pocket (Figure 1A).
from incubating already formed levan with the levansucrase While the GPC profile of Y247F- -1AzGlc and
may not resemble the protein-product interactions taking Y196F/Y247F/E314Y- -1AzGlc is similar, variants
place during in situ synthesis. Once oligosaccharides leave the Y196F/Y247F/D248Y- -1AzGlc and Y196F/Y247F/F445Y-
2
2
2
2-
binding pocket, their structure may undergo conformational 1AzGlc show significant differences (Supporting Information,
changes that could prevent them from rebinding in a Figure S20). Of all variants, tyrosine introduced at position 248
productive manner and thus resume elongation and proceed would be the most exposed. Variant Y196F/Y247F/D248Y-
to the synthesis of HMW.29
1AzGlc synthesizes almost entirely HMW levan producing only
Relatively stable contacts between elongating oligosaccharides traces of LMW oligosaccharides. Variant Y196F/Y247F/F445Y-
and the enzyme are essential at early stages of product -1AzGlc, however, presents the lower HMW/LMW levan ratio
extension if HMW levan is to be synthesized.29 Bm-LS-WT and compared to other “clicked” variants which is in agreement
single variants modified only with compound are unable to with the position of residue 445. Depending on the orientation
support the synthesis of large polymer due to premature of the chemical side chain in variant Y196F/Y247F/F445Y-
2-
2
2
2-
protein-oligosaccharide disengagement events. Such events 1AzGlc, it may keep oligosaccharide-protein interactions but
should only occur due to insufficient binding of growing also hinder elongation of nascent oligosaccharides if oriented
products within or near the catalytic pocket, since non- towards the active site.
productive protein-product interactions do not appear to be Our results suggest that the change in the product specificity
responsible for the inability of both enzymes to produce HMW of chemically modified levansucrases may obey to the
levan (Supporting Information, Figure S15).
restriction of oligosaccharides mobility triggered by the
-1AzGlc presence of the chemical side-chain - -azide. This may impede
Installing a chemical side chain in the variant Y247F-
2
2
may generate intra polar contacts between
protein as observed by Molecular Dynamics (MD) simulations.
MD simulations of Y247F- -1AzGlc (both isomers of alkyne
2-1AzGlc and the early protein-oligosaccharide dissociation events. Interactions
among enzyme, oligosaccharides and chemical tags, however,
2 in merits a thoroughly investigation.
2
pose A, Supporting Information, Figure S1) were obtained with
and without 6-kestose bound to the active site (Supporting
Conclusions
Information, Figure S18). Trajectories and interactions of -2-
1AzGlc are similar regardless of the absence/presence of the
ligand, indicating that chemical modification does not disturb
the binding of short polymerization starters in the active site.
Site directed mutagenesis has been used to modify the
19, 22-24
Such
products of a number of GH68 enzymes.17,
manipulations are often focused on reducing the number of
synthesized oligosaccharides; consequently, information
regarding how oligosaccharide’s elongation and polymer
formation progress is scarce.29, 30 Herein we demonstrate in an
unprecedented manner that the approach of modifying
strategically situated tyrosine residues can be applied to
manipulate the product specificity of Bm-LS to create novel
polymer products while increasing the transfer/hydrolysis
partition. Chemically- and genetically-modified Bm-LS variants
switched from the production of a wide oligosaccharide
distribution to the synthesis of HMW polymer maintaining
both protein integrity and functionality. Chemical tyrosine
modification via the Ene-reaction seems to be an attractive
strategy especially for tailoring the scaffold of carbohydrate
processing enzymes, which deal with polymers as substrates or
products. The fact that a correctly folded enzyme produced
under standard culture procedures can be post-translationally
modified with luminol derivatives carrying any chemical
residue of interest adds to the appeal of this technology.
Isomer 1 of -2-1AzGlc fluctuates back and forth over the
binding pocket exhibiting short-lived interactions with the
protein. On the contrary, flexibility of the isomer 2 is reduced
due to polar intermolecular interaction of -
main and side chains of I242, D243 and E244 (Supporting
Information, Figure S18). These results suggest that flexible -
2-1AzGlc with the
2-
1AzGlc may act as a chemical lid introducing steric hindrance,
which would prevent the size-increasing oligosaccharides from
leaving too early the binding pocket. The synthesis of small
amounts of short oligosaccharides may result from an
incomplete “click” reaction or from side-chain -2-1AzGlc
having more interaction with the protein and thus “opening”
the lid and preventing steric interference.
1,2,3-triazole ring systems are C–H hydrogen bond donors with
peptidomimetic characteristics, with similar size, planarity and
dipolar character as an amide linkage.32 To gain further
knowledge on the contribution of the 1,2,3-triazole ring and
other azides to polymer production sodium azide, 2-azido-1-(3-
hydroxyphenyl) ethan-1-one (AN28) and 5-FAM-azide were
also tested. HMW levan production is observed
notwithstanding the nature of the modifying azide, however
the presence of triazole alone is not enough to completely
shift the reaction from LMW to HMW polymer (Supporting
Conflicts of interest
There are no conflicts to declare.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 5
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 6 of 11
View Article Online
DOI: 10.1039/C8SC01244J
ARTICLE
Journal Name
[a]
PCR performed with the QuikChange Lightning Site-Directed
[b]
Mutagenesis Kit using forward and reverse primers. PCR performed
Acknowledgements
Financial support by the Bundesministerium für Bildung und
Forschung (01DN16034) for the project “Synthesis of tailor-
made modular hybrid functional oligosaccharides (Hy-OS)” is
gratefully acknowledged. We would like to thank Anne
Neumann for technical support.
with the QuikChange Lightning Multi Site-Directed Mutagenesis Kit
[c]
using only forward primers.
