Protein arginine allylation and subsequent fluorophore targeting

Article abstract of DOI:10.1002/cbic.201300176

Protein allylation and fluorophore targeting: Arginine residues of the yeast nuclear ribonucleoprotein Npl3 were extensively modified by Hmt1-catalyzed allylation reaction with allyl-SAM as the allyl group donor. The allylated protein was further treated with tetrazole compounds under UV irradiation, leading to formation of protein-attached fluorescent products.

Full text of DOI:10.1002/cbic.201300176

CHEMBIOCHEM
COMMUNICATIONS
DOI: 10.1002/cbic.201300176
Protein Arginine Allylation and Subsequent Fluorophore
Targeting
Yixin Zhang,[a, c] Yanbo Pan,[b, c] Wei Yang,[a] Wujun Liu,[a] Hanfa Zou,[b] and
Zongbao K. Zhao*[a]
Protein posttranslational modifi-
cations, such as phosphoryla-
tion, acetylation, and methyla-
tion, play important roles in
almost all biological processes.
Protein methylation by a methyl-
transferase (MTase) transfers
a methyl group from S-adeno-
syl-l-methionine (SAM) to a sub-
strate protein and releases S-ad-
enosyl-l-homocysteine (SAH) as
a co-product (Scheme 1A). Me-
thylated proteins are key to sev-
eral cellular processes, including
signal transduction, transcrip-
tional regulation, DNA repair,
and RNA processes.[1] In contrast
to protein phosphorylation, it
remains a challenge to analyze
Scheme 1. Protein alkylation with MTase. A) MTase-catalyzed transmethylation from SAM, B) Chemical biology
methylated proteins and pep-
tides, largely because the
methyl group is small and
strategy for labeling MTase substrates with SAM analogues.
chemically inert. Although many analytical techniques have
been developed, difficulties still exist to achieve a systems-
level understanding of the methylproteome, especially methy-
lated proteins in low abundance.[2] To advance this area, SAM
analogues bearing reactive functionalities have recently been
explored to specifically label the methylation sites by using
natural[3] or engineered MTases.[4] Once these reactive function-
alities have been incorporated, further derivation can introduce
chemical entities to study methylation with readily available
analytical and biochemical tools (Scheme 1B).
ation substrates.[3,4,6] Because natural MTases have limited flexi-
bility for cofactor binding,[4] the structural diversity for func-
tional SAM analogues is limited. It is important to develop new
methods to expand the bioorthogonal labeling toolbox for
protein methylation studies. Recently, photoinducible tetra-
zole–alkene cycloaddition (“photo-click chemistry”) has been
developed as a bioorthogonal reaction for protein labeling in
living cells.[7] This reaction features full water compatibility, fast
reaction kinetics, and formation of fluorescent pyrazoline cyclo-
adducts. To apply this photo-click chemistry in a protein meth-
ylation study, it is possible to use of an allylated SAM analogue
(allyl-SAM) as a SAM surrogate for protein MTases. In this work,
we established an alternative procedure for the preparation of
allyl-SAM and demonstrated protein allylation by using the
natural yeast protein arginine MTase Hmt1 and its protein sub-
strate Npl3. We observed mono-allylation, as well as di-allyla-
tion, on Npl3 at almost all known methylation sites. The incor-
porated allyl group enabled subsequent fluorophore targeting
upon reaction with tetrazole compounds (Scheme 2).
