Selective stalling of human translation through small-molecule engagement of the ribosome nascent chain

Article abstract of DOI:10.1371/journal.pbio.2001882

Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a key role in regulating the levels of plasma low-density lipoprotein cholesterol (LDL-C). Here, we demonstrate that the compound PF-06446846 inhibits translation of PCSK9 by inducing the ribosom

Full text of DOI:10.1371/journal.pbio.2001882

RESEARCH ARTICLE
Selective stalling of human translation
through small-molecule engagement of the
ribosome nascent chain
Nathanael G. Lintner1¤, Kim F. McClure2, Donna Petersen3, Allyn T. Londregan4, David
W. Piotrowski4, Liuqing Wei4, Jun Xiao4, Michael Bolt5, Paula M. Loria3, Bruce Maguire3,
Kieran F. Geoghegan6, Austin Huang7, Tim Rolph8, Spiros Liras2,4, Jennifer
A. Doudna1,9,10,11,12, Robert G. Dullea8*, Jamie H. D. Cate1,9,10,11
*
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
1 Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, California, United
States of America, 2 Pfizer Medicinal Chemistry, Cardiovascular, Metabolic and Endocrine Disease
Research Unit, Pfizer Worldwide Research and Development, Cambridge, Massachusetts, United States of
America, 3 Primary Pharmacology Group, Pharmacokinetics, Dynamics and Metabolism, Pfizer Worldwide
Research and Development, Groton, Connecticut, United States of America, 4 Pfizer Medicinal Chemistry,
Cardiovascular, Metabolic and Endocrine Disease Research Unit, Pfizer Worldwide Research and
Development, Groton, Connecticut, United States of America, 5 Drug Safety Research & Development,
Pfizer Worldwide Research & Development, Andover, Massachusetts, United States of America, 6 Pfizer
Medicinal Chemistry, Structural Biology and Biophysics, Pfizer Worldwide Research and Development,
Groton, Connecticut, United States of America, 7 Pfizer Medicinal Chemistry, Computational Sciences, Pfizer
Worldwide Research and Development, Cambridge, Massachusetts, United States of America,
8 Cardiovascular, Metabolic and Endocrine Disease Research Unit, Pfizer Worldwide Research and
Development, Cambridge, Massachusetts, United States of America, 9 QB3 Institute, University of California,
Berkeley, Berkeley, California, United States of America, 10 Department of Chemistry, University of
California, Berkeley, Berkeley, California, United States of America, 11 Physical Biosciences Division,
Lawrence Berkeley National Laboratory, Berkeley, California, United States of America, 12 Howard Hughes
Medical Institute (HHMI), University of California, Berkeley, Berkeley, California, United States of America
OPEN ACCESS
Citation: Lintner NG, McClure KF, Petersen D,
Londregan AT, Piotrowski DW, Wei L, et al. (2017)
Selective stalling of human translation through
small-molecule engagement of the ribosome
nascent chain. PLoS Biol 15(3): e2001882. https://
doi.org/10.1371/journal.pbio.2001882
¤ Current address: Chemical Biology, Pfizer Worldwide Research and Development, Cambridge,
Massachusetts, United States of America
Academic Editor: Chaitan Khosla, Stanford
* robert.dullea@pfizer.com (RGD); jcate@lbl.gov (JHDC)
University, United States of America
Received: December 23, 2016
Accepted: February 22, 2017
Published: March 21, 2017
Abstract
Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a key role in regulating the lev-
els of plasma low-density lipoprotein cholesterol (LDL-C). Here, we demonstrate that the
compound PF-06446846 inhibits translation of PCSK9 by inducing the ribosome to stall
around codon 34, mediated by the sequence of the nascent chain within the exit tunnel. We
further show that PF-06446846 reduces plasma PCSK9 and total cholesterol levels in rats
following oral dosing. Using ribosome profiling, we demonstrate that PF-06446846 is highly
selective for the inhibition of PCSK9 translation. The mechanism of action employed by PF-
06446846 reveals a previously unexpected tunability of the human ribosome that allows
small molecules to specifically block translation of individual transcripts.
Copyright: © 2017 Lintner et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: The mass
spectrometric proteomics data have been
deposited to the ProteomeXchange Consortium via
the PRIDE partner repository with the dataset
identifiers PXD005822 (secretome analyses) and
PXD005835 (analyses of cell lysates). The
ribosome profiling and accompanying RNA-seq
datasets have been deposited to the NCBI Gene
Expression Omnibus with accession number
GSE94454. The atomic coordinates of PF-
06446846 have been deposited to the Cambridge
Crystallographic Data Center (CCDC) with
Author summary
Many disease-mediating proteins have proven difficult to target with traditional small-
molecule pharmaceuticals. In this paper, we report that a small molecule, PF-06446846,
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
1 / 36