Variant Y196F/Y247F was used as
template. [d] Only the forward primer contains the new mutation and
whole plasmid amplification was performed with phosphorylated
primers. Mutations are underlined.
Protein expression and purification. One single colony of
freshly transformed E. coli bearing selected plasmids was used
Experimental
to inoculate
5
mL LB-medium containing 50 µg mL-1
Calculation of the Accessible Surface Areas (ASA). ASA of
tyrosine residues was calculated using the crystallographic
structure of the levansucrase PDB 3om2 with Proteins,
Interfaces, Structures and Assemblies (PISA) server
(http://www.ebi.ac.uk/pdbe/prot_int/pistart.html).33
kanamycin. Pre-cultures were incubated overnight at 37 °C and
used to inoculate 250 mL LB-medium with appropriate
antibiotic. Expression of levansucrase was induced at an OD600
of around 0.6 by adding IPTG at a final concentration of 0.5
m
M
. Cultures were incubated overnight at 20 °C. Cells were
harvested by centrifugation and resuspended in 7 mL of lysis
buffer (20 m NaHPO4, 20 m Na2HPO4, 20 m imidazole, 0.5
NaCl, pH 8.0). After sonication, extracts were cleared by
Gene constructs and mutagenesis. The gene of the
levansucrase from B. megaterium (GenBank: ADF38395.1) was
cloned into the vector pETM11 between the restriction sites
NcoI and XhoI. Mutagenesis reactions were performed by
using the QuikChange Lightning Site-Directed Mutagenesis and
QuikChange Lightning Multi Site-Directed Mutagenesis Kits
according to the provider’s instructions or by whole plasmid
amplification using phosphorylated primers and introducing
the mutated codon only in the forward primer. Vector
containing the wild-type B. megaterium levansucrase was used
as a template for generating variants Y196F, Y247F and the
double variant Y196F/Y247F. The latter was used as a template
to create triple variants Y196F/Y247F/D248Y and
Y196F/Y247F/D248Y. Resulting sequences were confirmed by
DNA sequencing.
M
M
M
M
centrifugation at 13000 x g. For Immobilized Metal Affinity
Chromatography (IMAC), cleared lysates were loaded onto a 1
mL HisTrap FF column (GE healthcare Life Sciences)
incorporated onto an Äkta prime plus purification system and
levansucrase eluted with a linear gradient of elution buffer (20
mM NaHPO4, 20 mM Na2HPO4, 0.25 M imidazole, 0.5 M NaCl, pH
8.0). Purification fractions containing pure protein were
pooled and concentrated.
The enzyme contains a TEV-protease cleavable N-terminal
hexahistidine-tag. Digestion with a 1:100 TEV/levansucrase
ratio in 20 m
M Tris-HCl buffer pH 7.5 and 0.1 mM EDTA was
allowed to proceed over 48 h. Levansucrase was separated
from the cleaved peptide and the protease via IMAC and size
exclusion chromatography over a HiLoad 16/600 Superdex 200
Primers employed in PCR are as indicated in Table 2.
pg column (GE healthcare Life Sciences) in 50 m
Na2HPO4, 20 m imidazole, 0.5 NaCl, pH 8.0.
An extinction coefficient of 51014
-1 cm-1 and a path length of
M NaHPO4, 20
Table 2. Primers for site directed mutagenesis.
m
M
M
M
M
Variant
Y196F [a]
Primer sequence (5' to 3' direction)
Forward: CGGATTATTCAGGTAAACAATTCGGAAA
ACAAACGTTAACGAC
1 cm were used to calculate concentration of purified enzymes
at 280 nm.
Tyrosine specific modification reactions. 10 µ
protein was incubated in 0.1 phosphate buffer, pH 7.5
containing 1 m H2O2, 10 µ hemin and 1 m luminol
M purified
Reverse: GTCGTTAACGTTTGTTTTCCGAATTGTTTA
CCTGAATAATCCG
M
M
M
M
Y247F [a]
Forward: GATGAAGGCGGTTTCGACACAGGGGATA
AC
derivative 2.27 Hemin and 2 were prepared in 15 and 100%
DMSO (w/v), respectively. H2O2 was diluted immediately
before use.
Reverse: GTTATCCCCTGTGTCGAAACCGCCTTCATC
Forward primers Y196F and Y247F
Y196F/Y247F
[b]
Blank reactions were prepared in similar reaction conditions
excluding the luminol derivatives. Modification reactions were
allowed to proceed over 72 h and time course samples of
enzymes were assayed for activity on sucrose.
Y196F/Y247F/
D248Y[c, d]
Forward: TACACAGGGGATAACCATACGCTAAG
Reverse: GAAACCGCCTTCATCAATAAACTGC
Forward:
Y196F/Y247F/
D248Y[a, c]
Enzymes used for oligosaccharide/levan synthesis and kinetic
determinations were modified over 22 h. Subsequent to
GCTTCTTGAAGGATCTAATAAATACAAAGCTTCTTT
AGCAAACGGGGC
tyrosine modification with compound
enzyme was separated from H2O2, hemin and the excess of
alkyne by buffer exchange against 50 m Sorensen’s buffer,
2 (alkyne modifier) the
Reverse:
GCCCCGTTTGCTAAAGAAGCTTTGTATTTATTAGAT
CCTTCAAGAAGC
2
M
pH 6.9, using a 5 mL HiTrap Desalting column (GE healthcare
Life Sciences).
