Modulation of rat liver urea cycle and related ammonium metabolism by sex and cafeteria diet

Article abstract of DOI:10.1039/c5ra25174e

High-energy (hyperlipidic) cafeteria diets induce insulin resistance limiting glucose oxidation, and lower amino acid catabolism. Despite high amino-N intake, amino acids are preserved, lowering urea excretion. We analysed how energy partition induced by cafeteria diet affects liver ammonium handling and urea cycle. Female and male rats were fed control or cafeteria diets for 30 days. There was a remarkable constancy on enzyme activities and expressions of urea cycle and ammonium metabolism. The key enzymes controlling urea cycle: carbamoyl-P synthase 1, arginino-succinate synthase and arginase expressions were decreased by diet (albeit more markedly in males), and their activities were correlated with the gene expressions. The effects observed, in ammonium handling enzyme activities and expressions behaved in a way similar to that of the urea cycle, showing a generalized downregulation of liver amino acid catabolism. This process was affected by sex. The different strategies of amino-N handling by females and males further modulated the preservation of 2-amino N under sufficient available energy. The effects of sex were more marked than those of diet were, since different metabolism survival strategies changed substrate partition and fate. The data presented suggest a lower than expected N flow to the liver, which overall importance for amino acid metabolism tends to decrease with both cafeteria diet and female sex. Under standard conditions, liver availability of ammonium was low and controlled. The situation was unchanged (or even lowered) in cafeteria-fed rats, ultimately depending on intestinal amino acid catabolism.

Full text of DOI:10.1039/c5ra25174e

RSC Advances
View Article Online
View Journal | View Issue
PAPER
Modulation of rat liver urea cycle and related
ammonium metabolism by sex and cafeteria diet
Cite this: RSC Adv., 2016, 6, 11278
Silvia Agnelli,a Sofıa Arriaran,a Laia Oliva,a Xavier Remesar,abc
´
´
abc
Jose-Antonio Fernandez-Lopezabc and Maria Alemany
*
´
´
´
`
High-energy (hyperlipidic) cafeteria diets induce insulin resistance limiting glucose oxidation, and lower
amino acid catabolism. Despite high amino-N intake, amino acids are preserved, lowering urea
excretion. We analysed how energy partition induced by cafeteria diet affects liver ammonium handling
and urea cycle. Female and male rats were fed control or cafeteria diets for 30 days. There was
a remarkable constancy on enzyme activities and expressions of urea cycle and ammonium metabolism.
The key enzymes controlling urea cycle: carbamoyl-P synthase 1, arginino-succinate synthase and
arginase expressions were decreased by diet (albeit more markedly in males), and their activities were
correlated with the gene expressions. The effects observed, in ammonium handling enzyme activities
and expressions behaved in
a way similar to that of the urea cycle, showing a generalized
downregulation of liver amino acid catabolism. This process was affected by sex. The different strategies
of amino-N handling by females and males further modulated the preservation of 2-amino N under
sufficient available energy. The effects of sex were more marked than those of diet were, since different
metabolism survival strategies changed substrate partition and fate. The data presented suggest a lower
than expected N flow to the liver, which overall importance for amino acid metabolism tends to
decrease with both cafeteria diet and female sex. Under standard conditions, liver availability of
ammonium was low and controlled. The situation was unchanged (or even lowered) in cafeteria-fed rats,
ultimately depending on intestinal amino acid catabolism.
Received 26th November 2015
Accepted 12th January 2016
DOI: 10.1039/c5ra25174e
www.rsc.org/advances
however, the progressive decrease in androgens with age12 is
compounded by the increase in glucocorticoids parallel to the
development of MS.13 Androgen secretion is largely blocked by
glucocorticoids, resulting in increased fat storage (obesity, liver
steatosis) and a marked alteration of glucose and lipid metab-
olism, especially in adipose tissue, muscle and liver.14
Our knowledge of how sex inuences the deleterious effects
of excess energy (lipid) intake with respect to energy expendi-
ture, and inammation is, however, rather sketchy, since sex-
related differences have been observed, but most mechanisms
remain to be fully claried.15,16
The liver plays a key role in nutrient partition and in the
maintenance of body energy homeostasis. It receives, via porta
vein, most of the nutrients extracted from the diet. However,
a large part of the siing has been done, already, by other
splanchnic bed organs, especially the intestine,17 and, probably,
mesenteric/omental adipose tissue.18 In any case, the liver
controls the ow of glucose into the systemic blood, and retains
(or metabolizes) many amino acids and short-chain fatty acids.
A sustained excess of nutrients and a critical failure of the
insulin system may lead to a generalized loss of effectivity of the
liver, oen provoking hepatic steatosis,19 associated to insulin
resistance.20 Loss of insulin function resulting also in lower
amino acid utilization.21 The liver condition may even develop
Introduction
There is a considerable body of knowledge on the effect of diet
on the substrate energy utilization under different physiological
conditions. A growing consensus attributes the wide extension
of metabolic syndrome (MS) to sustained excess energy (mainly
lipid) diets on the ponderostat system.1 The most apparent
consequence of excess energy being the development of obesity2
and their MS-related co-morbidities, especially insulin resis-
tance3 and the alteration of blood lipid transport.4
High-energy diets show markedly different effects depending
on the sex (and age) of the subjects.5 In general, females are
more resistant to the development of MS,6 in part because of the
protective effects of oestrogen,7 which hampers the obesogenic
effects of inammation and insulin resistance,8 limiting the full
development of obesity.9 There is a limited antagonism between
glucocorticoids and oestrogens,10 which tend to counteract the
increase in fat stores elicited by glucocorticoids.11 In males,
aDepartment of Nutrition and Food Science, Faculty of Biology, University of Barcelona,
Av. Diagonal 643, 08028 Barcelona, Spain. E-mail: malemany@ub.edu
bInstitute of Biomedicine, University of Barcelona, Av. Diagonal, 643, 08028 Barcelona,
Spain
cCIBER-OBN Research Web, Barcelona, Spain
11278 | RSC Adv., 2016, 6, 11278–11288
This journal is © The Royal Society of Chemistry 2016

View Article Online
Paper
RSC Advances
in a failure to detoxify the portal-carried ammonium, which may the food ingested) was (mean values, expressed as energy
result lethal.22 Of all these critical functions, the liver – in fact content): carbohydrate 47%, protein 12% and lipid 41%. The
the coordinate work of intestine and liver—plays an essential simplied cafeteria diet induced a signicant increase in body
role in the disposal of excess amino N and ammonia. The main fat, in line with previous studies on metabolic syndrome.32,36
pathway for excess N elimination is the urea cycle,23,24 which has The rats were killed, under isourane anaesthesia, by exsan-
been assumed to be fully operative only in liver.25 However, both guination (aortic puncture using a large dry-heparinized
intestine and kidney have functional (albeit complementary) syringe) at the beginning of a light cycle. Then, they were
urea cycles.26,27 We have found, recently, a robust presence of rapidly dissected, and two lobes of the liver were excised,
urea cycle in white adipose tissue,28 which is unaffected by sex blotted, and frozen in liquid nitrogen. These samples were
and anatomical site.29
weighed and ground under liquid nitrogen. The coarse powder
High-fat diets, such as the cafeteria diets,30 have been was aliquoted and stored at ꢁ80 C until processed. Later, the
known, to decrease the operation of the urea cycle in liver,31 liver remains were dissected to measure its full weight. Blood
with lower overall urinary excretion of N.32 This decreased was centrifuged to obtain plasma, which was frozen and stored
excretion, in spite of maintained or increased protein intake, is as well.