Among the bioorthogonal reactions that have been devel-
oped,[5] only copper-catalyzed azide–alkyne cycloaddition has
been successfully applied in protein methylation studies, in
which a terminal alkyne group was incorporated into SAM ana-
logues to ensure labeling and detection of the protein methyl-
[a] Y. Zhang, Dr. W. Yang, W. Liu, Prof. Dr. Z. K. Zhao
Division of Biotechnology, Dalian Institute of Chemical Physics
116023 Dalian (China)
Although allyl-SAM and a number of other SAM analogues
have been prepared previously by a one-step alkylation of SAH
with activated electrophiles,[8] pursuing an alternative route re-
mains attractive in order to bypass the expensive starting ma-
terial, SAH. To prepare allyl-SAM on a larger scale, we estab-
lished an efficient route starting from readily available adeno-
sine (Scheme 3). The adenosine was first converted to an ace-
E-mail: zhaozb@dicp.ac.cn
[b] Y. Pan, Prof. Dr. H. Zou
Key Laboratory of Separation Sciences for Analytical Chemistry
Dalian Institute of Chemical Physics
116023 Dalian (China)
[c] Y. Zhang, Y. Pan
University of Chinese Academy of Sciences
19A Yuquanlu, 100049 Beijing (China)
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemBioChem 2013, 14, 1438 – 1443 1438

CHEMBIOCHEM
COMMUNICATIONS
www.chembiochem.org
Scheme 2. Strategy for fluorophore-targeting MTase substrates.
tonide-protected nucleotide 1, followed by the introduction of
a sulfur atom with thioacetate under Mitsunobu reaction con-
ditions to give thioester 2.[9] In parallel, N-Boc-g-tosyl-l-homo-
serine-tert-butylester was produced from Boc-Asp-tBu accord-
ing to a literature procedure.[10] In situ cleavage of the acetylth-
io functionality of thioester 2 with fresh CH3ONa in MeOH
under O2-free conditions was followed by coupling with N-
Boc-g-tosyl-l-homoserine-tert-butylester to give 3. There was
a strong tendency for disulfide formation in the presence of
O2.[9,10] The reaction time and the basicity of solution should
also be carefully controlled to avoid a MeOH-involved transes-
terification product, as it could render the downstream depro-
tection process problematic. Treatment of 3 with allylbromide
in the presence of AgClO4 gave allyl-SAM under acidic condi-
tions. This step involved efficient formation of the carbon–sul-
fonium bond by alkylation and removal of three different pro-
tecting groups. The synthesized SAM analogue, with two dia-
stereomers, was used directly without further purification. It
should be noted that compound 3 is a fully protected SAH,
which could also be deprotected to form SAH for preparation
of SAM analogues according to previously established proce-
dures.[8]
found in the yeast Saccharomyces cerevisiae, to demonstrate
the usefulness of allyl-SAM. Hmt1 can methylate both histone
and non-histone proteins and is responsible for the formation
of 89% of the asymmetric dimethylarginine and 66% of the
monomethylarginine in yeast.[11] As a type I PRMT, Hmt1 has
high homology with the rat PRMT1 and other mammalian
PRMTs.[12] Npl3 is a yeast mRNA-binding protein that has up to
17 potential arginine methylation sites.[1a,13] Therefore, it is an
interesting pair with which to explore protein allylation and
subsequent fluorophore targeting.
We cloned the corresponding genes, enabled heterogene-
ous production, and purified recombinant Hmt1 and Npl3
from engineered Escherichia coli cells. After incubation of
Hmt1, Npl3, and allyl-SAM at 308C for 20 h, the reaction mix-
ture was mixed with various tetrazole compounds and subject-
ed to 312 nm UV light irradiation. As fluorescent pyrazoline
can be generated from the photoinducible bioorthogonal reac-
tion between tetrazole and alkene, the samples were then sep-
arated by SDS-PAGE and analyzed by in-gel fluorescence analy-
sis. As shown in Figure 1A, fluorescent signals were observed
for the three samples in the presence of Hmt1, whereas negli-
gible signal was seen in the absence of Hmt1, suggesting that
both protein allylation and photoinducible tetrazole–alkene cy-
cloaddition occurred. It was clear that tetrazole 2 showed the
strongest fluorescence intensity,
We selected the predominant protein arginine methyltrans-
ferase (PRMT) Hmt1 and its representative substrate Npl3,
which might be due to its high
reaction rate or fluorescent
quantum yield.[7c] Thus, tetra-
zole 2 was used in the following
experiments.
As multiple modification sites
are available within Npl3, it was
necessary to pursue a more de-
tailed analysis. To determine the
effects of allyl-SAM concentra-
tion on Npl3 allylation, we per-
formed an assay in the presence
of 0 to 800 mm of allyl-SAM, fol-
lowed by a photo-click reaction
with tetrazole 2. The fluores-
cence intensity was used to
roughly estimate the extent of
protein
allylation.