Y196F/Y247F/
F445Y[b]
Forward primers Y196F, Y247F and F445Y:
CATGACAAATAGAGGCTACTATGAAGACAACCACT
ATAC
Copper-catalysed azide-alkyne cycloaddition (CuAAC)
reaction (Click reaction). The enzyme modified with
2 was
concentrated after buffer exchange and incubated at a final
6 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 7 of 11
View Article Online
DOI: 10.1039/C8SC01244J
Journal Name
ARTICLE
concentration of 10 µ
M
in 0.1
M
phosphate buffer containing sucrose conversion). Levan and/or oligosaccharides were
of the azide ((1- recovered by centrifugation and freeze-dried.
100 µ
M
CuSO4, 0.5 m
M
THPTA and 50 µM
Azido-1-deoxy-β-d-glucopyranoside, sodium azide, 2-azido-1- Gel permeation chromatography of the polysaccharides was
(3-hydroxyphenyl)ethan-1-one (AN28) or 5-FAM-azide)). The performed with an aqueous GPC system from Malvern
click reaction was started by addition of 5 m
ascorbate. Blank reactions were prepared excluding the azide.
The click reaction was stopped after 3 h by addition of 1 m
M
sodium (Herrenberg, Germany). The system includes
GPCmax (in-line degasser, 2-piston-pump and autosampler), a
column oven (35 °C), refractive index (RI) detector (Viscotek
a Viscotek
M
EDTA prior buffer exchange against 50 m
pH 6.9.
M
Sorensen’s buffer, VE3580) and Viscotek A-columns (Guard column and two
A6000M analytical columns, length = 50 mm + resp. 300 mm,
Determination of optimal pH
width = 8 mm, porous poly(methyl methacrylate), particle size
Reactions for determining pH-dependent activity profiles 13 µm). An aqueous solution of Millipore water with 8.5 g L-1
contained 1 U mL-1 enzyme and 0.5 m
M
sucrose in 50 m
M
NaNO3 and 0.2 g L-1 NaN3 was used as solvent and eluent. The
acetate or Sorensen’s buffer ranging from pH 5-8, with samples were dissolved overnight and filtered with a 0.45 µm
increase of 0.5 pH units. Acetate buffer was employed in membrane. A volume of 100 µL was injected into the GPC
reactions performed at pH 5.0 and 5.5. For the remaining pH system and eluted with an elution rate of 0.7 mL min-1. The
values Sorensen’s buffer was used. The global activities were molecular weights of the polysaccharides were calculated
calculated from the release of reducing sugars by using the using
DNS (3,5-dinitro-salicylic acid method) 19, 34 method.
a conventional calibration obtained from dextran
standards (SIGMA, Germany).
Activity assay and determination of kinetic parameters. Initial Size Exclusion Chromatography (SEC). Modified and
rates were determined from the release of reducing sugars unmodified levansucrase was subjected to size exclusion
(DNS)19, 34 from 0.5 m
M
sucrose in 50 m
M Sorensen’s buffer pH chromatography to analyse their monomeric/oligomeric
6.9 containing unmodified or tyrosine-modified enzyme over status.
the time course.
0.5 mL of protein with a concentration of 4 mg mL-1 was
Catalytic parameters for the global reaction (hydrolysis and applied to
a HiLoad 16/600 Superdex 200 column (GE
transfer) were obtained from reactions performed in 50 m
M
Healthcare, Germany) coupled to an Äkta purification system
Sorensen’s
Sorensen’s buffer pH 6.9 containing purified enzyme and (GE Healthcare, Germany) and eluted with 50 m
M
varying concentrations of sucrose. KM and kcat values were buffer pH 6.9. Molecular weight of proteins was determined by
calculated by fitting the data to the Michaelis-Menten comparing its elution volume with that of known SEC protein
equation using non-linear curve in OriginPro (OriginLab).
HPAEC-PAD analysis of products from sucrose. Reactions Differential scanning fluorimetry (DSF). 150 µL samples
containing 0.5 protein (monomers of
sucrose and an enzymatic activity of 3 U mL-1 containing a final concentration of 2 µ
in 50 m Sorensen’s buffer pH 6.9 were employed to Y247F-2 or Y247F-2-1AzGlc), 50 m Sorensen’s buffer pH 6.9,
determine the transfer/hydrolysis partition and product profile 5X Sypro Orange (Thermofisher, Germany) and 0, 0.5, 1.0, 2.0,
of modified and unmodified levansucrases (wild-type and 4.0, 8.0, 15.0, 22.0, 35.0 or 50.0 m levan with an average DP
standards (SIGMA, Steinheim, Germany).