ꢀ
not paralleled by an increased deposition of protein (or faecal
excretion).32 In fact, nitrogen balances show that a signicant
Blood plasma parameters
portion of the N excreted is not accounted for.33 It has been
Plasma samples were used to measure glucose (kit #11504,
speculated that it may be justied (at least partly) by respiratory
Biosystems, Barcelona Spain), lactate (kit #1001330, Spinreac,
loss of nitric oxide34 or, even, release of nitrogen gas.35
Sant Esteve de Bas, Spain), triacylglycerols and total cholesterol
The control role of the liver on the disposal of ammonium-N
(Biosystems kits #11828, and #11505, respectively). Urea was
and excess amino-N, is a critical process for the maintenance of
measured with a chemical method (kit # 11537; Biosystems).
N homeostasis. Thus, alteration of liver metabolic function
Amino acids were analysed individually with an amino acid
induced by diet necessarily inuences N homeostasis, albeit in
analyser (LKB-Alpha-plus, Uppsala, Sweden) using plasma
ways so far not known. We assume that this dramatic change
samples deproteinized with chilled acetone.37 Since the method
may contribute to the pathogenesis of MS. In the present study,
used did not provide reliable data for several amino acids (i.e.
we analysed the effects of a relatively short (one-month) expo-
Gln, Trp, Cys, Asn), we decided to present only the partial sum
sure of adult rats (female and male) to a cafeteria diet. The
of the other amino acids as a single indicative value.
objective was to check how the initial phase of development of
MS affects, differentially (in adults), both sexes in the critical
function of liver as main site for disposal of ammonium
Enzyme activity analyses
through the urea cycle.
Homogenate preparation. Frozen liver samples were further
homogenized, using a tissue disruptor (Ultraturrax IKA-T10, Ika
Werke, Staufen, Germany). Homogenates for arginino-
succinate synthase and ornithine carbamoyl-transferase
activity measurement were prepared using 10 volumes of chil-
led 70 mM hepes buffer pH 7.4 containing 1 mM dithiothreitol
(Sigma, St Louis MO USA), 50 mM KCl, 1 g Lꢁ1 Triton X-100
(Sigma), and 1 g Lꢁ1 lipid-free bovine serum albumin (Sigma).
Homogenates for carbamoyl-P synthase analysis were prepared
with 10 volumes of chilled 50 mM triethanolamine buffer pH
8.0 containing 1 mM dithiothreitol, 0.5 g Lꢁ1 Triton X-100, 1 g
Lꢁ1 lipid-free bovine serum albumin and 10 mM magnesium
acetate. Homogenates for the analyses of the other enzymes
Experimental
Ethics statement
All animal handling procedures and the experimental setup
were in accordance with the animal handling guidelines of the
corresponding European and Catalan Authorities. The
Committee on Animal Experimentation of the University of
Barcelona approved the present study.
Experimental design and animal handling
Nine week old female and male Wistar rats (Harlan Laboratory were prepared with 10 volumes of chilled Krebs-Ringer bicar-
Models, Sant Feliu de Codines, Spain) were used. The rats (N ¼ bonate buffer pH 7.4 containing 1 g Lꢁ1 Triton X-100, 1 mM
6) were kept in same-sex two-rat cages with wood shards for dithiothreitol and 1 g Lꢁ1 lipid-free bovine serum albumin. The
bedding. The animals were maintained in a controlled animal homogenates were coarsely ltered through nylon-hose to
room (lights on from 08:00 to 20:00; 21.5–22.5 ꢀC; 50–60% eliminate large debris. They were kept on ice and used for
humidity). Two groups for each sex were randomly selected and enzyme activity analyses within 2 h. Tissue protein content was
were fed ad libitum, for 30 days, with either normal rat chow estimated with the Lowry method,38 using the corresponding
(Harlan #2014) or a simplied cafeteria diet36 made of chow homogenization buffer (containing albumin) as blank. Enzyme
ˆ ´
pellets, plain cookies, with liver pate, bacon, whole milk con- activities were expressed per unit of protein weight. The
taining 300 g Lꢁ1 sucrose and a mineral and vitamin supple- methods used were largely based in our parallel development of
ment. Food/nutrient consumption was measured as previously methods for analysis on white adipose tissue, extensively
described.30 Diet intake composition (expressed as energy described in a previous publication.28
content) was: carbohydrate 67%, protein 20%, and lipid 13% for
Carbamoyl-P synthase 1. Carbamoyl-P synthase 1 activity was
controls; that of rats fed the cafeteria diet (i.e. aer computing estimated from the incorporation of 14C-bicarbonate (Perkin
This journal is © The Royal Society of Chemistry 2016
RSC Adv., 2016, 6, 11278–11288 | 11279

View Article Online
RSC Advances
Paper
Elmer, Bad Neuheim, Germany) into carbamoyl-P using
a method previously described by us.39 Succinctly, we measured
the incorporation of label into carbamoyl-P by the activity of the
enzyme on ammonium carbonate in the presence of N-acetyl-
glutamate (Sigma) and ushing out all remaining bicarbonate
label with a stream of unlabelled CO2.
Arginino-succinate lyase. Arginino-succinate lyase activity
was measured from the breakup of arginino-succinate to yield
fumarate and arginine. This amino acid was analysed in
a second reaction, using arginase to form ornithine and urea,
which was measured using a sensitive chemical method.
Aliquots of 38 mL of homogenates were mixed with 38 mL of 66
mM hepes buffer pH 7.4, containing arginino-succinate
(Sigma), at a nal concentration 2 mM. Incubations were
Ornithine carbamoyl transferase. Ornithine carbamoyl
transferase activity was measured from the reaction of
condensation of carbamoyl-P and 14C-ornithine to yield
14C-citrulline. Aliquots of 25 mL of homogenates were mixed
with 50 mL of 70 mM hepes buffer pH 7.4 containing carbamoyl-
P, ornithine (all from Sigma), and 14C-ornithine (Perkin-Elmer);
ꢀ
carried out at 37 C for 0, 2.5, 5 and 10 min. The reaction was
stopped by the addition of 40 mL of 30 g Lꢁ1 perchloric acid.
The tubes were vortexed and brought to pH 8–9 with 10 mL of
100 g Lꢁ1 KOH, 80 g Lꢁ1 HKCO3. The tubes were centrifuged for
15 min in the cold at 8000 ꢂ g. Aliquots of 100 mL of the
supernatants were mixed with 50 mL of the reacting mixture,
containing 66 mM hepes buffer pH 7.5 (to achieve a nal pH
8.5), MnCl2 and arginase (rat liver, Lee Biosolutions, St Louis,
nal concentrations were 9 mM, 13 mM and 1 kBq mLꢁ1
,
respectively. The reaction was started with the homogenate, and
was carried out at 37 ꢀC during 0, 0.5,1 and 2 min. The reaction
was stopped by introducing 75 mL aliquots in tubes, kept on ice,
containing 100 mL of chilled acetone. Aer centrifugation, the
clear supernatants were dried in a vacuum-centrifuge (Thermo
Scientic, Waltham, MA USA). The residues were dissolved in 25
mL of water; they were run on TLC silica gel plates (200 mm;
MO USA). The nal concentrations were 7 mM and 17 mkat Lꢁ1
respectively. Arginase already in the buffer containing Mn2+
,
,
was previously activated for 5 min at 55 ꢀC. The reaction
developed for 30 min at 37 ꢀC, and was stopped by the addition
of 35 mL of 160 g Lꢁ1 perchloric acid. The tubes were centri-
fuged in the cold for 15 min at 8000 ꢂ g. The acidic superna-
tants (175 mL) were used for the estimation of urea. They were
mixed with 600 mL of 90 g Lꢁ1 H2SO4 containing 270 g Lꢁ1
H3PO4; then 10 mL of 30 g Lꢁ1 of 1-phenyl-2-oxime-1,2-
propanodione (Sigma) in absolute ethanol were added. The
reaction was developed at 100 ꢀC for 30 min in a dry block
heater. The absorbance of the tubes (including standards and
blanks) was measured at 540 nm with a plate reader. Arginase
effectivity (using the method explained above) was tested in all
batches. In all cases, conversion of arginine to urea was 100%
(i.e. there was a full coincidence of the standard curves for both
urea and arginine).