Figure 2
Scheme 3. Synthesis of allyl-SAM.: a) p-TsOH, acetone, room temperature, 95%; b) PPh3, DEAD, AcSH, THF, À108C
then 08C, 77%; c) N-Boc-g-tosyl-homoserine-tert-butylester, CH3ONa, MeOH, À208C then room temperature, 32%;
d) allylbromide, AgClO4, 08C then room temperature, 55%.
shows that 400 mm allyl-SAM af-
forded the strongest fluores-
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemBioChem 2013, 14, 1438 – 1443 1439

CHEMBIOCHEM
COMMUNICATIONS
www.chembiochem.org
Figure 1. SDS-PAGE analysis of Hmt1-catalyzed allylation of Npl3. A) Fluorescence image, B) Coomassie Blue staining, C) Structures of tetrazole compounds
used in the photo-click reaction.
cence intensity. Thus, extensively modified Npl3 samples were
chose for additional characterization.
identify 15 allylated arginine residues. Among these, seven
sites that were previously identified as being dimethylated in
vivo were found to be diallylated in our studies. To the best of
our knowledge, this is the first time that protein arginine dia-
lkylation has been realized enzymatically by using a SAM ana-
logue as the donor of the alkyl group. Among the 17 methyla-
tion sites described previously, 13 sites were found allylated in
our studies as well; and allylation of the remaining four sites
were found in other samples in the presence of different
amounts of allyl-SAM. Two arginine residues, Arg370 and
Arg391, were found to be allylated here; methylation of these
residues has not previously been observed. These results indi-
cated that allyl-SAM can be used as an effective SAM surrogate
by Hmt1 for protein allylation, and the selectivity for methyla-
To further confirm that the allyl group of allyl-SAM was in-
corporated into the arginine residues of Npl3 and investigate
the selectivity for potential modification sites, labeled Npl3
samples were digested with trypsin and analyzed by high reso-
lution LC–MS/MS. It has been demonstrated that native Npl3
purified from yeast has 17 methylated arginine residues; dime-
thylation was observed at 10 sites, whereas both monomethy-
lation and dimethylation were observed for the other sites
(Table 1, Figure 3).[1a] Based on mass increments in the MS
spectra that are 40.0313 Da and 80.0626 Da higher than the
unmodified peptide alone for mono- and diallylation, respec-
tively. Through further MS/MS data analysis, we were able to
Figure 2. Allyl-SAM concentration dependence of Hmt1-catalyzed allylation of Npl3. A) Fluorescence image, B) Coomassie Blue staining, C) Relative fluores-
cence intensity (DI) of allylated Npl3 samples by using different concentrations of allyl-SAM.
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemBioChem 2013, 14, 1438 – 1443 1440

CHEMBIOCHEM
COMMUNICATIONS
www.chembiochem.org
Table 1. Allylation and methylation sites of Npl3 based on LC–MS/MS analysis and literature.
Modification
site[a]
Sample 1[b]
Run 1[c]
Sample 2
Run 1
Allylation
state
Methylation
state
Run 2
Run 2
1
2
3
4
5
6
7
8
Arg284
Arg288[d]
Arg290[d]
Arg294
Arg298
Arg302
Arg307
Arg314
Arg321
Arg329
Arg337[d]
Arg344[d]
Arg351
Arg358
Arg363
Arg370
Arg377
Arg384
Arg391
–
–
–
–
–
–
–
–
–
–
M
–
–
M
–
–
M
M
D
D
D
D
D
D
D
D
D
M
M
M
D
–
M
M
D
M
D
M
M
–
D
D
D
–
M
M
M
–
D
D
M
M
D
M
M
–
M/D
M/D
M/D
M
M/D
M/D
M/D
–
–
M
M
–
D
D
–
9
10
11
12
13
14
15
16
17
18
19
–
–
–
–
–
–
–
–
D
D
D
–
M
M
M
–
M
D
M
D
D
D
M
M
D
D
M
D
M
–
D
D
–
M/D
M/D
M/D
M/D
M/D
M/D
M
M
–
M
[a] Location of alkyl–arginine residues in Npl3 was shown as below. RSNR284GGFR288GR290GGFR294GGFR298GGFR302GGFSR307GGFGGPR314GGFGGPR321
-
GGYGGYSR329GGYGGYSR337GGYGGSR344GGYDSPR351GGYDSPR358GG YSR363GGYGGPR370NDYGPPR377GSYGGSR384 GGYDGPR391GDYGPPRDA. [b] Two sets of par-
allel samples were evaluated with Hmt1 (10 mm), Npl3 (10 mm), and allyl-SAM (400 mm). [c] All samples were run twice in parallel by LC–MS/MS; –/M/D rep-
resent no/monoalkyl/dialkyl modification. [d] Allylation of Arg288, Arg290, Arg337, and Arg344 was not observed in these sets of samples but were detect-
ed in the other samples when using different amounts of allyl-SAM.