Selective inhibition of ribosome nascent chain complexes
accession number 1149348. The individual
quantitative observations that underlie Figs 1B-D,
2, 4E, 5J-M, S9A-D, S10B-F, S11, and S15A-B are
in supplementary data table S14.
directly inhibits translation of one such protein, proprotein convertase subtilisin/kexin
type 9 (PCSK9), by acting on the translating human ribosome. PF-06446846 causes the
translating ribosome to stall soon after translating the PCSK9 signal sequence. We further
show that PF-06446846 activity is dependent on the amino acid sequence of the nascent
chain inside the ribosome exit tunnel. In a rat safety study, we observe decreases in plasma
PCSK9, total cholesterol, and low-density lipoprotein (LDL) cholesterol. Using mass spec-
trometry in cell culture and ribosome profiling, we demonstrate that despite acting on the
ribosome, which synthesizes every protein in the cell, PF-06446846 displays a high level of
selectivity for PCSK9. This unexpected potential for small molecules to selectively inhibit
the human ribosome opens the possibility for future development of small molecules tar-
geting disease-mediating proteins that were previously thought to be undruggable.
Funding: Pfizer Medicinal Chemistry. Received by
KFM, ATL, DWP, LW, JX, KFG, and SL. The funder
played a role in study design, data collection and
analysis, decision to publish, and preparation of the
manuscript. Pfizer Emerging Science Fund.
Received by NGL, KFM, DP, ATL, DWP, LW, JX,
MB, PML, BM, KFG, AH, TR, SL, JAD, RGD, and
JHDC. The funder played a role in study design,
data collection and analysis, decision to publish,
and preparation of the manuscript. National
Institutes of Health (grant number S10-
RR029668). Funding supported experiments by
NGL. The funder had no role in study design, data
collection and analysis, decision to publish, or
preparation of the manuscript. National Institutes
of Health (grant number S10-RR027303). Funding
supported experiments by NGL. The funder had no
role in study design, data collection and analysis,
decision to publish, or preparation of the
Introduction
Reduction of plasma low-density lipoprotein cholesterol (LDL-C) through the use of agents
such as statins represents the therapeutic standard of care for the prevention of cardiovascular
disease (CVD) [1, 2], the leading cause of death in Western nations. Proprotein convertase
subtilisin/kexin type 9 (PCSK9) regulates plasma LDL-C levels by preventing the recycling of
the LDL-receptor (LDLR) to the plasma membrane of hepatocytes [3, 4]. Humans with natural
PCSK9 loss-of-function mutations display dramatically reduced LDL-C levels and decreased
risk of CVD, yet display no adverse health effects [5–8]. The robust LDL-C lowering observed
with recently approved PCSK9 monoclonal antibodies (mAbs) when administered as a mono-
therapy or in combination with established LDL-C–lowering drugs validates the therapeutic
potential of inhibiting PCSK9 function [9–11]. However, these therapeutic candidates require
a parenteral route of administration rather than being orally bioavailable. Utilizing a pheno-
typic screen for the discovery of small molecules that inhibit the secretion of PCSK9 into con-
ditioned media, we have recently identified a compound family that inhibits the translation of
PCSK9 [12]. However, the mechanism of translation inhibition exerted by these compounds
remains unknown. Herein we describe a more optimized small molecule, PF-06446846, that
demonstrates in vivo activity. We show that PF-06446846 induces the 80S ribosome to stall
while translating PCSK9. We further demonstrate using ribosome profiling that despite acting
through protein translation, a core cellular process, PF-06446846 is exceptionally specific,
affecting very few proteins. The PF-06446846 mechanism of action reveals a previously unex-
pected potential to therapeutically modulate the human ribosome with small molecules as a
means to target previously “undruggable” proteins.
manuscript. National Institutes of Health (grant
number P50-GM102706). Received by NGL, JAD,
and JHDC. The funder had no role in study design,
data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing interests: NGL, DP, AL, DWP, LW, JX,
MB, PML, BM, KFG, AH, KFM, RGD, and SL are
employees of Pfizer, Inc.
Abbreviations: ALT, alanine transaminase; AST,
aspartate transaminase; CDH1, cadherin-1; CDS,
coding DNA sequence; CFR, cumulative fractional
read; CVD, cardiovascular disease; EMCV IRES,
encephalomyocarditis virus internal ribosome entry
site; FBS, fetal bovine serum; FDR, false discovery
rate; HDL, high-density lipoprotein; IFI30,
interferon gamma–inducible protein 30; LDL, low-
density lipoprotein; LDL-C, low-density lipoprotein
cholesterol; LDLR, LDL-receptor; mAb,
monoclonal antibody; MMRM, mixed model
repeated measure; mTOR, mammalian target of
Rapamycin; NMR, normalized mean read; ORF,
open reading frame; PCSK9, proprotein convertase
subtilisin/kexin type 9; RT-qPCR, quantitative
reverse transcription PCR; SILAC, stable isotope
labeling with amino acids in cell culture; TE,
translational efficiency; uORF, upstream open
reading frame.
Results
PF-06446846 inhibits PCSK9 translation by causing the ribosome to stall
during elongation
The previously identified hit compound was adequate for initial in vitro characterization, but
in vivo assessment required improvements in pharmacokinetic properties [12]. The potency,
physicochemical properties, and the off-target pharmacology associated with the hit com-
pound were improved by structural changes to two regions of the molecule. These efforts led
to the identification of compound PF-06446846 (Fig 1A), which has properties suitable for
both in vitro and in vivo evaluation (S1 Fig and S1 Table). The synthesis and physiochemical
characterization of PF-06446846 are described in the Materials and methods, S2–S8 Figs and
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
2 / 36

Selective inhibition of ribosome nascent chain complexes
Fig 1. PF-06446846 targets the human ribosome, inducing stalling during proprotein convertase subtilisin/
kexin type 9 (PCSK9) translation. (A) Structure of PF-06446846. (B) Luciferase activity of HeLa-based cell-free
translation reactions programmed with mRNAs encoding PCSK9-luciferase, PCSK9(1–35)-luciferase, and PCSK9
(1–33)-luciferase fusions and luciferase alone in the absence (black bars) or presence (grey bars) of 50 μM PF-
06446846. All error bars represent one standard deviation of three replicates. (C) PF-06446846 sensitivity
dependence on the amino acid sequence of PCSK9(1–33). PCSK9-luciferase fusions encode the native PCSK9
amino acid sequence with common codons or rare codons or a native, double-frameshifted mRNA sequence that
results in a changed amino acid sequence (See S1E Fig for sequences). All error bars represent one standard
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
3 / 36