¨
Macherey-Nagel, Duren, Germany). Standards of ornithine and
citrulline were included in one of the lanes of each plate. The
plates were developed with trichloromethane: methanol: acetic
acid (1 : 2 : 2 by volume). Standards were revealed with
a ninhydrin spray. The lanes were cut in 1 cm pieces and
counted. The label in the citrulline spot was expressed as
a percentage of the total label counted in each TLC lane. These
data allowed the calculation of newly formed citrulline at each
incubation time. The V0 value for each sample was plotted, and
was considered to represent the value of Vmax under the
conditions tested.
Arginino-succinate synthase. Arginino-succinate synthase
activity was measured from the reaction of condensation of
aspartate with citrulline in the presence of ATP to yield
arginino-succinate. Homogenates (55 mL) were mixed with 30 mL
of 70 mM hepes buffer pH 7.4, containing ATP-Na2, MgCl2,
citrulline and aspartate (Sigma); nal concentrations were 10
mM, 5 mM, 3 mM, and 2.5 mM, respectively. Theꢀreaction was
started with aspartate, and was carried out at 37 C. The reac-
tion was stopped with 40 mL of 30 g Lꢁ1 perchloric acid. The
tubes were vortexed and neutralized (pH 7–8) with 10 mL of 100 g
Lꢁ1 KOH containing 62 g Lꢁ1 KHCO3. The tubes were vortexed
again and centrifuged in the cold 15 min at 8000 ꢂ g. The
aspartate remaining in the supernatants was measured by
transamination to oxaloacetate, which was reduced by malate
dehydrogenase and NADH. Briey, 20 mL of the supernatants
were brought up to 300 mL in 96-well plates, with 66 mM
phosphate buffer pH 7.4 containing NADH, 2-oxoglurarate,
aspartate transaminase (pig heart) and malic acid dehydroge-
nase (pig heart) (all from Sigma); nal concentrations were,
respectively, 0.25 mM, 0.2 mM, 20 mkat Lꢁ1 and 17 mkat Lꢁ1. The
plates were read at 340 nM in a plate reader (Biotek, Winoosky,
VT USA) at intervals of 30 s during 20 min. The fall in NADH was
used to determine the levels of aspartate at each incubation
time. Its disappearance (versus time zero levels) was used to
calculate the aspartate incorporated into arginino-succinate by
the enzyme.
Arginase. Arginase activity was measured through the esti-
mation of the urea produced by the activity of the enzyme on
arginine in the presence of Mn2+ ions.40,41 Aliquots of 20 mL of
homogenates were mixed with 5 mL of MnCl2 in water; nal
concentration 10 mM. The tubes were heated for 5 min at 55 ꢀC
to activate arginase41,42 Aer the temperature was brought down
to 37 ꢀC, the reaction began with the addition of 75 mL of
arginine (Sigma); nal concentration 78 mM. Incubations were
carried out for 0, 8 and 16 min at 37 ꢀC. The reaction was
stopped by the addition of 35 mL 160 g Lꢁ1 perchloric acid. The
tubes were centrifuged 15 min in the cold at 8000 ꢂ g. Urea was
measured as described above.
Glutamine synthetase. Glutamine synthetase, activity was
estimated using a method we had used previously,43 based on
the reaction of glutamine and hydroxylamine in the presence of
ADP, Mn2+ and arsenate to yield g-glutamyl-hydroxamate. The
addition of Fe(NO3)3 in trichloroacetic acid results in the
development of colour, read at 500 nm using a plate reader.
Serine dehydratase. Serine dehydratase activity was analysed,
by measuring the pyruvate freed by the enzyme in the presence
of pyridoxal-P.44 This reaction was coupled with the reduction of
pyruvate to lactate with lactate dehydrogenase, measuring the
decrease in NADH,45 by UV spectrometry using a plate reader.
11280 | RSC Adv., 2016, 6, 11278–11288
This journal is © The Royal Society of Chemistry 2016

View Article Online
Paper
AMP deaminase. AMP deaminase activity was estimated by
the determination of the ammonium released by the action of
the enzyme on AMP, in the presence of KCl, yielding IMP.46 The
ammonium evolved was estimated with the classical Berthelot
indophenol reaction,47 in which indophenol was formed by
reaction of ammonium with phenol in the presence of an
oxidative agent (hypochlorite) and nitroprusside as catalyser.
RSC Advances
charge control gene.49 The data were expressed as the number of
transcript copies per gram of protein in order to obtain
comparable data between the groups. The genes analysed, and
a list of primers used, are presented in Table 1.
The possible contamination of RNA with DNA was checked,
before PCR cycling, by charging a number of samples of each
batch with known internal standards of RNA. No spurious
signals were observed. All the primers used for measurement of
the enzyme gene expressions were checked, with Northern blots
of the PCR-synthesized cDNAs. In all cases, the cDNAs obtained
had the expected molecular weights.
Total DNA was estimated with a uorimetric method.50
Approximate cellularity was calculated, assuming that the mean
mammalian cell DNA content was 6 pg.51 Mean cell volume was
estimated from liver weight, liver density: 1.1 g mLꢁ1, and the
estimated number of cells.
Gene expression analysis
Total tissue RNA was extracted from frozen samples (about 30
mg) using the GenEluteTM (Sigma-Aldrich, St Louis MO USA)
procedure, and was quantied in a ND-100 spectrophotometer
(Nanodrop Technologies, Wilmington DE USA). RNA samples
were reverse transcribed using the MMLV reverse transcriptase
(Promega, Madison, WI USA) system and oligo-dT primers. The
data were also used to determine the total RNA content of the
tissue in order to establish quantitative comparisons between
different gene expressions.
Statistics
Two-way ANOVA comparisons between groups, correlations and
curve tting (including Vi estimations) were carried out with the
Prism 5 program (GraphPad Soware, San Diego CA USA).
Real-time PCR (RT-PCR) amplication was carried out using
10 mL amplication mixtures containing Power SYBR Green PCR
Master Mix (Applied Biosystems, Foster City, CA USA), 10 ng of
reverse-transcribed RNA and primers (300 nM). Reactions were run
on an ABI PRISM 7900 HT detection system (Applied Biosystems)
using a uorescent threshold manually set to 0.15 for all runs.
A semi-quantitative approach for the estimation of the
Results
General parameters
concentration of specic gene mRNAs per unit of tissue or Table 2 presents the rat weights, and liver size and composition
protein weight was used.48 Cyclophyllin A (Ppia) was used as of the four groups of rats. As expected, body and liver weight
Table 1 Primer sequences used in the analysis of liver gene expressions
Protein
Gene
Cps1
Otc
EC number
6.3.4.16
2.1.3.3
6.3.4.5
4.3.2.1
3.5.3.1
2.3.1.1
1.14.13.39
6.3.1.2
3.5.1.2
1.4.1.3
—
Primer sequence
bp
Carbamoyl-phosphate synthase [ammonia], mitochondrial type 1
Ornithine carbamoyl-transferase
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
50 > 30
30 > 5
ACCCATCATCCCCTCTGACT
ACACGCCACCTCTCCAGTAG
CTTGGGCGTGAATGAAAGTC
ATTGGGATGGTTGCTTCCT
CAAAGATGGCACTACCCACA
GTTCTCCACGATGTCAATGC
CCGACCTTGCCTACTACCTG
GAGAGCCACCCCTTTCATCT
GCAGAGACCCAGAAGAATGG
GTGAGCATCCACCCAAATG
GCAGCCCACCAAAATCAT
CAGGTTCACATTGCTCAGGA
CAAGTCCTCACCGCCTTTT
GACATCACCGCAGACAAACA
AACCCTCACGCCAGCATA
CTGCGATGTTTTCCTCTCG
CCGAAGGTTTGCTCTGTCA
AGGGCTGTTCTGGAGTCGTA
GGACAGAATATCGGGTGCAT
TCAGGTCCAATCCCAGGTTA
AAGCACGAATGGGTAACAGC
TCCAAAGCACCAAACTCCTC
CGGCTTCTCTCACAAGGTG
CGGATGTCGTTACCCTCAG
CTGAGCACTGGGGAGAAAGGA
GAAGTCACCACCCTGGACA
118
126
100
104
126
82
Arginino-succinate synthase 1
Ass1
Asl
Arginino-succinate lyase
Arginase, liver (type 1)
Arg1
Nags
Nos3
Glul
Gls
N-Acetyl-glutamate synthase
Nitric oxide synthase 3, endothelial cell type
Glutamate-ammonia ligase [glutamine synthetase]
Glutaminase kidney isoform, mitochondrial
Glutamate dehydrogenase 1, mitochondrial
Glycine cleavage system H protein, mitochondrial
Adenosine monophosphate deaminase 2
Peptidyl-prolyl-cis-trans isomerase Aa
138
148
63
Glud1
Gcsh
Ampd2
Ppia
122
146
78
3.5.4.6
—
87
a
Housekeeping gene.