Stable, less bulky SAM analogues are essential to study pro-
tein methylation behavior with native MTases. Among many
known SAM analogues, only the selenium-based analogue
SeAdoYn showed excellent compatibility with most wild-type
protein MTases for protein alkylation. However, the half-life of
SeAdoYn was only about 1.5 h at pH 7.5.[3c,16] Because allyl-
SAM is relative stable and the allyl group is relative small, allyl-
SAM has a high likelihood of being recognized as a SAM surro-
gate by wild-type MTases. Furthermore, the presence of an
allyl group can be easily detected by a visible fluorescent
signal introduced by a photo-click chemical reaction. In terms
of protein methylation and DNA/RNA methylation, the applica-
tion of allyl-SAM provides a terminal alkene functionality that
is orthogonal to other functional groups on these macromole-
Figure 3. MS/MS spectra of one peptide fragment (GGFRGGFRGGFR) detect-
ed by arginine monoallylation (*) and diallylation (**).
cules, offering many benefits for biochemical and biological
studies. For example, it can be used to find more protein
methylation substrates or to visualize methylated products.
tion was largely retained. By measuring the formation of SAH
by HPLC, the specific activities of Hmt1 in the presence of allyl-
SAM and SAM were determined as 0.46 molgÀ1 minÀ1 and
11.19 molgÀ1 minÀ1, respectively. Thus, the Hmt1–allyl-SAM pair
retained about 4% activity of that of the Hmt1–SAM pair in
terms of releasing the alkyl group. Hmt1, as a predominant
type I PRMT, is capable of catalyzing both monomethylation
and dimethylation of protein arginine residues. It is closely re-
lated to other members of the PRMT1 family by primary se-
quence as well as tertiary structure.[14] Previously, allyl-SAM has
been documented to efficiently allylate peptide substrates by
natural MTases belonging to the distinct SET-domain-contain-
ing protein lysine methyltransferases (PKMTs).[15] Thus, allyl-
SAM might be compatible with both PRMTs and PKMTs.
The photoinducible bioorthogonal strategy has already been
used to study protein modification such as lipidation[17] and to
spatiotemporally control imaging of newly synthesized pro-
teins.[7d] More interestingly, allyl-SAM might also be used to
tailor natural products by using the corresponding MTase
found in the biosynthetic pathway.
In summary, we developed an alternative procedure for the
preparation of allyl-SAM and found that arginine residues of
the yeast nuclear ribonucleoprotein Npl3 were extensively
modified by a Hmt1-catalyzed allylation reaction with allyl-SAM
as the allyl group donor. The allylated protein was further la-
beled by using a photoinducible cycloaddition reaction with
tetrazole compounds, leading to formation of protein-attached
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemBioChem 2013, 14, 1438 – 1443 1441

CHEMBIOCHEM
COMMUNICATIONS
www.chembiochem.org
diethyl ether (3ꢁ20 mL). The aqueous portion was lyophilized and
then redissolved in KH2PO4 buffer (pH 7.0). After adjusting the pH
to 4.8–5.2, the crude product was purified over an IRC 84 weak
acid resin, eluting with KH2PO4 buffer, 0.02m HCl, 0.04m HCl and
0.1m HCl, sequentially. The eluents were concentrated, and the
product was collected as a white solid. The concentration of allyl-
fluorescent products. We are now exploring allyl-SAM to study
other methylation events in the biological system.