Selective inhibition of ribosome nascent chain complexes
deviation of three replicates. (D) 3H-PF-06446846 binding to purified human ribosomes, Kd: 7.0 μM (95% CI: 5.5–8.4)
Bmax: 28.7 pmol/mg (95% CI: 26.5–30.8). The symbols within the graph represent the individual measurements
obtained from three independent experiments. Bmax and Kd values were calculated using GraphPad PRISM, in which
the complete (n = 3) dataset was fit to the one site-specific binding equation. (E–F) Electrophoreograms of toeprints
of stalled ribosomes on the (E) PCSK9(1–35)-luciferase fusion construct and (F) full-length PCSK9-luciferase fusion.
The nucleotide (nt) positions from the “A” of the ATG initiation codon of the first and last of the group of toeprinting
peaks are indicated. The expected position of the P-site of the stalled ribosome from ribosome profiling is also
indicated. (G) Schematic of ribosomal toeprinting assays. 5´ 6-FAM labeled primers are extended by reverse
transcriptase, which terminates when blocked by a ribosome. In this case, we also hypothesize that additional factors
may be bound to the stalled ribosome, obstructing the reverse transcriptase at more 3´ positions and over a broader
range of positions then what is normally observed [13]. (H) Sucrose density gradient profiles of cell-free translation
reactions programmed with an mRNA encoding an N-terminally extended PCSK9 in the presence of 100 μM PF-
06446846 (grey) and vehicle (blue). (I) Tris-Tricine SDS-PAGE gels showing 35S-Met-labelled peptides that sediment
in the polysome region of the gradient. (J) Model of the species isolated by density gradient centrifugation containing
one stalled ribosome and two queued ribosomes. The individual quantitative observations that underlie Fig 1B–D are
in S14 Table.
https://doi.org/10.1371/journal.pbio.2001882.g001
S2–S7 Tables. PF-06446846 inhibited the secretion of PCSK9 by Huh7 cells with an IC50 of
0.3 μM (S1A Fig). However, metabolic labeling of Huh7 cells with 35S-Met/Cys showed that
decreases in PCSK9 were not a consequence of global inhibition of protein synthesis (S1B and
S1C Fig). Furthermore, proteomic analysis of the Huh7 cells utilizing stable isotope labeling with
amino acids in cell culture (SILAC) indicated no general effect of PF-06446846 on the secreted
and intracellular proteome (S9 Fig, S8–S10 Tables). Taken together, these results indicate that
PF-06446846 exhibits a high degree of specificity for inhibiting the expression of PCSK9.
To identify the specific mechanism responsible for translation inhibition by PF-06446846,
we tested mRNAs encoding PCSK9-luciferase fusions in HeLa cell–derived in vitro translation
assays [12]. PF-06446846 inhibited translation of PCSK9-luciferase fusion constructs contain-
ing only the first 35 residues of PCSK9 and displayed comparable activity towards the first 33
residues (Fig 1B). In the HeLa cell-free translation assay, PF-06446846 inhibited PCSK9(1–
35)-luciferase expression with an IC50 of 2 μM, while at the maximum concentration evalu-
ated, 250 μM, the translation of luciferase without the PCSK9 N-terminal sequence was only
inhibited by 20% (S1D Fig). Translation of the protein fusion constructs was driven by the
encephalomyocarditis virus internal ribosome entry site (EMCV IRES), indicating that PF-
06446846 is unlikely to target PCSK9 translation initiation directly. When all the codons of
PCSK9(1–33) were mutated to either common or rare synonymous codons (S1E Fig), PF-
06446846 still inhibited translation of PCSK9(1–33)-luciferase (Fig 1C), ruling out a role of the
mRNA sequence. Conversely, PF-06446846 did not inhibit translation of a PCSK9(1–33) con-
struct with two compensatory frameshifts that result in a near endogenous mRNA sequence
but a nonendogenous amino acid sequence (Fig 1C and S1E Fig). These data indicate that PF-
06446846 sensitivity is primarily dependent on the amino acid sequence of PCSK9. To further
define the sequence requirements, we tested the activity of PF-06446846 against sets of N-ter-
minal deletions, C-terminal deletions, and alanine scanning mutations of PCSK9(1–33). The
most important regions in PCSK9(1–33) that confer sensitivity to PF-06446846 are Leu15–
Leu20, residues 9–11 (which include two tryptophan amino acids) and residues 31–33 (S10A
and S10B Fig). However, most mutations partially reduced the activity of PF-06446846, sug-
gesting that multiple amino acid features of PCSK9(1–35) make contributions to its sensitivity
to PF-06446846.
The sensitivity of the extreme N-terminal sequence of PCSK9 to PF-06446846 suggests that
PCSK9(1–35) may act as a small molecule–induced arrest peptide in the ribosome exit tunnel,
similar to arginine attenuator peptide, TnaC, ErmCL, and CatA86 [14]. [3H]PF-06446846
binds to purified human ribosomes (Kd = 7 μM) in filter-binding assays (Fig 1D). In ribosomal
toeprinting assays [13] of cell-free translation reactions programmed with full-length PCSK9
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
4 / 36