This journal is © The Royal Society of Chemistry 2016
RSC Adv., 2016, 6, 11278–11288 | 11281

View Article Online
RSC Advances
Paper
were affected by sex and diet. However, liver weight was main- ornithine carbamoyl-transferase, arginino-succinate synthase,
tained at about 3.1–3.3% of body weight in all groups. Whole- arginino-succinate lyase and arginase 1. The gure shows also
liver cellularity was (mean values for groups, in 109 cells): 4.0 the expressions of the genes coding for endothelial nitric oxide
and 4.9 for control and cafeteria males, as well as 2.4 and 2.7 for synthase and N-acetyl-glutamate synthase (acetyl-transferase).
control and cafeteria females. Estimated cell size was higher in Arginase activity was about three orders of magnitude higher
females: 3.3 and 3.2 ng per cell in control and cafeteria rats, than those of the arginino-succinate enzymes; ornithine
respectively, versus 2.9 and 2.8 ng per cell in males (P < 0.05 for carbamoyl-transferase activity was also high, but only one order
both diets). However, no overall signicant effects of diet and of magnitude higher than those of the arginino-succinate
sex were observed for DNA content in mg gꢁ1 tissue.
enzymes. These extreme differences in activity were less
Concentrations of protein and RNA in liver were affected by marked when comparing the expressions of the four enzymes,
sex; males had higher protein and females had higher RNA since all were in the same range except arginino-succinate syn-
concentrations; but no signicant effects of diet were observed. thase, one order of magnitude higher. These differences resulted
RNA/DNA ratios were, again, not affected by diet, but sex in disparate activity/expression ratios.
resulted in higher values (P < 0.05) for females (3.2 controls and
The patterns of activity were similar for all four enzymes, but
3.0 cafeteria) than males (2.4 for both dietary groups).
there were signicant effects of sex only in arginino-succinate
Table 3 shows the main plasma energy parameters of the rats. synthase and arginase, and of diet in these same enzymes
Glucose levels were increased, and those of lactate decreased, plus arginino-succinate lyase. The patterns for gene expression
signicantly by feeding the cafeteria diet. Cholesterol was unaf- of the urea cycle enzymes were also similar and followed the
fected by either sex or diet. Triacylglycerols, however, were same prole than their corresponding enzyme activities. Sex
affected by sex (but not by diet), with female values being higher affected only (i.e. signicantly) the expression of arginino-
than those of males, especially in control rats. The sum of plasma succinate synthase. The expression of their corresponding
amino acids was also affected by sex (with females showing genes was affected by diet in the same enzyme plus arginino-
higher combined levels). Finally, urea concentrations were succinate lyase and arginine. In all enzymes of Fig. 1, except
decreased by cafeteria diet, but were overall higher in female rats. ornithine carbamoyl-transferase, both activities and expres-
sions were decreased in cafeteria diet-fed rats vs. controls.
The possible direct relationship between gene expression
and enzyme activity (unaffected by post-translational modi-
cation) was checked analysing the correlation between the data
Urea cycle
Fig. 1 depicts a scheme of the urea cycle in liver, showing the
enzyme activities (and their corresponding gene expressions) for
Table 2 Body and liver weight and composition of male and female rats fed control or cafeteria diets for 30 daysa
Male
Female
Control
P
Parameter
Units
Control
Cafeteria
Cafeteria
Sex
Diet
Body weight
Liver weight
DNA
RNA
Protein
g
g
373 ꢃ 6
420 ꢃ 20
13.8 ꢃ 1.1
2.13 ꢃ 0.32
5.21 ꢃ 0.18
185 ꢃ 5
232 ꢃ 8
267 ꢃ 16
8.36 ꢃ 0.50
1.91 ꢃ 0.22
5.75 ꢃ 0.15
157 ꢃ 9
<0.0001
<0.0001
NS
0.0065
0.0003
0.0074
0.0473
NS
NS
NS
11.6 ꢃ 0.5
2.07 ꢃ 0.17
4.96 ꢃ 0.31
191 ꢃ 7
7.72 ꢃ 0.31
1.83 ꢃ 0.22
5.95 ꢃ 0.30
160 ꢃ 5
mg gꢁ1
mg gꢁ1
mg gꢁ1
a
The data correspond to the mean ꢃ sem of 6 different animals. Statistical signicance of the differences between groups was established with a 2-
way anova program.
Table 3 Main plasma metabolites of male and female rats fed control or cafeteria diets for 30 daysa
Male
Female
Control
P
Plasma parameters (mM)
Control
Cafeteria
Cafeteria
Sex
Diet
Glucoseb
Lactate
10.2 ꢃ 0.4
3.10 ꢃ 0.29
1.97 ꢃ 0.07
1.50 ꢃ 0.06
3.90 ꢃ 0.17
3.34 ꢃ 0.08
10.8 ꢃ 0.4
2.64 ꢃ 0.21
2.28 ꢃ 0.21
1.50 ꢃ 0.01
3.82 ꢃ 0.20
3.68 ꢃ 0.10
8.64 ꢃ 0.34
3.78 ꢃ 0.24
1.98 ꢃ 0.16
1.69 ꢃ 0.06
5.13 ꢃ 0.25
3.96 ꢃ 0.18
11.5 ꢃ 0.3
2.57 ꢃ 0.21
2.07 ꢃ 0.19
1.51 ꢃ 0.03
3.78 ꢃ 0.20
4.07 ꢃ 0.12
NS
NS
NS
0.0390
0.0094
0.0007
0.0001
0.0023
NS
NS
0.0025
NS
Cholesterol
Triacylglycerols
Urea
Amino acidsc
a
The data correspond to the mean ꢃ sem of 6 different animals. Statistical signicance of the differences between groups was established with
b
a two-way anova program. The glucose values were higher than expected because of the necessary exposure of the animals to isourane
anaesthesia during the process of killing and sampling. c These values do not include Gln, Asn, Trp and Cys.
11282 | RSC Adv., 2016, 6, 11278–11288
This journal is © The Royal Society of Chemistry 2016

View Article Online
Paper
RSC Advances
Fig. 1 Gene expressions and enzyme activities of the urea cycle in the liver of male and female rats fed control or cafeteria diet for 30 days. The
data correspond to the mean ꢃ sem of 6 different animals, and are all expressed per gram of tissue protein (gP). Statistical analysis of the
differences between groups was done using a two-way anova program and the variables “sex” and “diet”. Only significant (P < 0.05) values have
been represented. Purple data, marked with a “S” correspond to the overall effect of “sex”, and red data marked with a “D” correspond to the
overall effect of “diet”. MC ¼ male fed the control diet; MK ¼ male fed the cafeteria diet; FC ¼ female fed the control diet; FK ¼ female fed the
cafeteria diet. Males: dashed columns; females: no-pattern columns. Enzyme gene expressions: orange: control diet; yellow: cafeteria diet
enzyme activities: blue: control diet; green: cafeteria diet.
for both parameters of all animals studied, irrespective of sex expression, which presented considerable variability. AMP
and diet (i.e. N ¼ 24). There were signicant correlations deaminase showed no signicant effects of sex or diet on
between enzyme activity and expression for arginino-succinate activity or gene expression. The activity of serine dehydratase
synthase (R2 ¼ 0.283; P ¼ 0.023), arginase 1 (R2 ¼ 0.184; P ¼ was markedly affected by sex, with lower female values, an effect
0.037), carbamoyl-P synthase (R2 ¼ 0.440; P ¼ 0.0008) and serine that was parallel to the changes in gene expression. Diet also
dehydratase (R2 ¼ 0.635; P ¼ 0.0002). No signicant correlations affected the gene expression of serine dehydratase, with values
were found for any of the other enzymes studied.
even lower for cafeteria-fed rats.