Experimental Section
SAM was determined by UV absorption to be e260
=
General: All reagents and chemicals were obtained from commer-
cial suppliers in analytical or higher grade and were used without
further purification unless otherwise noted. Compound 2,[9] N-Boc-
g-tosyl-homoserine-tert-butylester,[10] and all tetrazole com-
pounds[18] were synthesized as previously described in literature.
The silica gel used for flash column chromatography was received
from Yantai Yuanbo Silica Gel Co., China. The IRC 84 weak acid
resin was purchased from the Chemical Plant of NanKai University,
China. TLC plates were visualized by using a combination of UV,
iodine, or staining with ninhydrin. Primers HMT1-F: GGAATTCCATAT-
GAGCAAGACAGCCGTGAAAGAT, HMT1-R: CCGCTCGAGTTAATGCAT-
TAAATAAGAACCTTCGTTTT, NPL3-F: GGAATTCCATATGTCTGAAGCT-
CAAGAAACTCAC, and NPL3-R: CCGCTCGAGCCTGGTTGGTGATCTTT-
CACGT (restriction sites underlined), were synthesized by Takara
Bio (Dalian, China).
15400 LmolÀ1 cmÀ1. The bioactive epimer was estimated to be
50% of the total diastereomeric mixture and was not further puri-
fied (32 mg, 55%): 1H NMR (400 MHz, D2O): d=2.35–2.41(m, 2H,
Hb), 3.55–3.59 (m, 2H, Hg), 3.90–3.95 (m, 2H, H5’), 4.09–4.14 (m,
1H, Ha), 4.14–4.19 (m, 2H, H1’’), 4.51–4.56 (m, 1H, H4’), 4.59–4.64
(m, 1H, H3’), 4.84 (dd, J1 =9.4 Hz, J2 =3.8 Hz, 1H, H2’), 5.58–5.68
(m, 2H, H3’’), 5.77–5.91 (m, 1H, H2’’), 6.14 (d, J=3.6 Hz, 1H, H1’),
8.46 (s, 1H, arom. H), 8.47 ppm (s, 1H, arom. H); 13C NMR (100 MHz,
D2O): d=27.6, 27.7, 38.1, 38.4, 43.7, 44.3, 45.4, 45.8, 53.9, 75.3, 75.7,
81.3, 81.6, 92.6, 92.7, 122.0, 125.2, 131.6, 146.3, 147.2, 150.7, 152.6,
173.0 ppm; ESI-MS m/z (calcd): allyl-SAM, 425.1590 (424.1602); [5’-
(prop-2-enyl)thio-5’-deoxyadenosine+H]+, 324.1158 (324.1130).
Cloning, expression, and purification of Hmt1 and Npl3: The
genes encoding HMT1 (YBR034C) and NPL3 (YDR432W) were ampli-
fied from S. cerevisiae BY4741 genome with primer pairs HMT1-F/
HMT1-R and NPL3-F/NPL3-R and were cloned into the Nde I-Xho I
site of expression plasmids pET15b and pET24b, respectively. The
resulting expression vectors pET15b-Hmt1 and pET24b-Npl3 were
transformed into E. coli BL21 (DE3). The corresponding proteins
Hmt1 and Npl3 were overexpressed, purified, and concentrated as
described previously.[19] The purified proteins were stored in ali-
quots at À808C in elution buffer (pH 8.0) with 10% glycerol.
NMR spectra were recorded at room temperature on a Bruker
DRX 400 instrument (400 MHz for 1H, 100 MHz for 13C). Accurate
mass measurements of synthesized compounds were performed
by using a Q-TOF Micro mass spectrometer (Waters) equipped with
a Z-spray ionization source. Analytical HPLC was conducted on
a Dionex Controller by using a C18 4.6 mmꢁ200 mm reverse phase
column with UV detection at 260 nm. The handheld UV lamp used
in the photo-click reaction was a Spectroline E-series ultraviolet
hand lamp (312 nm, 220 V). For in-gel fluorescence imaging, the
gel was illuminated from one side by using a handheld 365 nm UV
lamp. Fluorescence images and Coomassie Blue-stained protein
bands were recorded by gel documentation and analysis systems
(InGenius LHR, British). Mass spectrometric analysis of the enzymat-
ic reaction mixtures were carried out by an RP LC–MS/MS system
consisting of an LTQ-Orbitrap mass spectrometer (Thermo Fisher
Scientific) with a nanospray source.