Selective inhibition of ribosome nascent chain complexes
and PCSK9(1–35)-luciferase fusions, 50 μM PF-06446846 induced reverse-transcriptase early
termination products consistent with stalling on and after codon 35 (Fig 1E and 1F). In typical
ribosomal toeprinting assays, 1–3 major peaks appear 14–16 nucleotides (nt) 3´ of the +2 posi-
tion of the codon in the P-site [13]. In the case of PF-06446846–stalled ribosomes, the toeprint-
ing peaks appeared in up to 14 nucleotide positions, depending on the construct used, and
were 18–31 nucleotides 3´ of the +2 positions of the P-site codon, determined using ribosome
profiling. The broader distribution of toeprint positions is consistent with the ribosome stall-
ing at multiple codons, as indicated by ribosome profiling. The 3´ shift of the toeprint peaks
relative to the ribosome profiling stall sites could be due to additional cellular factors recogniz-
ing and binding to the PF-06446846–stalled ribosomes (Fig 1G). In cell-free translation reac-
tions programmed with mRNA encoding full-length PCSK9 fused to an N-terminal extension,
PF-06446846 also resulted in the appearance of polysomes containing three small radiolabeled
peptides, suggesting that these PCSK9 nascent chains associated with one stalled ribosome, fol-
lowed by two queued ribosomes (Fig 1H–1J). Most arrest peptides function only in one
domain of life—i.e., solely in bacteria or solely in eukaryotes [14]. In agreement with this phe-
nomenon, PF-06446846 inhibited PCSK9(1–35)-luciferase translation in cell-free translation
systems derived from rabbit reticulocytes, wheat germ, and yeast but not from Escherichia coli
(S10C–S10F Fig).
PF-06446846 reduces circulating PCSK9 and total plasma cholesterol
levels in vivo
To explore the safety of the compound and to gain insight into the in vivo activity of PF-
06446846, male rats were orally administered PF-06446846 at doses of 5, 15, and 50 mg/kg daily
for 14 d. Plasma PF-06446846 (S11 Table) and PCSK9 concentrations were measured at 1, 3, 6,
and 24 h following the 1st and 12th dose, and total plasma cholesterol levels were assessed in
fasted animals just prior to necropsy on day 15. Dose-dependent lowering of plasma PCSK9
was observed following single and repeated dosing of PF-06446846 (Fig 2A and 2B). In addition
to the reduction in circulating levels of PCSK9, evidence of inhibition of PCSK9 downstream
function was observed at the 50 mg/kg dose, with a statistically significant 30% decrease in total
plasma cholesterol and 58% decrease in LDL cholesterol but no significant decrease in high-
density lipoprotein (HDL). This encouraging effect on circulating PCSK9 concentration was
achieved in the absence of modulating plasma liver function markers, with no treatment-related
changes observed for alanine transaminase (ALT), aspartate transaminase (AST) or albumin
(Fig 2C–2E and S11 Fig). Although reductions in cholesterol were observed, this endpoint is
poorly assessed in rodents, and the clinical experience shows that reduced free PCSK9 levels
represent the primary determinant of the improved lipid profile in humans [5–9, 11].
During the 2-wk dosing period, PF-06446846 was tolerated. There was a small decrease
(11%–13% relative to vehicle) in food consumption at 50 mg/kg PF-06446846 that was not asso-
ciated with any changes in body weight. Histological and clinical chemistry examination of
samples collected at day 15 indicated no dose-limiting changes compared to vehicle at the 5 and
15 mg/kg dose level. Administration of PF-06446846 at 50 mg/kg/day demonstrated a minimal
decrease in bone marrow cellularity (primarily involving erythroid parameters) that correlated
with a decrease in red cell mass (9%). Furthermore, mild reductions in white blood cells (52%),
lymphocytes (54%), T cell (approximately 54% in the total, helper, and cytotoxic T cells) and B
cell populations (58.4%), as well as minimal necrosis of the crypt cells of the ileum (in one of
five animals), were observed at 50 mg/kg/day. Importantly, no histopathological findings were
observed at any dose of PF-06446846 in the liver, the organ responsible for the majority of
PCSK9 production as well as maintaining whole-body cholesterol homeostasis [15, 16].
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
5 / 36

Selective inhibition of ribosome nascent chain complexes
Fig 2. Oral administration of PF-06446846 reduces plasma proprotein convertase subtilisin/kexin type 9
(PCSK9) and total cholesterol levels in rats. (A–B) Plasma PCSK9 levels following (A) a single and (B) 12 daily oral
doses of PF-06446848. Rats were administered the indicated dose of PF-06446846, and plasma concentrations of
PCSK9 were measured by commercial ELISA at 1, 3, 6, and 24 h after dosing (A) or the 12th daily dose (B). Symbols
represent mean concentration ± standard error and were jittered to provide a clearer graphical representation. Data
were analyzed using a mixed model repeated measure (MMRM) with treatment, day, and hour as fixed factors;
treatment by day and hour as an interaction term; and animal as a random factor. The significance level was set at a
level of 5%. No adjustment for multiple comparisons was used. *p ꢀ 0.05, **p ꢀ 0.01, ***p ꢀ 0.001. (C–E) Total
plasma (C), low-density lipoprotein (LDL) (D), and high-density lipoprotein (HDL) (E) cholesterol levels in rats measured
24 h following 14 daily oral doses of PF-06446846. Symbols represent individual animal values. The middle horizontal
bar represents the group mean ± standard deviation. Difference between group means relative to vehicle was
performed by a one-way ANOVA followed by a Dunnett’s multiple comparisons test; * p ꢀ 0.05, **** p ꢀ 0.0001. The
individual quantitative observations that underlie Fig 2 are in S14 Table.
https://doi.org/10.1371/journal.pbio.2001882.g002
Translation-focused, genome-wide identification of PF-06446846
sensitive genes
While the absence of adverse histopathological changes is consistent with the high degree of
selectivity observed in SILAC experiments (S9 Fig), we used ribosome profiling [17–19] to
provide a higher-resolution understanding of the selectivity of PF-0644846 at the level of
mRNA translation. Huh7 cells were treated with 1.5 and 0.3 μM PF-06446846 (5x and 1x the
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
6 / 36