M
M
M
M
M
variants). HPAEC-PAD analysis of oligosaccharides was of 9 were prepare in 1.5 mL Eppendorf tubes. Control
performed with a Dionex ICS-5000+SP system utilizing a experiments without protein were also included. Aliquots of
Carbopac PA10 column with pulsed amperometric detection. 25 µL of each sample were applied 4 times on a 96-well plate
Eluents were 100 mM NaOH (A), 100 mM NaOH, 1 M NaOAc (B). that was later sealed with transparent adhesive film and
For quantification of glucose and fructose a multistep gradient centrifuged at 500 x g for 1 minute.
was programmed as follows: 0–5 min 100% A, 5-30 min 0-50% The well plate was placed in a HT/7900 fast real time PCR
B, 30-45 min 100% A. The release of glucose reflects the global system (Applied Biosystems, Germany) and changes in
activity (hydrolysis and transfructosylation), while fructose fluorescence over a temperature range were recorded using
only results from hydrolysis. The difference between glucose the ROX filter and the following program:
and
fructose
concentrations
corresponds
to
transfructosylation.
Step
Ramp rate
Temperature Time
Gel permeation chromatography (GPC). Products from
(°C)
(mm:ss)
modified and unmodified enzymes were obtained from
1
2
100%
1%
25
1:00
1:00
reactions performed in 50 mM Sorensen’s buffer pH 6.9 with
sucrose and 3 U mL-1 enzymatic activity unless stated
95
0.5
M
otherwise. Reactions were stopped with 50 m
h.
M NaOH after 48
Fluorescence data was processed in OriginPro to obtain the
melting temperature at each levan concentration by fitting the
data to the Boltzmann function.
Reactions with 0.1, 1-3 and 10 U mL-1 enzymatic activity were
stopped after 120, 48 and 5 h, respectively.
Melting temperature values of two independent
measurements with four replicates each were used to
calculate the apparent dissociation constant Kd using the single
Products of the wild-type levansucrase and its variants were
purified by ethanol precipitation (5 volumes of cold ethanol by
1 volume of the reaction medium after approximately 90%
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 7
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 8 of 11
View Article Online
DOI: 10.1039/C8SC01244J
ARTICLE
Journal Name
site ligand binding equation with the GraphPad Prism SDS-PAGE applying 5 µg of reduced and alkylated proteins
software.31
onto 12% acrylamide gels.
Molecular Dynamic simulations. The trajectories and Excised gel bands were destained with 30% acetonitrile in
interactions of compounds 2 and 2-1AzGlc were investigated 0.1 M NH4HCO3 (pH 8), shrunk with 100% acetonitrile, and
by MD simulations of the covalent complexes in which the dried in
a vacuum concentrator (Concentrator 5301,
compounds were attached to Y196 of Bm-LS variant Y247F. Eppendorf, Germany). Digests were performed with 0.1 µg
Simulations were performed using the AMBER14 program elastase per gel band overnight at 37 °C in 0.1 M NH4HCO3
package.35 To achieve the wild-type of the protein we used the (pH 8). After removing the supernatant, peptides were
D257A mutant (pdb code 3OM2) and replaced Ala257 by extracted from the gel slices with 5% formic acid, and
Asp257. The covalent attachment of 2 on Y196 was performed extracted peptides were pooled with the supernatant.
with the Avogadro program package (http://avogadro.cc/) 36
.
NanoLC-MS/MS analyses were performed on an Orbitrap
considering the enzyme surrounding (5 Å radius of the Fusion (Thermo Scientific) equipped with a PicoView Ion
corresponding tyrosine residue). The positioning of sucrose Source (New Objective) and coupled to an EASY-nLC 1000
was achieved by aligning the X-ray structure of Bm-LS (Thermo Scientific). Peptides were loaded on capillary columns
complexed with sucrose (pdb code 1PT2) with wild-type (PicoFrit, 30 cm x 150 µm ID, New Objective) self-packed with
modification (of 3OM2). 6-kestose was inserted by aligning the ReproSil-Pur 120 C18-AQ, 1.9 µm (Dr. Maisch) and separated
fructose unit of sucrose and 6-kestose. The protein was with a 30-minute linear gradient from 3% to 40% acetonitrile
described by the Amber14 force field ffl4SB.37 For 2, 2-1AzGlc, and 0.1% formic acid and a flow rate of 500 nL min-1.
sucrose and 6-kestose the generalized AMBER force field Both MS and MS/MS scans were acquired in the Orbitrap
(GAFF) was applied using Antechamber.38,
39
To include the analyzer with a resolution of 60,000 for MS scans and 15,000
environment in an appropriate manner an octahedral solvation for MS/MS scans. A mixed ETD/HCD method was used. HCD
shell with periodic boundaries was used. A minimization fragmentation was applied with 35% normalized collision
containing 1000 steps was carried out with restraints on the energy. For ETD calibrated charge-dependent ETD parameter
protein-ligand complex followed by 2500 steps without were applied. A Top Speed data-dependent MS/MS method
restraints allowing minimization of the entire system. The with a fixed cycle time of 3 seconds was used. Dynamic
gradual heating from 0 to 300 K was performed with a exclusion was applied with a repeat count of 1 and an
duration of 100 ps including restraints on the protein-inhibitor exclusion duration of 10 seconds; singly charged precursors
complex. Afterwards a MD simulation of 10 ns without were excluded from selection. Minimum signal threshold for
restraints was carried out.
precursor selection was set to 50,000. Predictive AGC was used
Analysis of full length unmodified and modified proteins by with AGC a target value of 2x105 for MS scans and 5x104 for
LC-MS. The time course samples of the tyrosine modification MS/MS scans. EASY-IC was used for internal calibration.