Hmt1-catalyzed protein allylation of Npl3 in the presence of
Allyl-SAM: Enzymatic reactions were carried out in 20 mm MOPS,
120 mm NaCl, and 2 mm EDTA (pH 7.2) at 308C for 20 h. The reac-
tion mixture (200 mL) contained Hmt1 (10 mm), Npl3 (10 mm), and
allyl-SAM (400 mm). Control experiments were run in the absence
of Hmt1. With the exception of MS analysis, all reaction samples
were then subjected to the photo-click reaction as described
below.
Synthesis of 2’,3’-O-isopropylidene-S-adenosyl-N-Boc-l-homocys-
teine-tert-butylester (3): A fresh solution of CH3ONa (54 mg,
0.84 mmol) in MeOH (3 mL) was added to a solution of compound
2 (141 mg, 0.40 mmol) and N-Boc-g-tosyl-l-homoserine-tert-buty-
lester (180 mg, 0.42 mmol) in dry MeOH (5 mL) at À208C. The solu-
tion was stirred at À208C for 30 min and then at room tempera-
ture for an additional 15 h. The reaction was quenched by adding
aqueous KOAc solution (pH 4.0) and extracting with CHCl3. The or-
ganic layers were combined, and the solvents were removed in
vacuo. Purification of the crude product by flash chromatography
on silia gel with petrol ether/EtOAc (1:5 to 0:1) as the eluent yield-
ed SAH precursor 3 as a white solid (75 mg, 32.3%): 1H NMR
(400 MHz, CDCl3): d=1.38 (s, 3H), 1.40 (s, 9H), 1.42 (s, 9H), 1.59 (s,
3H), 1.75–2.05 (m, 2H), 2.49–2.57 (m, 2H), 2.71–2.87 (m, 2H), 4.20–
4.25 (m, 1H), 4.33–4.37 (m, 1H), 5.02 (dd, J1 =3.2, J2 =6.4 Hz, 1H),
5.49 (d, J=6.0 Hz, 1H), 6.07 (d, J=2.0 Hz, 1H), 7.92 (s, 1H),
8.32 ppm (s, 1H); 13C NMR (100 MHz, CDCl3): d=27.9, 29.6, 30.5,
30.9, 35.6, 36.8, 55.8, 82.3, 84.7, 86.3, 86.6, 89.1, 93.4, 117.0, 122.8,
142.6, 151.7, 155.6, 157.9, 158.3, 173.8 ppm.
Fluorophore targeting via a tetrazole–alkene photo-click reac-
tion: The enzymatic reaction mixtures were mixed with tetrazole
compounds (300 mm), irradiated with 312 nm UV light for 5 min at
room temperature, and additional incubation was carried out at
room temperature for 1.5 h without UV irradiation. Teterazole 2
(1 mm) was used to determine the effects of allyl-SAM concentra-
tion on Npl3 allylation. The samples were resolved by SDS-PAGE.
The protein gels were first subjected to fluorescence analysis and
then stained with Coomassie Blue.
HPLC analysis of the specific activity of Hmt1 toward allyl-SAM
and SAM: The activity assays were carried out by measuring SAH
concentrations in the reaction mixtures over time. Enzymatic reac-
tions were initiated by adding 10 mm Hmt1 to 200 mL assay buffer
containing 2 mm Npl3 and 200 mm allyl-SAM at 308C. Reaction mix-
tures were collected every 15 min, quenched by adding an equal
volume of chloroform, centrifuged, and filtered by using a 0.22 mm
filter unit. The samples were analyzed on a SinoChrom ODS-BP C18
column (5 mm, 4.6 mmꢁ200 mm), eluting as described in the litera-
ture.[20] For activity assays in the presence of SAM, only Hmt1
(1.0 mm) was used to ensure similar amounts of SAH in the reaction
mixtures. Control experiments were run in the absence of Npl3.