Acetylation of glutamate was also affected by diet, following
Glutamine synthetase activity in females was higher than in
the same pattern described above. The expression of endothelial males, a difference also observed in the expression of its gene.
nitric oxide synthase showed a clear effect of sex, with higher Glutaminase expression did not show effects of sex, but cafe-
values in females but the effects of diet were not signicant.
teria diet decreased the expression of the enzyme. This pattern
was paralleled by glutamate dehydrogenase, which also showed
an effect of sex (higher values in females). The expression of the
glycine cleavage system (in fact that of representative H protein)
was strongly inuenced by sex, with—again—higher values in
female rats.
Ammonium metabolism
Fig. 2 shows a general outline of liver ammonium metabolism,
including the activities of carbamoyl-P synthase 1, serine
dehydratase, AMP deaminase and glutamine synthetase, as well
as the expressions of their corresponding genes. The gure
includes, also the expressions of glutaminase, the cytoplasmic
(NADPH-dependent) glutamate dehydrogenase and a compo-
nent of the glycine cleavage system (H protein).
Discussion
We have shown evidence that both sex and diet, rather inde-
Carbamoyl-P synthetase 1 showed higher enzyme activities pendently, affected the activities and gene expressions of the
in females; these effects were not observed in its gene urea cycle enzymes in rat liver. However, this apparent
This journal is © The Royal Society of Chemistry 2016
RSC Adv., 2016, 6, 11278–11288 | 11283

View Article Online
RSC Advances
Paper
Fig. 2 Gene expressions and enzyme activities of enzymes related to ammonia/ammonium metabolism in the liver of female and male rats fed
control or cafeteria diet for 30 days. The data correspond to the mean ꢃ sem of 6 different animals, and are expressed per gram of tissue protein
(gP). Statistical analysis, abbreviations and colour conventions are the same described for Fig. 1.
similarity of effect shis towards more extensive effects of sex
The so far scarcely studied effect of sex on amino acid
on the management of ammonium in the liver, thus affecting, catabolism may have deeper roots than usually assumed. The
albeit indirectly, the overall operation of the urea cycle and the lack of direct studies on the mechanisms has driven our
nal excretion of N as urea. The model used behaved as ex- attention to the overall picture of effects of sex on amino-N
pected both in increased WAT fat deposition52,53 and relative economy. In males, the main trend is accumulation of body
normalcy of plasma parameters, including insulin54 as repeat- protein, largely muscle, an effect facilitated by insulin,61 GH and
edly found under these same conditions in previous studies.32,36 androgens,62 and hampered by glucocorticoids.63 In females,
We used a cafeteria diet model well studied by us previously, however, the main drive seems to be somewhat different: to
which shows a discrete increase in body weight due to the enhance N sparing probably to full the burden of reproduc-
accumulation of fat, but the metabolic alterations induced by tion, rst the foetuses, and then the energy economy ordeal of
inammation in the context of MS are essentially incipient.52 lactation. In both sexes, in addition, the overall trend to
The effects are strongly inuenced by sex;55 a question that we preserve amino-N is
a primeval drive that prevents its
also found applies to amino acid metabolism.29 The obesogenic wasting64,65 even under (rare in Nature) conditions of dietary
effects of cafeteria diets are maximal during early postnatal excess of protein.66 We can speculate that androgen predomi-
development,56 preventing the weaning shi from a high fat to nance (i.e. in males), acting as counterbalance to glucocorti-
a high carbohydrate diet.57 The timing and extent of exposure coids, may diminish the hepatic conversion of amino acid N to
are critical to enhance the ability of this type of diets to induce urea; oestrogen (i.e. in females) showing a less marked inu-
MS.55,58 We used young adult rats, and subjected them to ence on this aspect.
a moderate exposure time to the hyperlipidic diet in order to
Enzyme activities are not direct estimations of the enzyme
obtain not a frankly pathological state but a pre-MS situation in function within the cell, but are a widely accepted correlate of
which the immediate effects of the high-energy diet are not the overall enzyme ability to carry out its function. Thus, the Vi
confounded by the additional disorders elicited by a severe values presented are a correlate of Vmax and of functional
inammation.59,60
protein enzyme levels. These values, consequently; reect
11284 | RSC Adv., 2016, 6, 11278–11288
This journal is © The Royal Society of Chemistry 2016

View Article Online
Paper
RSC Advances
potential ability of the tissue to catalyse the reaction, albeit
It has been generally assumed that ammonia arriving to the
being estimated under result-maximizing non-physiological liver (and that produced in its own catabolism of amino acids) is
conditions. The closeness of gene expression patterns and a main factor for the control of its disposal through the urea
enzyme activities mutually support the data presented. cycle.76,77 It is obvious that the liver is a formidable barrier that
However, the large differences in activity observed between prevents ammonium from entering the systemic circulation
enzymes (i.e. arginase vs. arginino-succinate synthase) but also and thus possibly damaging the nervous system.78 The liver
between expression and activity may be a consequence of counts not only with the urea cycle (essentially carbamoyl-P
different turnover number or enzyme (as protein) turnover,67 synthase 1) to incorporate it into urea with amino-N taken
but place the control of the cycle, precisely on these key from aspartate, but also with two additional and powerful
enzymes. In arginino-succinate synthase as rate limiting step;68 ammonium-handling systems (and nitrogen salvage79): gluta-
and arginase as nal factor in the release of urea,69 but also as mine synthetase,80 and glutamate dehydrogenases81 within the
the main site for arginine break-up and maintenance of body mitochondrion and in the cytoplasm. Compartmentation of
arginine-citrulline equilibrium.70 In the urea cycle, N disposal ammonium/ammonia in the cell is also an important82 aspect
and guanido-amino acid maintenance for their multiple regu- that has not been sufficiently studied.
latory tasks intermix to a considerable extent, as can be deduced
Carbamoyl-P synthases convert ammonium (or glutamine
from the model presented here. The different needs for arginine amido N) into carbamoyl-P in liver, were practically only the
possibly modulate the sex differences in expression, but the isozyme 1 has signicant activity.83 The reaction provides
enzyme activities follow more closely the regulation mecha- carbon and nitrogen to start the formation of the guanido group
nisms for N handling.
on ornithine, via ornithine carbamoyl-transferase. Following
It has been known for long, that urea production is the trend described for the urea cycle enzymes, no differences
decreased by diets rich both in energy and in protein,31 were observed in gene expressions but cafeteria diet slightly
assumedly because of lower urea cycle enzyme activities in the decreased the enzyme activity in both sexes. These differences
liver. Our results are consistent with this observation, but, at the support the overall function of the cycle described above, since
same time, we provide evidence that these differences, largely this enzyme incorporation of ammonia is a key control point in
down regulation of enzyme activities, were described, essen- the synthesis of urea.77
tially, in males. No sufficient data for comparison is available
The existence of signicant correlations between activity and
for females. This is best observed in the halving of three key expression for carbamoyl-P synthase and the key regulatory urea
enzyme activities in males by feeding a cafeteria diet: arginino- cycle enzymes arginino-succinate synthase and arginase, attest
succinate synthase, arginino-succinate lyase and arginase. Of to a direct translational control of the urea cycle in liver. As
these, female rats maintained only the effect on arginino- indicated above, these three enzymes have been postulated as
succinate lyase; thus, males' downregulation may be traced to main control points for urea cycle operation. It is worth noting
more control points than females, which may help explain the that only these enzymes, and serine dehydratase, which gene
sex-related differences in regulation described above. The expression is controlled only by serine availability,84 showed
consequences on overall function of the cycle are consistent a direct (statistically signicant) relationship between expres-
with the lower urea production observed in rats fed a cafeteria sion and measured enzyme activity. Since the analyses have
diet, in studies using mainly males.31,32,71
been done under different dietary and sex conditions, the
The relatively low and largely unchanged expression of maintenance of this basic process shows that regulation of gene
endothelial nitric oxide synthase suggests a relatively low translation is a key mechanism of control of the cycle.