reaction were analysed by LC-MS on a micrOTOF-Q III (Bruker PEAKS Studio 8.0 was used for raw data processing and
Daltonics) equipped with an ESI Ion Source (Apollo II) and database searching with the following parameters: parent
coupled to an Agilent 1100 HPLC System. The Q-TOF MS mass error tolerance: 7.0 ppm, fragment mass error tolerance:
instrument has a resolution of 20,000 and a mass accuracy of 5 0.015 Da, enzyme: none, variable modifications:
ppm with external calibration. Full length proteins were loaded carbamidomethyl (C) (57.02 Da), oxidation (M) (15.99 Da),
on a reversed phase column (YMS-Pack C4, 15 cm x 4.6 mm ID, acetylation (Protein N-terminal) (42.01), pyro-Glu (N-terminal
5µM, YMC) and separated with a flow of 0.5 mL min-1 over 30 Q) (-17.03 Da), 2 (labelled as J2) (Y) (256.08 Da), and 2-1AzGlc
minutes using a step gradient from 25% to 90% acetonitrile. (labelled as J2-azido-glucopyranoside (Y) (461.15 Da). A small
The MS spectra were recorded continuously in the range m/z custom-made database (about 200 proteins) containing
200 – 3000 with the following settings: capillary voltage -4.5 sequences of wild-type Bm-LS and its variants was applied.
kV, end plate voltage – 4 kV, nitrogen nebulizer pressure 3 bar, Results were filtered with 1% FDR on PSM level.
dry gas flow 12 L min-1, dry temperature 180 °C; Funnel 1 and 2 Synthesis of 4-hydroxyphthalic acid (4). In a 1L-three-necked
RF 400 Vpp, Hexapole RF 200 Vpp; Quadrupole ion energy 5 piston with inside thermometer and KPG-stirrer a solution of
eV, Quadrupole low mass 200 m/z; collision energy 7 eV, 50% aqueous 4-sulphophthalic acid (591 g, 1.20 mol) was
collision RF 1000 Vpp, transfer time 100 µs, pre pulse storage stirred at room temperature and NaOH (577 g, 14.4 mol) was
10 µs. The instrument was calibrated with the MMI-L Low added in small portions. The reaction mixture was stirred and
Concentration Tuning Mix (Agilent) prior to measurement of heated for 1 h at 180 °C. After cooling the reaction to room
the samples. The accuracy of the calibration masses was re- temperature, 1 L water and 1 L conc. HCl were added to
checked by measuring the Tuning Mix after the sample precipitate the solid product. The filtrate was extracted with
measurements. The spectra were recorded with the Compass AcOEt by using a perforator, the combined organic layer was
Software (Bruker Daltonics) containing the OTOF Control 3.4 dried over Na2SO4 and the solvent was removed under
and Hystar 3.2 software for controlling the MS instrument and reduced pressure. The product 4 (50.7 g, 23%) was obtained as
the HPLC. For spectra deconvolution and data evaluation the a white solid.
Data Analysis software DA 4.2 (Bruker Daltonics) was used.
1H-NMR (400 MHz, DMSO-d6):
δ = 12.81 (s, 2H, COOH), 10.39
Protein digestion and analysis by mass spectrometry. (s, 1H, OH), 7.64 (d, 1H, 3J = 8.52 Hz, H-1), 6.87 (dd, 1H,
Tyrosine-modified and unmodified enzymes were analysed by
8 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 9 of 11
View Article Online
DOI: 10.1039/C8SC01244J
Journal Name
ARTICLE
3J = 8.42 Hz, 4J = 2.50 Hz, H-2), 6.84 (d, 1H, 4J = 2.31 Hz, H-3) 3.87 (s, 3H, H-9/10); 2.41 (dt, 2H, 3J = 6.9 Hz, 3J = 2.6 Hz, H-3’);
ppm.
13C-NMR (100 MHz, DMSO-d6):
δ = 169.6 (C-8), 167.4 (C-7), 160.2 (C-
2.04 – 1.99 (m, 2H, H-2’); 1.98 (t, 1H, 4J = 2.6 Hz, H-5’) ppm.
13C-NMR (100 MHz, CDCl3):
= 169.0 (C-8), 166.9 (C-7), 161.5
δ
3), 137.5 (C-5), 131.6 (C-1), 120.8 (C-6), 116.3 (C-2), 114.3 (C-4) ppm (C-3), 135.8 (C-5), 131.7 (C-1), 122.2 (C-6), 116.2 (C-2), 114.1
(C-4), 83.1 (C-4’), 69.3 (C-5’), 66.7 (C-1’), 52.9 (C-10), 52.5 (C-9),
27.9 (C-2’), 15.1 (C-3’) ppm. (Supporting information, Figure
24).
(Supporting information, Figure 21).
HRMS (ESI pos., m/z): Calculated C8H6O5 [M+Na]+ 205.01129,
measured 205.01074, Δppm: 1.46.
HRMS (ESI pos., m/z): Calculated C15H16O5 [M+Na]+ 299.08899,
Synthesis of dimethyl 4-hydroxyphthalate (5). 4-
hydroxyphthalic acid (15.4 g, 84.6 mmol) was solved under
protective gas atmosphere in 160 mL dry methanol. The
solution was cooled to 0 °C and 18 mL thionyl chloride
(248 mmol) was added dropwise. The solvent was removed
under reduced pressure and the residue was resolved in 50 mL
AcOEt. The organic layer was washed with 30 mL water, 30 mL
brine and dried over MgSO4. The product 5 (16.2 g, 91%) was
obtained as a white solid by evaporating the solvent under
reduced pressure.
measured 299.08968, Δppm: 2.28 ppm.