Each sample was analyzed three times. Samples from at least five
time points were analyzed for each data set to calculate enzymatic
activity. The specific activity was calculated as v/c (v: the initial ve-
Synthesis of allyl-SAM: Allyl bromide (2.27 mL, 11.0 mmol) was
added dropwise to a stirred solution of compound 3 (80 mg,
0.14 mmol) in formic acid/acetic acid (7 mL, 1:1) at 08C; AgClO4
(132 mg, 0.55 mmol) was added subsequently. The solution was
further stirred in the dark at room temperature for 24 h. The reac-
tion was quenched by adding water (15 mL) and was washed with
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemBioChem 2013, 14, 1438 – 1443 1442

CHEMBIOCHEM
COMMUNICATIONS
www.chembiochem.org
locity of SAH formation [mmolmLÀ1 minÀ1], c: concentration of
Hmt1 [mgmLÀ1]).
Sherman, Mol. Microbiol. 2007, 65, 590–606; c) M. Mohan, H.-M. Herz,
A. Shilatifard, Cell 2012, 149, 498–498.e1; d) K. Nimura, K. Ura, Y.
Kaneda, J. Mol. Med. 2010, 88, 1213–1220.
Methods for mass spectroscopic analysis: The enzymatic reaction
mixtures were first digested with trypsin at 378C for 16–20 h. After
desalting, the digestion products were then analyzed by an RP LC–
MS/MS system consisting of an LTQ-Orbitrap mass spectrometer
with a nanospray source. A capillary column was first manually
pulled to a fine point as a spray tip and then was packed with C18
AQ beads (3 mm, 120 ꢂ, Michrom Bioresources). Formic acid (0.1%,
v/v) in water and 0.1% (v/v) formic acid in CH3CN were applied as
the mobile phase. Gradient elution from 5 to 35% (v/v) of the
0.1% (v/v) formic acid in CH3CN in 30 min was performed to elute
each sample. All MS and MS/MS spectra were acquired in the data-
dependent mode with the ten most intense ions fragmented by
CID.
[2] M. A. Erce, C. N. I. Pang, G. Hart-Smith, M. R. Wilkins, Proteomics 2012,
12, 564–586.
[3] a) T. Osborne, R. L. W. Roska, S. R. Rajski, P. R. Thompson, J. Am. Chem.
Soc. 2008, 130, 4574–4575; b) S. Willnow, M. Martin, B. Luescher, E.
Weinhold, ChemBioChem 2012, 13, 1167–1173; c) W. Peters, S. Willnow,
M. Duisken, H. Kleine, T. Macherey, K. E. Duncan, D. W. Litchfield, B.
Luscher, E. Weinhold, Angew. Chem. 2010, 122, 5296–5299; Angew.
Chem. Int. Ed. 2010, 49, 5170–5173.
[4] a) R. Wang, W. H. Zheng, H. Q. Yu, H. T. Deng, M. K. Luo, J. Am. Chem.
Soc. 2011, 133, 7648–7651; b) K. Islam, W. Zheng, H. Yu, H. Deng, M.
Luo, Acs Chem. Biol. 2011, 6, 679–684.
[5] E. M. Sletten, C. R. Bertozzi, Angew. Chem. 2009, 121, 7108–7133;
Angew. Chem. Int. Ed. 2009, 48, 6974–6998.
[6] M. Luo, ACS Chem. Biol. 2012, 7, 443–463.
[7] a) W. Song, Y. Wang, J. Qu, Q. Lin, J. Am. Chem. Soc. 2008, 130, 9654–
9655; b) W. Song, Y. Wang, J. Qu, M. M. Madden, Q. Lin, Angew. Chem.
2008, 120, 2874–2877; Angew. Chem. Int. Ed. 2008, 47, 2832–2835; c) Y.