Selective inhibition of ribosome nascent chain complexes
IC50 in Huh7 cells) (Fig 1A) or a vehicle control for 10 and 60 min in three biological repli-
cates, and ribo-seq libraries were prepared. To measure mRNA abundance and translational
efficiencies, we subsequently conducted a second ribosome profiling study in which Huh7
cells were treated with 1.5 μM PF-06446846 or vehicle for 1 h, and both ribo-seq and mRNA-
seq libraries were prepared from the same sample.
Metagene analysis [20, 21] of the distribution of ribosomal footprints relative to the start
and stop codons displayed the hallmarks of ribosome footprints [18, 19], including 3-nt peri-
odicity through the coding DNA sequence (CDS) regions and a minimal number of reads
mapping to 3´-UTR regions (Fig 3A–3D and S12 Fig). We also observed high correlation
between replicates in reads aligning to individual genes (S13 Fig). We consistently observed a
compound-independent depletion of reads aligning to the first forty codons of the CDS
regions, a large buildup of reads on the stop codon, and a small queued ribosome peak
upstream from the stop codon [22] (Fig 3A–3D and S12 Fig). This buildup may be due to
omission of the cycloheximide pretreatment step [22–24], which we omitted to avoid an arte-
factual buildup of reads near the start codon [19]. PF-06446846 treatment induced no change
in the average distribution of reads along the CDS after 1 h of treatment (Fig 3C) and only a
small PF-06446846–induced accumulation of reads mapping to the first 50 codons after a 10
min treatment (Fig 3A), indicating that PF-06446846 does not cause pausing or stalling on
most transcripts. The PF-06446846–induced increase in early read counts at the 10 min time-
point, but not at the 60 min timepoint, may indicate the induction of cellular stress upon the
initial exposure to PF-06446846 followed by adaptation within the 1 h timeframe.
Differential expression analysis using the ribosome footprint data revealed that 1,956 genes
are differentially expressed after 10 min of treatment at a false discovery rate (FDR) of 10%
(DeSeq) but only 9 after 1 h (Fig 3E and 3F). Only a single gene, EFNA3, displayed a difference
in transcript levels (FDR < 10%). mRNA-seq and translational efficiency (TE) analysis reveals
that almost all of the change in expression levels occurs at the translation step (Fig 3G–3I). The
two features present in the data at 10 min but not at 1 h—the relative global depletion of reads
between nt positions +2 and +100 of the CDS and the large number of genes displaying a brief
change in translation levels—could be indicative of cellular stress after 10 min of treatment.
Thus, we focused the following analyses generally on the 1-h treatment time.
Examination of ribosomal footprints aligning to the PCSK9 transcript (Fig 4A–4C) revealed
a PF-06446846–dependent buildup of footprints centered on codon 34, consistent with ribo-
somal stalling at this position. The number and distribution of fragments from mRNA-seq was
unaffected by PF-06446846 (Fig 4D). PF-06446846 treatment also resulted in a decrease in
ribosome footprints mapping 3´ to the stall site on the PCSK9 transcript. Notably, the magni-
tude of the decrease in footprints 3´ to the stall site is similar to the level of inhibition of
PCSK9 expression as measured by ELISA (Fig 4E), indicating that for PF-06446846–sensitive
proteins, the decrease in reads mapping 3´ to the stall site could function as a surrogate mea-
surement of the extent of translation inhibition for a given protein. Thus, PF-06446846 targets
should be detectable through differential expression analysis using only the reads that align 3´
to the stall site. In our second ribosome profiling study, we found that the magnitude of the
buildup of reads at the stall site was smaller for both PCSK9 (Fig 4C) and other targets, while
the number of reads mapping 3´ to the stall site remained consistent. The variability in magni-
tude of the stall peak could be an artefact of the size-selection step during library preparation;
subsequent to our initial set of experiments, it was reported [25, 26] that ribosome profiling of
stalled ribosomes can yield a broader range of protected footprint sizes than the conventional
26–34 nt range [19].
To identify and quantify the sensitivity of individual proteins to PF-06446846, we adopted a
computational approach to identify transcripts that could potentially have PF-06446846–
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
7 / 36

Selective inhibition of ribosome nascent chain complexes
Fig 3. PF-06446846 does not cause widespread ribosomal stalling. (A–D) Metagene plots showing the
normalized mean read counts at the nucleotide (nt) positions relative to the start and stop sites for cells treated
with 1.5 μM PF-06446846 (red trace) and vehicle (blue trace) for (A–B) 10-min treatment and (C–D) 1-h
treatment. In panels A–D, reads positions are displayed according to the inferred ribosomal P-site [19]. In
panels A and C, the values are averaged over three nucleotides for clarity. Panels B and D represent zoomed
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
8 / 36