Synthesis of (4-(pent-4-yn-1-yloxy)phthalic acid (9). To a
solution of compound 8 (0.67 g, 2.43 mmol) in 10 mL THF and
MeOH (1:1) a solution of 5 mL NaOH (5 m) was added and
stirred for 16 h at room temperature. The reaction mixture
was then acidified by adding 12 mL 1 m HCl (pH = 1) and the
product was extracted with AcOEt. The combined organic layer
was washed with brine, dried over MgSO4 and the solvent was
removed under reduced pressure to obtain
2.30 mmol, 95%) as a white solid. 9:
9 (0.57 g,
1H-NMR (400 MHz, CDCl3):
δ = 7.76 (d, 1H, 3J = 8.53 Hz, H-1),
7.02 (d, 1H, 4J = 2.56 Hz, H-2), 6.93 (dd, 1H, 3J = 8.54 Hz,
1H-NMR (400 MHz, DMSO-d6):
δ = 13.0 (s, 2H, COOH); 7.72 (d,
1H, 3J = 8.6 Hz, H-1); 7.08 (dd, 1H, 3J = 8.5 Hz, 3J = 2.6 Hz, H-2);
7.05 (d, 1H, 4J = 2.5 Hz, H-4); 4.12 (t, 2H, 3J = 6.16 Hz, H-1’);
2.83 (t, 1H, 4J = 2.6 Hz, 5’); 2.32 (dt, 2H, 3J = 7.1 Hz, 4J = 2.6 Hz,
H-3’); 1.90 (quin, 2H, 3J = 6.7 Hz, H-2’) ppm.
4J = 2.60 Hz, H-4), 3.91 - 3.87 (s, 6H, H-9/10) ppm.
13C-NMR (100 MHz, CDCl3):
δ = 169.5 (C-8), 167.2 (C-7), 159.2 (C-3),
135.8 (C-5), 132.1 (C-1), 121.9 (C-6), 117.4 (C-2), 115.4 (C-4), 53.1
(C-10), 52.7 (C-9) ppm (Supporting information, Figure 22).
HRMS (ESI pos., m/z): Calculated C10H10O5 [M+Na]+ 233.04204,
measured 233.04222, Δppm: 0.74.
13C-NMR (100 MHz, DMSO-d6):
δ = 169.2 (C-8), 167.3 (C-7),
160.6 (C-3), 137.1 (C-5), 131.3 (C-1), 122.4 (C-6), 115.5 (C-2),
113.5 (C-4), 83.6 (C-4’), 71.8 (C-5’), 66.6 (C-1’), 27.5 (C-2’), 14.4
(C-3’) ppm (Supporting information, Figure 25).
Synthesis of 5-bromo-1-pentin (7). Pent-4-yn-1-ol (1.27 g, 15.0
mmol) and tetrabromide (7.73 g, 23.3 mmol) were solved in 20
mL DCM and cooled to 0 °C. After adding triphenylphosphine
(6.31 g, 24.1 mmol) in small portions the reactions mixture was
stirred for 1 h at room temperature. Complete precipitation of
the product was obtained by adding 10 mL cyclohexane and
storing the suspension at 4 °C overnight. The product was
filtered and washed with cyclohexane. The solvent was
removed under reduced pressure and the product was purified
by silica gel column (n-pentane) providing 7 (1.10 g, 50%) as a
colourless oil.
HRMS (ESI pos., m/z): Calculated C13H12O5 [M+Na]+ 271.05824,
measured 271.05754.
Synthesis
of
2-methyl-6-(pent-4-yn-1-yloxy)-2,3-
dihydrophthalazine-1,4-dione (2) (isomer mixture). To
a
solution of compound 9 (0.52 g, 2.11 mmol) in 20 mL dry THF
2.2 mL (23.3 mmol) Ac2O was added and the reaction mixture
was stirred for 3 h under reflux conditions. After removing the
solvent under reduced pressure, the residue was dissolved in
20 mL ethanol and 0.7 mL methylhydrazine (13.4 mmol) was
added. The mixture was stirred again for 3 h under reflux
conditions. The solution was cooled to room temperature and
quenched with 50 mL sat. NH4Cl and 50 mL AcOEt. The product
was extracted with AcOEt and the combined organic layer was
washed with brine, dried over MgSO4 and the solvent was
evaporated under reduced pressure. Detailed synthesis of 2 is
described in Supporting Scheme 2. The purification was carried
out by silica gel column (Cy:EE = 1:1) providing 2 (0.53 g, 96%)
as a white solid.
1H-NMR (400 MHz, CDCl3):
δ = 3.54 (t, 2H, 3J = 6.4 Hz, H-1);
2.40 (dt, 2H, 3J = 8 Hz, 4J = 2.7 Hz, H-3); 2.06 (quin, 2H, 3J = 6.6
Hz, H-2); 1.99 (t, 1H, 4J = 2.7 Hz, H-5) ppm.
13C-NMR (100 MHz, CDCl3):
δ = 82.5 (C-4), 69.5 (C-5), 32.3 (C-1), 31.3
(C-2), 17.2 (C-3) ppm (Supporting information, Figure23).