activity, compared with arginase, in their competence for argi-
The liver is a main site for amino acid partition and N
nine, an effect best seen in peripheral tissues.72 In the present disposal. This is a consequence of its peculiar placement, at the
study, the expression of the enzyme did not change signicantly end of the portal system, which carries the N debris of intestinal
at all, which seems to disconnect this enzyme from the main and microbiota catabolism, modulated by intestinal function.85
hepatic degradative pathway represented by the urea cycle. The In addition, liver has the advantage of using the ammonia
fate of the “unaccounted for” dietary nitrogen i.e. that portion of evolved from catabolic reactions directly in its cells. Glutamine
dietary N not excreted in urine (mainly urea) or faeces, and synthetase is placed essentially in the peri-venous cells,86 acting
neither accumulated in body protein does not seem, thus, to be as last defence barrier against release of ammonium into the
related to changes in the capacity of liver for higher nitric oxide systemic circulation; this enzyme shows a marked sex differ-
synthesis. Limiting its contribution to the excess nitric oxide ence. NADP+-glutamate dehydrogenase showed
production caused by metabolic syndrome and/or cafeteria diet pattern with respect to sex, but cafeteria diet tended to decrease
feeding.33,73
its expression. Since glutamate dehydrogenase is assumed to
a similar
Liver ability to synthesize citrulline was not decreased by act (in the liver) mainly in the direction of glutamate
diet, which suggests that liver may also contribute to the overall synthesis,81,87 its increase in females agrees with the hypothesis
production of citrulline,74 as that observed in adipose tissue.29 of their enhanced focussing on amino-N sparing.
The relative inability of the liver to retain and process citrul-
The signicant (from a quantitative point of view) functional
line74 hints at this amino acid not being, in the liver, a critical urea cycle in white adipose tissue introduces a critical question
factor in the regulation of the cycle, in addition to its overall on the primacy of liver in overall 2-amino N disposal.28,29
importance for arginine metabolism regulation.75
Probably, the main role of adipose tissue urea cycle is
This journal is © The Royal Society of Chemistry 2016
RSC Adv., 2016, 6, 11278–11288 | 11285

View Article Online
RSC Advances
Paper
complementary to that of liver, providing arginine and citrul- to run in a way similar to that described for the urea cycle:
line to the rest of the body28 and, perhaps acting as backup a generalized down regulation of amino acid metabolism.71 This
system for the liver amino-N elimination. The limited effect of conclusion is in agreement with a decreased urea production,
diet on the urea cycle of adipose tissue28,29 contrasts with the and markedly contrasts with the actually higher availability of 2-
marked effects observed here in liver, and help support the amino N in the rats fed a cafeteria diet.102
hypothesis that the function of the cycle is not subjected to the
same parameters of control, nor, probably, shares the same in a way that the different strategies of amino-N handling by
metabolic function in both organs. females and males further modulate the preservation of
This complex intertwining of mechanisms is affected by sex,
The main liver ammonium producing mechanisms are the 2-amino-N when sufficient energy is available. The sex-related
purine nucleotide cycle,88 i.e. AMP deaminase,89 glutaminase,90 differences are important both in direction and in extension,
serine (and threonine) dehydratase91 and the glycine cleavage and open new avenues for understanding how amino acids are
system.92 There are other sources, such as amine-oxidases, amino used for energy, but also how survival and/or sex-related
acid oxidases and a number of enzymes acting on the catabolism metabolism strategies modify substrate partition and fate.
of essential amino acids, but the nature of the N donors suggest
The confrontation between amino-N preservation and the
a conjointly limited contribution to the liver ammonium pool. need to dispose of its excess seem to show a winning hand for
However, a main source is the ammonia/ammonium carried preservation as all the data presented above suggest. In any
from the intestine (and microbiota) by the portal blood.93
case, elimination of excess N is necessary and cannot be easily
The role of AMP deaminase in liver is more complex than its carried out through the metabolic pathways we know. In any
simple participation in the purine nucleotide cycle,94 since it is case, the experimental data show that excess N is removed. The
part of the purine salvage pathway.95 In addition, the enzyme problem is that we have not yet identied which (necessarily
breaks up the AMP generated by adenylate kinase under major) pathway is used for that elimination, so far, we can only
conditions of scarcity of ATP or nutrients,96 as a way to control add that it is not urea, and also that the main agent does not
glycolysis, oen in conjunction with ammonium production.97 seem to be the liver. In any case, the critical question of the fate
Breakup of AMP to IMP also affects AMP-kinases and their of the 2-amino N ingested but not excreted (faeces, urine) or
control of energy partition.98 The varied functions of AMP- accrued in the body of rats fed a high-energy protein-rich self-
deaminase in liver, do not seem to include a signicant role selected (cafeteria) diet, remains open.
in the in situ production of ammonium,99 a condition largely
different from that of the muscle enzyme, which places the
purine nucleotide cycle as a main mechanism for mineraliza- Conflict of interest
tion of amino-N.
The authors declare that they have no conict of interests.
The analysis of diet/sex effects on serine dehydratase are
consistent with a sex-related preservation of amino-N in
females, enhanced by the additional protective effects of cafe-
teria diet. Serine dehydratase is a classic example of substrate-
controlled expression/activity,84 and thus, both are correlated.
Acknowledgements
This study was nanced in part, by grants of the Plan Nacional
The expression of protein H of the glycine cleavage system
´
de Investigacion en Biomedicina (SAF2012-34895) and the Plan
showed, again an effect of sex. Glycine is also a by-product of
serine, thus the probable increase in its cleavage may not only
represent a way of amino-N disposal, but a much needed source
of 1C fragments for synthesis,100 especially under conditions of
excess energy and amino acids.
It may be assumed that, under conditions of sufficient
glucose and energy availability (controls) or in their excess
(compounded by the presence of large amounts of lipid in
cafeteria diet), amino acid metabolism must be hampered in
intestine (and liver) by the ultimate need to preserve amino-N.101
In consequence, it is probable that the porta vein ammonia
would not be increased by cafeteria diet. The nal picture, then,
could be summarized in a controlled, relatively low, availability
of ammonium in the liver under standard conditions, which
may be unchanged or even lowered in cafeteria-fed rats,
depending on intestinal amino acid catabolism.93
´
Nacional de Ciencia y Tecnologıa de los Alimentos (AGL-2011-
23635) of the Government of Spain. It also counted with the
collaboration of the CIBER-OBN Research Web. Silvia Agnelli
obtained a Leonardo da Vinci fellowship, and Sofıa Arriaran was
the recipient of a predoctoral fellowship of the Catalan
Government, in both cases covering part of the time invested in
this study.
´
´
References
1 M. Alemany, Nutr. Res., 2013, 33, 1–11.
2 A. Sclafani and D. Springer, Physiol. Behav., 1976, 17, 461–
471.
´
3 J. P. Felber, E. Haesler and E. Jequier, Diabetologia, 1993, 36,
1221–1229.