Selective inhibition of ribosome nascent chain complexes
views of the treatment datasets only to show three-nucleotide periodicity and preferential mapping to coding
DNA sequence (CDS) regions, the hallmark features of ribosome profiling data. The normalized mean reads
(NMR) were calculated as in [20]. The normalized read count at a given position on a particular mRNA is the
number of reads aligning to that position divided by the average read density along the CDS. These values are
then averaged across all transcripts of sufficient length. (E–G) Log2-fold change in the number of reads
mapping to a given gene plotted against overall expression level of that gene as calculated by DeSeq. (E)
10-min treatments, (F) 1-h treatments, (G) mRNA-seq datasets for the translational efficiency (TE) data.
Genes with a significant (false discovery rate [FDR] < 10%) change in expression are highlighted in red. (H–I)
Changes in expression level are primarily due to changes in translation, not transcript levels. (H) Changes in
TE plotted against expression level (read count). Red points indicate outliers (expression-level Z-score > 3.0)
[22]. All changes in TE with Z-score > 3 are decreases. (I) Z-score–transformed change in ribo-seq read
counts upon PF-06446846 treatment, plotted against the Z-score–transformed change in mRNA-seq read
counts. The outliers (red) are spread solely along the x-axis, consistent with PF-06446846 expression level
changes occurring primarily at the level of translation. For a further description of the Z-score transformation,
see the Materials and methods and [22].
https://doi.org/10.1371/journal.pbio.2001882.g003
induced stalls, estimate the position of the stalls, and use differential expression analysis using
only reads aligning 3´ to the stall site (Fig 5A). To estimate a 3´ bound for the positions of
potential PF-06446846–induced pauses, we adapted the approach previously reported [21].
For each gene, we plotted the percentage of the total reads aligning at or 5´ to each codon to
generate cumulative fractional read (CFR) plots (Fig 5B and 5C). If PF-06446846 induced a
stall, the CFR plot should increase rapidly 5´ to the stall and level off 3´ to the stall. We define
the maximum divergence between the PF-06446846 and vehicle CFR plots as the Dmax and the
codon at which Dmax occurs as the Dmax position, which is analogous to the Kolmogorov–
Smirnov position previously described [21]. For genes with one or more PF-06446846–
induced stalls, the Dmax position occurs 3´ to the last stall site. For genes with a high Dmax (Z-
score > 2), we used reads mapping 3´ to the position of Dmax for differential expression analy-
sis (Fig 5D, see Methods for details). Using this approach, we identified 22 PF-06446846–sensi-
tive genes at the 60-min timepoint (Fig 5E–5I, S14 Fig and S13 Table) and 44 genes at the
10-min timepoint (Dmax Z-score > 2, DeSeq FDR > 10%). With the exception of cadherin-1
(CDH1) and interferon gamma–inducible protein 30 IFI30, all PF-06446846–sensitive pro-
teins identified at the 1-h timepoint were also identified at the 10-min timepoint. To test the
robustness of our approach, we also analyzed the data from the second ribosome profiling
experiment with the same pipeline. Despite most stall peaks being smaller in the second study,
we identified all of the same PF-06446846–sensitive sequences as for the data from study 1,
demonstrating the advantage of using information from the entire transcript instead of a single
codon.
SILAC-based proteomic analyses of lysates of Huh7 cells treated for 4 h or 16 h with
0.25 μM or 1.25 μM PF-06446846 (the same cells as those from which the secretome data were
obtained) failed to detect most of the hits identified by ribosome profiling, including PCSK9,
when data were analyzed using the same criteria as for the secretome (S9E–S9H Fig). With a
reduction in stringency (proteins with 3 unique peptides accepted), a 2- to 3-fold reduction in
CDH1 production was detectable after 16 h of treatment with PF-06446846 (S9G and S9H
Fig). These results suggest that depletion of the levels of transcript-stalled proteins are likely to
occur at a rate governed by protein turnover.
In addition to stalling on the main open reading frame (ORF), it is possible that stalling on
upstream ORFs could lead to a change in translation of the main ORF. We thus analyzed all
upstream ORFs for a change in read density and found none that displayed an increase in
reads with PF-06446846 treatment that was consistent across replicates. SORCS2, FAM13B,
and LRP8, the three genes that are downregulated at the 1-h timepoint but do not have a Dmax
Z-score > 2, do not have translated upstream open reading frames (uORFs).
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
9 / 36

Selective inhibition of ribosome nascent chain complexes
Fig 4. The PF-06446846–induced stall site is revealed by ribosome profiling. (A–D) Ribosome footprint density plots displaying the number of
reads aligning to a given codon per million total reads for the proprotein convertase subtilisin/kexin type 9 (PCSK9) coding region from Huh7 cells
treated for (A) 1 h and (B) 10 min. (C) Ribo-seq datasets from the second study and (D) mRNA-seq datasets from the second study. The upward red
bars indicate readmaps from cells treated with 1.5 μM PF-06446846 and the blue downward bars represent vehicle. In panels A–D, read positions are
mapped according to inferred location of the ribosome P-site [19]. (E) The footprint density downstream from the stall in the 10-min treatment (black)
and 1-h treatment (light grey) compared with PCSK9 expression as measured by ELISA (middle grey). Error bars represent one standard deviation of
three replicates. The individual quantitative observations that underlie Fig 4E are in S14 Table.
https://doi.org/10.1371/journal.pbio.2001882.g004
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
10 / 36

Selective inhibition of ribosome nascent chain complexes
Fig 5. Identification and validation of PF-06446846–sensitive nascent chains. (A) Outline of the approach to identify PF-06446846–targeted
mRNAs. (B) Example readplot and (C) example cumulative fractional read (CFR) plot for proprotein convertase subtilisin/kexin type 9 (PCSK9). A CFR
plot depicts at each codon the percentage of reads aligning at or 5´ to that codon. In all plots, data from 1.5 μM PF-06446846 treatments are shown in
red and vehicle treatments are shown in blue. The major stall and the position of Dmax is marked. (D) Scatterplot showing the distribution of Dmax values
as a function of read counts; red indicates Dmax Z-score > 3 (see Materials and methods for Z-score calculations) and green indicates 2 < Z-score < 3.
(E) Scatterplot of fold change versus expression level when reads mapping 3´ to Dmax position (for Z-score > 2) or codon 50 (for Z-score < 2) are used.
Genes for which Dmax Z-score > 2 and DeSeq fasle discovery rate (FDR) < 10% are highlighted in red, in green for Dmax Z-score > 2 but FDR > 10%,
and in purple for Dmax Z-score < 2 with FDR < 10%. (F–I) Example readplots for PF-06446846–sensitive proteins (F) HSD17B11, (G) RPL27, (H)
PCBP1, and (I) cadherin-1 (CDH1). Bars representing the treatment dataset are red and go upwards and bars representing the vehicle datasets are
blue and go downwards. All graphs are derived from the 1-h treatment time in the first study. (J) Cell-free translation assays showing inhibition of
translation by 50 μM PF-06446846 when the stall sites identified by ribosome profiling are fused to the N-terminus of luciferase. (K) Inhibition of in vitro
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
11 / 36