Synthesis of dimethyl 4-(pent-4-yn-1-yloxy)phthalate (8). To a
solution of compound 5 (1.05 g, 5.0 mmol) and K2CO3 (1.05 g,
7.7 mmol) in DMF (10 mL) the compound 7 (1.59 g, 7.72 mmol)
was added to deliver compound 8. After stirring the mixture
for 16 h at 60 °C the reaction was quenched with AcOEt
(40 mL) and H2O (40 mL). The product was extracted with
AcOEt and the combined organic layer was washed with brine
and dried over MgSO4. The solvent was evaporated under
reduced pressure and the product was purified by silica gel
column (Cy:EE = 5:1) providing 8 (0.67 g, 51%) as a colourless
oil.
1H-NMR (400 MHz, DMSO-d6):
δ = 11.6 (s, 1H + 1.15H, NH);
8.12 (d, 1H, 3J = 8.8 Hz, H-5*); 7.79 (d, 1.15H, 3J = 8.8 Hz, H-8);
7.59 (d, 1.15H, 4J = 2.6 Hz, H-5); 7.45 (dd, 1.15H, 3J = 8.8 Hz,
4J = 2.7 Hz, H-7); 7.42 (dd, 1H, 3J = 8.8 Hz, 4J = 2.6 Hz, H-6*);
7.29 (d, 1H, 4J = 2.4 Hz, H-8*); 4.20 (m, 2H + 2x1.15H, H-1‘);
3.55 (s, 3x1.15H, H-2*); 3.53 (s, 3H, H-2); 2.84 (m, 1H + 1.15H,
H-5‘); 2.39 – 2.34 (m, 2H + 2x1.15H, H-3‘); 1.98 – 1.91 (m, 2H +
2x1.15H, H-2‘) ppm.
1H-NMR (400 MHz, CDCl3):
δ = 7.80 (d, 1H, 3J = 8.6 Hz, H-1);
7.07 (d, 1H, 4J = 2.6 Hz, H-4); 6.99 (dd, 1H, 3J = 8.7 Hz, 4J = 2.6
(Supporting information, Figure 26).
NMR Spectra of levan. NMR spectra (1H-NMR, 13C-NMR,
DEPT135, COSY, HMBC, HSQC) were measured on a BRUKER
AVANCE 400 FT-NMR or a BRUKER AVANCE DMX 600 FT-NMR
Hz, H-2); 4.13 (t, 2H, 3J = 6.1 Hz, H-1’); 3.91 (s, 3H, H-9/10);
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 9
Please do not adjust margins

Please do not adjust margins
Chemical Science
Page 10 of 11
View Article Online
DOI: 10.1039/C8SC01244J
ARTICLE
Journal Name
22
M. Ortiz-Soto, E., C. Possiel, J. Gorl, A. Vogel, R. Schmiedel
and J. Seibel, Glycobiology, 2017, DOI:
10.1093/glycob/cwx050.
spectrometer at 25 °C. Proton chemical shifts (δ scale) are
expressed in parts per million (ppm) and were determined
relative to a residual protic solvent as an internal reference
1
23
24
25
26
27
28
29
C. P. Strube, A. Homann, M. Gamer, D. Jahn, J. Seibel and
D. W. Heinz, J. Biol. Chem., 2011, 286, 17593-17600.
L. K. Ozimek, S. Kralj, T. Kaper, M. J. E. C. van der Maarel
and L. Dijkhuizen, FEBS J., 2006, 273, 4104-4113.
H. Ban, M. Nagano, J. Gavrilyuk, W. Hakamata, T. Inokuma
and C. F. Barbas, Bioconjugate Chem., 2013, 24, 520-532.
R. Dahl, K. K. Baldridge and N. S. Finney, Synthesis, 2010,
13, 2292-2296.
S. Sato, K. Nakamura and H. Nakamura, ACS Chem. Biol.,
2015, 10, 2633-2640.
H. C. Kolb, M. G. Finn and K. B. Sharpless, Angew. Chem.
Int. Ed. Engl., 2001, 40, 2004-2021.
E. Raga-Carbajal, E. Carrillo-Nava, M. Costas, J. Porras-
Dominguez, A. Lopez-Munguia and C. Olvera,
Glycobiology, 2016, 26, 377-385.
D. Goldman, N. Lavid, A. Schwartz, G. Shoham, D. Danino
and Y. Shoham, J. Biol. Chem., 2008, 283, 32209-32217.
M. Vivoli, H. R. Novak, J. A. Littlechild and N. J. Harmer,
Jove-J. Vis. Exp., 2014, DOI: ARTN e51809
(CDCl3: δ = 7.26 ppm, MeOD: δ = 3.31 ppm). Data for H-NMR
spectra are listed as follows: chemical shift (δ ppm)
(multiplicity, integration, coupling constants (Hz), assigned
proton). Couplings are indicated as: s = singlet, d = doublet, t =
triplet, m = mulitplet. Carbon nuclear magnetic resonance (13C-
NMR) spectra were recorded with the same BRUKER
spectrometers at 100.9 and 150.9 MHz, respectively. Carbon
chemical shifts (δ scale) are indicated in ppm and calibrated to
the carbon resonance of the respective solvent (CDCl3: δ =
77.16 ppm, MeOD: δ = 49.00 ppm, DMSO-d6: δ = 2.50 ppm).
(Supporting information, Figure 8-11 and Supporting Table 1)
1
S. G. Burton, D. A. Cowan and J. M. Woodley, Nat.
Biotechnol., 2002, 20, 37-45.