´
4 J. P. Despres, Clin. Endocrinol. Metab., 1994, 8, 629–660.
5 X. Wang, J. W. Choi, T. S. Oh, D. K. Choi, R. Mukherjee,
H. Liu and J. W. Yun, Proteomics, 2012, 12, 284–299.
6 M. R. Meyer, D. J. Clegg, E. R. Prossnitz and M. Barton, Acta
Physiol., 2011, 203, 259–269.
Conclusions
The effects observed, both in enzyme activities and expressions
contributing to remove ammonium and those producing it tend
11286 | RSC Adv., 2016, 6, 11278–11288
This journal is © The Royal Society of Chemistry 2016

View Article Online
Paper
7 T. M. d'Eon, S. C. Souza, M. Aronovitz, M. S. Obin,
RSC Advances
´
´
´
29 S. Arriaran, S. Agnelli, X. Remesar, J. A. Fernandez-Lopez
S. K. Fried and A. S. Greenberg, J. Biol. Chem., 2005, 280,
35983–35991.
and M. Alemany, PeerJ, 2015, 3, e1399.
30 E. Prats, M. Monfar, R. Iglesias, J. Castella and M. Alemany,
`
8 R. E. Stubbins, K. Najjar, V. B. Holcomb, J. Hong and
Physiol. Behav., 1989, 45, 263–272.
˜
˜
˜
´
N. P. Nunez, Diabetes, Obes. Metab., 2012, 14, 58–66.
31 T. Barber, J. R. Vina, J. Vina and J. Cabo, Biochem. J., 1985,
˜
´
9 R. E. Stubbins, V. B. Holcomb, J. Hong and N. P. Nunez, Eur.
230, 675–681.
´
´
´
J. Nutr., 2012, 51, 861–870.
32 D. Sabater, S. Agnelli, S. Arriaran, J.-A. Fernandez-Lopez,
M. D. M. Romero, M. Alemany and X. Remesar, BioMed
Res. Int., 2014, 2014, 959420.
10 H. Gong, M. J. Jarzynka, T. J. Cole, J. H. Lee, T. Wada,
B. Zhang, J. Gao, W. C. Song, D. B. DeFranco, S. Y. Cheng
and W. Xie, Cancer Res., 2008, 68, 7386–7393.
11 C. Asensio, P. Muzzin and F. Rohner-Jeanrenaud, Int. J.
Obes., 2004, 28, S45–S52.
12 L. Antonio, F. C. W. Wu, T. W. O'Neill, S. R. Pye, E. L. Carter,
J. D. Finn, M. K. Rutter, M. R. Laurent, I. T. Huhtaniemi,
T. S. Han, M. E. J. Lean, B. G. Keevil, N. Pendleton,
G. Rastrelli, G. Forti, G. Bartfai, F. F. Casanueva, K. Kula,
M. Punab, A. Giwercman, F. Claessens, B. Decallonne and
D. Vanderschueren, J. Clin. Endocrinol. Metab., 2015, 100,
1396–1404.
33 M. Esteve, I. Rafecas, X. Remesar and M. Alemany, Biochem.
Int., 1992, 26, 687–694.
34 C. Bucca, A. Cicolin, G. Guida, E. Heffler, L. Brussino and
G. Rolla, J. Breath Res., 2012, 6, 027104.
35 G. Costa, L. Ullrich, F. Kantor and J. F. Holland, Nature,
1968, 218, 546–551.
36 R. Ferrer-Lorente, C. Cabot, J. A. Fernandez-Lopez and
M. Alemany, Life Sci., 2005, 77, 2051–2058.
37 L. Arola, E. Herrera and M. Alemany, Anal. Biochem., 1977,
82, 236–239.
´
´
13 M. Wang, Nutr. Metab., 2005, 2, 3.
14 M. Alemany, Front. Endocrinol., 2012, 3, 27.
38 O. H. Lowry, R. W. Rosebrough, A. L. Farr and R. J. Randall,
J. Biol. Chem., 1951, 193, 265–275.
´
´
´
´
15 M. E. Estrany, A. M. Proenza, M. Gianotti and I. Llado, Cell
39 S. Arriaran, S. Agnelli, J. A. Fernandez-Lopez, X. Remesar
and M. Alemany, J. Enzyme Res., 2012, 3, 29–33.
40 R. T. Schimke, Methods Enzymol., 1970, 17, 313–317.
41 E. L. Oginsky, Methods Enzymol., 1957, 3, 639–643.
42 D. M. Greenberg, Enzymes, 1960, 4, 257–267.
43 L. Arola, A. Palou, X. Remesar and M. Alemany, Horm.
Metab. Res., 1981, 13, 199–202.
Biochem. Funct., 2013, 31, 504–510.
16 H. Yokomizo, T. Inoguchi, N. Sonoda, Y. Sasaki, Y. Maeda,
T. Inoue, E. Hirata, R. Takei, N. Ikeda, M. Fujii, K. Fukuda,
H. Sasaki and R. Takayanagi, Am. J. Physiol., 2014, 306,
E1163–E1175.
17 T. Aikawa, H. Matsutaka, H. Yamamoto, T. Okuda,
E. Ishikawa, T. Kawano and E. Matsumura, J. Biochem.,
1973, 74, 1003–1017.
44 A. Palou, M. Alemany, L. Arola and X. Remesar, Rev. Esp.
Fisiol., 1980, 36, 151–154.
18 Y. Eguchi, T. Eguchi, T. Mizuta, Y. Ide, T. Yasutake,
R. Iwakiri, A. Hisatomi, I. Ozaki, K. Yamamoto,
Y. Kitajima, Y. Kawaguchi, S. Kuroki and N. Ono, J.
Gastroenterol., 2006, 41, 462–469.
45 E. Ishikawa, T. Ninagawa and M. Suda, J. Biochem., 1965, 57,
506–513.
46 N. Ogasawara, H. Goto and T. Watanabe, FEBS Lett., 1974,
44, 63–66.
19 M. Carmiel-Haggai, A. I. Cederbaum and N. Nieto, FASEB J.,
2005, 19, 136–138.
47 J. K. Fawcett and J. E. Scott, J. Clin. Pathol., 1960, 13, 156–
159.
´
48 M. M. Romero, M. M. Grasa, M. Esteve, J. A. Fernandez-
20 G. Marchesini, M. Brizi, A. M. Morselli-Labate, G. Bianchi,
E. Bugianesi, A. J. McCullough, G. Forlani and
N. Melchionda, Am. J. Med., 1999, 107, 450–455.
21 G. Bianchi, G. Marchesini, N. Brunetti, E. Manicardi,
F. Montuschi, R. Chianese and M. Zoli, Dig. Liver Dis.,
2003, 35, 722–727.
´
Lopez and M. Alemany, Nutr. Metab., 2007, 4, 26.
49 J. Q. He, A. J. Sandford, I. M. Wang, S. Stepaniants,
´
D. A. Knight, A. Kicic, S. M. Stick and P. D. Pare, Eur.
Respir. J., 2008, 32, 755–762.
ˇ
50 R. Vytasek, Anal. Biochem., 1982, 120, 243–248.
22 A. H. Lockwood, J. M. McDonald, R. E. Reiman,
A. S. Gelbard, J. S. Laughlin, T. E. Duffy and F. Plum, J.
Clin. Invest., 1979, 63, 449–460.
51 GSP Consortium, Nature, 2004, 428, 493–521.
´
52 S. Arriaran, S. Agnelli, D. Sabater, X. Remesar,
´
´
J. A. Fernandez-Lopez and M. Alemany, PLoS One, 2015,
23 H. A. Krebs, Biochem. J., 1942, 36, 758–767.
24 H. A. Krebs, R. Hems, P. Lund, D. Halliday and
W. W. C. Read, Biochem. J., 1978, 176, 733–737.
25 M. Takiguchi, T. Matsubasa, Y. Amaya and M. Mori,
BioEssays, 1989, 10, 163–166.
10, e0119572.