Selective inhibition of ribosome nascent chain complexes
translation of full-length Midikine- and BCAP31-luciferase fusions in the cell-free translation system. (L) In vitro translation of control constructs not
predicted to be inhibited by PF-06446846 from cell-based experiments. (M) In vitro translation of constructs with PF-06446846–induced stalls identified
only at the 10-min treatment time. The individual quantitative observations that underlie Fig 5J–M are in S14 Table.
https://doi.org/10.1371/journal.pbio.2001882.g005
To validate our approach, we tested the translational inhibitory activity of PF-06446846 for
a set of the targets identified in the 1-h datasets in HeLa-derived, cell-free translation reactions.
In all but two cases, translation of constructs consisting of the predicted stall site fused to lucif-
erase was inhibited by PF-06446846 (Fig 5J). For the other two proteins, Midikine and
BCAP31, the translation of luciferase fusions to the full-length proteins was inhibited by PF-
06446846 (Fig 5K). Four control sequences predicted not to be PF-06446846–sensitive were
inhibited at comparable levels to luciferase alone (Fig 5L).
We next tested the translation inhibition of PF-06446846 towards four example “stall
sequences” identified only in the 10-min dataset. PF-06446846 inhibited translation of all of
these transcripts only slightly more than luciferase alone (Fig 5M). These results indicate that
the most sensitive PF-06446846 targets are those identified using the 1-h treatment time. The
additional effects seen in the 10-min treatment could be due to a partial adaptation of the cells
on the 1-h timescale, or the cells could be sensitized during the first 10 min of compound treat-
ment because of the sudden media changes required for the experiment. In either case, these
data indicate that 1-h treatment times are most appropriate for evaluation of this and similar
compounds.
As a complimentary approach, we also calculated the change in mean read position or cen-
ter of density [22] between the 1.5 μM PF-06446846 and vehicle data and used a Z-score trans-
formation [27] to identify outliers. 17 transcripts with a significant change in the center of read
density (Z > 3) were identified in the 1-h datasets (Fig 6A and S14T Fig). Of these, 13 were
also identified using the Dmax approach (S14T Fig). For the hits identified using only center-
of-density analysis, VPS25 and TM2D3 had stalls but no decrease in downstream reads, indi-
cating that the stall was unlikely to result in a decrease in protein production (S14P and S14Q
Fig). MAPRE1 did not have a clear stall site (S14R Fig). COX10 (S14S Fig) had a series of PF-
06446846–induced stalls near the stop codon, which would be difficult to detect using the
Dmax approach because of a lack of downstream reads to quantify. We also used center-of-den-
sity analysis to confirm the bias for stalling near the 5´ ends of the CDS by repeating the cen-
ter-of-density analyses omitting the first 50, 100, and 150 codons, respectively (Fig 6B–6D). In
all cases, the cluster of outliers disappeared, indicating that while there are exceptions, PF-
06446846–induced stalls most often occur in the first 50 codons.
To confirm that the decrease in reads downstream from PF-06446846–induced stalls occur
as a result of changes in translation as opposed to mRNA levels, we plotted the change Z-score
transformed [22] (see Materials and methods) in mRNA-seq reads versus the changes in ribo-
seq reads (Fig 6E). For all identified PF-06446846–sensitive sequences, the changes in ribo-
some footprints were due solely to changes at the level of translation (Fig 6E). We additionally
tested how transcript levels of PF-06446846 targets change with longer-scale treatments and
under different growth conditions by treating Huh7 cells grown in either standard or lipopro-
tein-depleted fetal bovine serum (FBS) for 4 and 24-h with 1.5 μM PF-06446846, then measur-
ing the transcript levels by quantitative reverse transcription PCR (RT-qPCR). With four
biological replicates, no consistent changes in target transcript levels were found (S15A and
S15B Fig), consistent with PF-06446846–induced changes in protein expression occurring at
the translation step.
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
12 / 36

Selective inhibition of ribosome nascent chain complexes
Fig 6. Features of PF-06446846–sensitive transcripts. (A) Changes in the mean read position or center of
density [22] plotted against expression levels. Genes with a local Z-score greater than 3 are highlighted in red.
(B–D) Center-of-density analysis with first (B) 50, (C) 100, and (D) 150 codons omitted, showing that stalling
preferentially occurs before codon 50. (E) Expression changes for PF-06446846–sensitive transcripts occur
at the step of translation. Plot of Z-score–transformed [22] read counts for mRNA-seq and ribo-seq. PF-
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
13 / 36