Wang, W. Song, W. J. Hu, Q. Lin, Angew. Chem. 2009, 121, 5434–5437;
Angew. Chem. Int. Ed. 2009, 48, 5330–5333; d) W. Song, Y. Wang, Z. Yu,
C. I. R. Vera, J. Qu, Q. Lin, Acs Chem. Biol. 2010, 5, 875–885; e) Z. Yu, L. Y.
Ho, Q. Lin, J. Am. Chem. Soc. 2011, 133, 11912–11915.
[8] C. Dalhoff, G. Lukinavicius, S. Klimasauakas, E. Weinhold, Nat. Protoc.
2006, 1, 1879–1886.
[9] M. Pignot, G. Pljevaljcic, E. Weinhold, Eur. J. Org. Chem. 2000, 549–555.
[10] C. Dalhoff, M. Hꢃben, T. Lenz, P. Poot, E. Nordhoff, H. Kçster, E. Wein-
hold, ChemBioChem 2010, 11, 256–265.
[11] J. K. K. Low, M. R. Wilkins, FEBS J. 2012, 279, 4423–4443.
[12] V. H. Weiss, A. E. McBride, M. A. Soriano, D. J. Filman, P. A. Silver, J. M.
Hogle, Nat. Struct. Biol. 2000, 7, 1165–1171.
For identification, the MS/MS spectra in one acquired raw file was
converted to a single .mgf file by using MSQuant (http://msquan-
t.alwaysdata.net/msq). These .mgf files were queried against the
NPL3 protein database by using Mascot (Matrix Science). FDRs
given here are those originating from the internal Mascot decoy
database search function. Peptides with FDR<1% (rank 1 and
bold red) and Mascot ion scores>10 were accepted for identifica-
tion. The .mgf files were searched by using fully tryptic cleavage
and as many as five missed cleavage site; oxidation of methionine
(+15.9949 Da), monoallylation of arginine (+40.0313 Da), and dia-
llylation of arginine (+80.0626 Da) were set as variable modifica-
tions. The mass tolerances were 10 ppm for parent masses and
0.8 Da for fragment masses.
[13] C. M. Wong, H. M. V. Tang, K. Y. E. Kong, G. W. O. Wong, H. Qiu, D. Y. Jin,
A. G. Hinnebusch, Nucleic Acids Res. 2010, 38, 2217–2228.
[14] X. Zhang, X. D. Cheng, Structure 2003, 11, 509–520.
[15] R. Wang, G. Ibꢄnez, K. Islam, W. H. Zheng, G. Blum, C. Sengelaub, M. K.
Luo, Mol. BioSyst. 2011, 7, 2970–2981.
[16] I. R. Bothwell, K. Islam, Y. L. Chen, W. H. Zheng, G. Blum, H. T. Deng, M. K.
Luo, J. Am. Chem. Soc. 2012, 134, 14905–14912.
[17] W. Song, Z. Yu, M. M. Madden, Q. Lin, Mol. BioSyst. 2010, 6, 1576–1578.
[18] S. Ito, Y. Tanaka, A. Kakehi, K. Kondo, Bull. Chem. Soc. Jpn. 1976, 49,
1920–1923.
Acknowledgements
We thank Dr. Yongjin Zhou, Lei Wang, Zhiwei Zhu, Xinping Lin,
and Dr. Sufang Zhang for useful suggestions. This work was sup-
ported by the National Basic Research and Development Pro-
gram of China (No. 2013CB911204).
[19] J. Wang, H. Tan, Z. Zhao, Protein Expression Purif. 2007, 53, 97–103.
[20] C. Birsan, S. C. Litescu, G. L. Radu, Anal. Lett. 2010, 43, 793–803.
Keywords: bioorthogonal
reaction
·
cycloaddition
·
fluorescence labeling
·
methyltransferase
·
protein
methylation · S-adenosyl-l-methionine
Received: March 25, 2013
[1] a) A. E. McBride, J. T. Cook, E. A. Stemmler, K. L. Rutledge, K. A. McGrath,
J. A. Rubens, J. Biol. Chem. 2005, 280, 30888–30898; b) B. Polevoda, F.
Published online on July 19, 2013
ꢀ 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemBioChem 2013, 14, 1438 – 1443 1443