30
31
2
3
M. T. Reetz, J. Am. Chem. Soc., 2013, 135, 12480-12496.
C. J. Noren, S. J. Anthonycahill, M. C. Griffith and P. G.
Schultz, Science, 1989, 244, 182-188.
4
5
6
V. W. Cornish, K. M. Hahn and P. G. Schultz, J. Am. Chem.
Soc., 1996, 118, 8150-8151.
I. Kwon and B. Yang, Ind. Eng. Chem. Res., 2017, 56, 6535-
6547.
10.3791/51809.
32
Y. R. Hua and A. H. Flood, Chem. Soc. Rev., 2010, 39, 1262-
1271.
33
E. Krissinel and K. Henrick, J. Mol. Biol., 2007, 372, 774-
797.
T. H. Wright, B. J. Bower, J. M. Chalker, G. J. L. Bernardes,
R. Wiewiora, W. L. Ng, R. Raj, S. Faulkner, M. R. J. Vallee,
A. Phanumartwiwath, O. D. Coleman, M. L. Thezenas, M.
Khan, S. R. G. Galan, L. Lercher, M. W. Schombs, S.
Gerstberger, M. E. Palm-Espling, A. J. Baldwin, B. M.
Kessler, T. D. W. Claridge, S. Mohammed and B. G. Davis,
Science, 2016, 354.
A. Yang, S. Ha, J. Ahn, R. Kim, S. Kim, Y. Lee, J. Kim, D. Soll,
H. Y. Lee and H. S. Park, Science, 2016, 354, 623-626.
K. Wals and H. Ovaa, Front. Chem., 2014, 2.
C. D. Spicer and B. G. Davis, Nat. Commun., 2014, 5.
J. M. Antos, J. M. McFarland, A. T. Iavarone and M. B.
Francis, J. Am. Chem. Soc., 2009, 131, 6301-6308.
K. L. Seim, A. C. Obermeyer and M. B. Francis, J. Am.
Chem. Soc., 2011, 133, 16970-16976.
H. Ban, J. Gavrilyuk and C. F. Barbas, J. Am. Chem. Soc.,
2010, 132, 1523-1525.
S. Meunier, E. Strable and M. G. Finn, Chem. Biol., 2004,
11, 319-326.
S. D. Tilley and M. B. Francis, J Am Chem Soc, 2006, 128,
1080-1081.
N. S. Joshi, L. R. Whitaker and M. B. Francis, J. Am. Chem.
Soc., 2004, 126, 15942-15943.
34
35
G. L. Miller, Anal. Chem., 1959, 31, 426-428.
D. A. Case, V. Babin, J. T. Berryman, R. M. Betz, Q. Cai, D.
S. Cerruti, T. E. Cheatham, T. A. Darden, R. E. Duke, H.
Gohlke, A. W. Goetz, S. Gusarov, N. Homeyer, P. Janowski,
J. Kaus, I. Kolossváry, A. Kovalenko, T. S. Lee, S. LeGrand,
T. Luchko, R. Luo, B. Madej, K. M. Merz, F. Paesani, D. R.
Roe, A. Roitberg, C. Sagui, R. Salomon-Ferrer, G. Seabra, C.
L. Simmerling, W. Smith, J. Swails, R. C. Walker, J. Wang,
R. M. Wolf, X. Wu and P. A. Kollman, University of
California, San Francisco, 2014.
7
8
9
10
36
37
M. D. Hanwell, D. E. Curtis, D. C. Lonie, T. Vandermeersch,
E. Zurek and G. R. Hutchison, J. Cheminform., 2012, 4, 17.
J. A. Maier, C. Martinez, K. Kasavajhala, L. Wickstrom, K. E.
Hauser and C. Simmerling, J. Chem. Theory Comput., 2015,
11, 3696-3713.
11
12
13
14
15
16
17
18
19
38
39
J. Wang, W. Wang, P. A. Kollman and D. A. Case, J. Mol.
Graph. Model, 2006, 25, 247-260.
J. Wang, R. M. Wolf, J. W. Caldwell, P. A. Kollman and D.
A. Case, J. Comput. Chem., 2004, 25, 1157-1174.
V. Lombard, H. G. Ramulu, E. Drula, P. M. Coutinho and B.
Henrissat, Nucleic Acids Res., 2014, 42, D490-D495.
A. Homann, R. Biedendieck, S. Gotze, D. Jahn and J. Seibel,
Biochem. J., 2007, 407, 189-198.
E. T. Öner, L. Hernandez and J. Combie, Biotechnol. Adv.,
2016, 34, 827-844.
M. E. Ortiz-Soto, M. Rivera, E. Rudino-Pinera, C. Olvera
and A. Lopez-Munguia, Protein Eng. Des. Sel, 2008, 21,
589-595.
20
21
G. M. T. Calazans, R. C. Lima, F. P. de Franca and C. E.
Lopes, Int. J. Biol. Macromol., 2000, 27, 245-247.
N. Elvassore, A. Bertucco and P. Caliceti, J. Pharm. Sci.,
2001, 90, 1628-1636.
10 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Page 11 of 11
Chemical Science
View Article Online
DOI: 10.1039/C8SC01244J
A flexible tyrosine-attached chemical loop prevents premature disengagement of growing
oligosaccharides and triggers the synthesis of high molecular weight polymer.