53 M. D. M. Romero, S. Roy, K. Pouillot, M. Feito, M. Esteve,
´
´
M. D. M. Grasa, J.-A. Fernandez-Lopez, M. Alemany and
X. Remesar, PLoS One, 2014, 9, e90995.
54 R. Ferrer-Lorente, C. Cabot, J. A. Fernandez-Lopez and
M. Alemany, Naunyn-Schmiedeberg's Arch. Pharmacol.,
2010, 381, 339–348.
´
´
26 A. Aperia, O. Broberger, A. Larsson and K. Snellman, Scand.
J. Clin. Lab. Invest., 1979, 39, 329–336.
´
´
´
27 P. K. Davis and G. Y. Wu, Comp. Biochem. Physiol., Part B:
Biochem. Mol. Biol., 1988, 119, 527–537.
55 R. Dıaz-Rua, E. Garcıa-Ruiz, A. Caimari, A. Palou and
P. Oliver, Food Funct., 2014, 5, 3117–3131.
´
´
´
´
´
28 S. Arriaran, S. Agnelli, X. Remesar, J.-A. Fernandez-Lopez
56 H. Castro, C. A. Pomar, C. Pico, J. Sanchez and A. Palou, Int.
and M. Alemany, RSC Adv., 2015, 5, 93403–93414.
J. Obes., 2015, 39, 430–437.
57 M. Alemany, Reprod. Biol. Endocrinol., 2011, 9, 101.
This journal is © The Royal Society of Chemistry 2016
RSC Adv., 2016, 6, 11278–11288 | 11287

View Article Online
RSC Advances
Paper
58 D. A. Correa Pinto and P. Monteiro Seraphim, Rev. Nutr.,
2012, 25, 313–319.
59 J. F. Lalanza, A. Caimari, J. M. del Bas, D. Torregrosa,
80 E. Cersosimo, P. Williams, R. Geer, T. Lairmore, F. Ghishan
and N. N. Abumrad, Am. J. Physiol., 1989, 257, E514–E519.
81 L. Boon, W. J. C. Geerts, A. Jonker, W. H. Lamers and
C. J. F. van Noorden, Histochem. Cell Biol., 1999, 111, 445–
452.
`
I. Cigarroa, M. Pallas, L. Capdevila, L. Arola and
R. M. Escorihuela, PLoS One, 2014, 9, e85049.
60 C. J. Bailey, P. R. Flatt and N. S. Radley, Nutr. Res., 1985, 5,
1003–1010.
82 L. R. Soria, J. Marrone, G. Calamita and R. A. Marinelli,
Hepatology, 2013, 57, 2061–2071.
´
61 D. R. Bolster, L. S. Jefferson and S. R. Kimball, Proc. Nutr.
Soc., 2004, 63, 351–356.
83 V. Rubio, G. Ramponi and S. Grisolıa, Biochim. Biophys.
Acta, 1981, 659, 150–160.
62 J. Grigsby, W. Bergen and R. Merkel, Growth, 1976, 40, 303–
316.
84 H. Nakagawa, S. Miura, H. Kimura and T. Kanatsuna, J.
Biochem., 1969, 66, 549–564.
63 R. C. May, J. L. Bailey, W. E. Mitch, T. Masud and
B. K. England, Kidney Int., 1996, 49, 679–683.
64 D. H. Elwyn, F. E. Gump, M. Iles, C. L. Long and
J. M. Kinney, Metabolism, 1978, 27, 325–331.
65 J. Van Raaij, C. M. Schonk, S. H. Vermaat-Miedema, M. Peek
and J. Hautvast, Am. J. Clin. Nutr., 1991, 53, 612–619.
66 C. Moundras, C. Remesy and C. Demigne, Am. J. Physiol.,
1993, 264, G1057–G1065.
85 O. M. Wrong and A. Vince, Proc. Nutr. Soc., 1984, 43, 77–86.
86 R. da Silva, O. Levillain, J. T. Brosnan, S. Araneda and
M. E. Brosnan, Can. J. Physiol. Pharmacol., 2013, 91, 362–
368.
87 J. D. McGivan and J. B. Chappell, FEBS Lett., 1975, 52, 1–7.
88 K. K. Moss and J. D. McGivan, Biochem. J., 1975, 150, 275–
283.
89 M. Szydlowska, G. Nagel-Starczynowska, I. Rybakowska,
A. Swieca and K. Kaletha, Mol. Cell. Biochem., 2002, 241,
81–82.
67 B. K. Speake, R. Dils and R. J. Mayer, Biochem. J., 1976, 154,
359–370.
68 A. Husson, C. Brasse-Lagnel, A. Fairland, S. Renouf and
A. Lavoinne, Eur. J. Biochem., 2003, 270, 1887–1899.
69 S. M. Morris, Annu. Rev. Nutr., 1992, 12, 81–101.
70 J. C. Marini, J. Nutr., 2012, 142, 572–580.
71 C. Vizioli de Castro Ghizoni, F. Rodrigues Silva Gasparin,
90 A. J. Verhoeven, J. F. van Iwaarden, S. K. Joseph and
A. J. Meijer, Eur. J. Biochem., 1983, 133, 241–244.
91 T. Yamada, J. Komoto, Y. Takata, H. Ogawa, H. C. Pitot and
F. Takusagawa, Biochemistry, 2003, 42, 12854–12865.
92 R. K. Hampson, M. K. Taylor and M. S. Olson, J. Biol. Chem.,
1984, 259, 1180–1185.
˜
A. Sueiti Maeda, F. Olinto Carreno, R. Polimeni
Constantin, A. Bracht, E. L. Ishii Iwamoto and
J. Constantin, Mol. Cell. Biochem., 2013, 373, 265–277.
72 W. Durante, F. K. Johnson and R. A. Johnson, Clin. Exp.
Pharmacol. Physiol., 2007, 34, 906–911.
73 A. Ghasemi, S. Zahediasl and F. Azizi, Scand. J. Clin. Lab.
Invest., 2012, 72, 523–530.
74 H. G. Windmueller and A. E. Spaeth, Am. J. Physiol., 1981,
241, E473–E480.
75 C. Breuillard, L. Cynober and C. Moinard, Amino Acids,
2015, 47, 685–691.
93 N. M. Anderson, F. I. Bennett and G. A. O. Alleyne, Biochim.
Biophys. Acta, 1976, 437, 238–243.
94 J. M. Lowenstein, Int. J. Sports Med., 1990, 11, S37–S46.
95 Y. A. Kim, M. T. King, W. E. Teague, G. A. Rufo, R. L. Veech
and J. V. Passoneau, Am. J. Physiol., 1992, 262, E344–E352.
96 P. Dzeja and A. Terzic, Int. J. Mol. Sci., 2009, 10, 1729–1772.
97 K. Tornheim, J. Theor. Biol., 1979, 79, 491–541.
98 G. Lutoslawska and M. Niedbalska, Med. Sportiva, 2004, 8,
85–104.
99 K. Tornheim and J. M. Lowenstein, J. Biol. Chem., 1972, 247,
162–169.
´
˜
76 S. Grisolıa, M. D. Minana, E. Grau and V. Felipo, Adv. Exp.
Med. Biol., 1994, 341, 1–12.
77 A. J. Meijer, Trends Biochem. Sci., 1979, 4, 83–86.
100 T. Yoshida and G. Kikuchi, Arch. Biochem. Biophys., 1970,
139, 380–392.
78 C. H. C. Dejong, M. T. Kampman, N. E. P. Deutz and 101 M. Alemany, Nutr. Res. Rev., 2012, 25, 18–28.
´
´
P. B. Soeters, J. Neurochem., 1992, 59, 1071–1079.
102 M. Esteve, I. Rafecas, J. A. Fernandez-Lopez, X. Remesar
and M. Alemany, Biochem. Mol. Biol. Int., 1993, 29, 1069–
1081.
´
´
´
79 C. Remesy, C. Moundras, C. Morand and C. Demigne, Am. J.
Physiol., 1997, 272, G257–G264.
11288 | RSC Adv., 2016, 6, 11278–11288
This journal is © The Royal Society of Chemistry 2016