Selective inhibition of ribosome nascent chain complexes
06446846–sensitive nascent chains are highlighted in red. (F) Alignment of PF-06446846–sensitive
sequences. The sequences are aligned according to the stall position, and the residues predicted to reside in
the ribosome exit tunnel, P-site, and A-site are indicated.
https://doi.org/10.1371/journal.pbio.2001882.g006
Discussion
To our knowledge, PF-06446846 is the first example of an orally-active small molecule that
inhibits PCSK9 function through a mechanism that directly reduces its synthesis. Although
the narrow margin between PCSK9-lowering and hematopoietic effects likely prevents clinical
development of PF-06446846, it demonstrates that it may be possible to modulate PCSK9
function with a small molecule. This has been a challenge for small molecules by conventional
means, as it requires the disruption of the small, flat interaction between PCSK9 and the LDLR
that represents the primary contact patch at neutral pH. The importance of PCSK9 in regulat-
ing LDL-C clearance by LDLR is underscored by the greater degree of LDL-C lowering possi-
ble with mAbs relative to statins. However, by their nature, anti-PCSK9 mAbs are unable to
modulate PCSK9 and LDL-C levels in an intermediate fashion. Inhibition of PCSK9 synthesis
by a small molecule could provide additional options for patients and physicians by offering a
range of inhibition to balance safety and efficacy.
This work also represents the first demonstration of the potential for selective inhibitors of
eukaryotic mRNA translation as a therapeutic approach. The reduction of PCSK9 demon-
strated by PF-06446846 in vivo with no sign of toxicity in the liver is consistent with the high
selectivity observed by ribosome profiling. It is unclear whether a lack of complete selectivity
evident in the very small number of transcripts whose translation was perturbed by PF-
06446846 is responsible for the adverse effects seen outside the liver at the highest dose.
PF-06446846 induces the ribosome to stall on the PCSK9 transcript a few codons beyond to
the end of the signal peptide. Ribosome profiling reveals that despite acting on the human
ribosome, PF-06446846 is exceptionally specific. Interestingly, the validated off-targets have
few common features in their primary structures predicted to be present in the ribosome exit
tunnel when stalling occurs (Fig 6F). Although a number of the PF-06446846–sensitive
sequences include a leucine repeat or hydrophobic stretch N-terminal to their stall sites, the
vast majority of hydrophobic stretches in all of the translated proteins are unaffected. These
results indicate that, although PF-06446846 sensitivity is determined by amino acid sequence,
stalling cannot be predicted by a simple primary structure motif. Additional requirements for
stalling are likely to include the structure adopted by the nascent chain in the exit tunnel [28,
29] or the context in which the sensitive sequence occurs.
One common feature of the PF-06446846–sensitive proteins is that stalling usually occurs
early in the protein coding region; 15 of the 18 stalls identified in the 1-h treatment occur
before codon 50, with the most N-terminal stall site occurring at codon 16. The heightened
sensitivity of N-terminal regions of proteins to PF-06446846 could be due to a unique feature
early in the elongation phase of translation. Most stalls would likely occur before the nascent
chain emerges from the ribosomal exit tunnel or when only a few residues are extruded. Our
mutagenic analysis also indicates that the most critical residues for PF-06446846–induced
stalling reside in the exit tunnel, pointing to the ribosomal exit tunnel as a critical element of
PF-06446846 action. This is consistent with previous findings that the ribosomal exit tunnel
acts as a functional environment, allowing certain peptides and small molecules to induce
ribosome stalling [14, 30–35].
Most translation regulation mechanisms in eukaryotes identified to date act on the initia-
tion step [36]. PF-06446846 presents a case of protein production rates controlled during elon-
gation. Translation regulation during elongation presents an interesting mechanistic puzzle as,
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
14 / 36

Selective inhibition of ribosome nascent chain complexes
theoretically, every ribosome that initiates should eventually result in a full-length protein,
regardless of how long it takes to traverse the CDS. Our mRNA-seq and RT-qPCR data rule
out the possibility that the stalled ribosome induces no-go decay [37] or other mRNA quality
control mechanisms that decrease overall mRNA levels. It is possible that PF-06446846–
induced stalling near the N-terminus could impede initiation, thus lowering the overall initia-
tion rate. Evidence for “queued” ribosomes (Fig 1H–1J) suggest impeding of initiation could
occur for stalls near the N-terminus. However, an impact on translation initiation could not
explain the effects of more C-terminal stalling on CDH1 levels (S9G and S9H Fig) and would
predict that PF-06446846–sensitive transcripts would display a bias for higher TE, which they
do not (S15C Fig). Alternatively, the stalled ribosomes may be removed from the transcript by
a “rescue” mechanism and not complete translation. Future experiments will be required to
determine the underlying mechanisms of protein reduction because of ribosome stalling by
PF-06446846.
While PF-06446846 directly and selectively inhibits the translation of PCSK9 during the
elongation phase, most drugs and drug candidates known to modulate human translation tar-
get translation initiation factor complexes or upstream signaling pathways such as mammalian
target of Rapamycin (mTOR) [38, 39]. Furthermore, they generally modulate translation of a
large number of mRNAs. One drug candidate, Ataluren, selectively induces readthrough of
premature stop codons while not affecting termination at native stop codons [40]. The present
example of PF-06446846 demonstrates that drug-like small molecules have the potential to
directly modulate human translation elongation for therapeutic purposes. The variability in
the protein primary structures affected by PF-06446846 suggest that each target may be
affected by a slightly different mechanism and that analogues of PF-06446846 could be further
optimized for improved selectivity for PCSK9 or even to target other proteins.
Materials and methods
Ethics statement
All procedures performed on animals in this study were in accordance with established guide-
lines and regulations and were reviewed and approved by the Pfizer Institutional Animal Care
and Use Committee. Pfizer animal care facilities that supported this work are fully accredited
by AAALAC International.
Synthesis of PF-06446846
All chemicals, reagents, and solvents were purchased from commercial sources and used with-
out further purification. All reactions were performed under an atmosphere of nitrogen unless
otherwise noted. Nuclear magnetic resonance spectra (1H, 13C NMR) were recorded with 400
MHz–600 MHz Varian or Bruker spectrometers. Chemical shifts are expressed in parts per
million downfield from tetramethylsilane. The peak shapes are denoted as follows: s, singlet; d,
doublet; t, triplet; q, quartet; m, multiplet; br s, broad singlet. Because of differences in solvents
used in sample preparation and, in some cases, amount of water present, not all exchangeable
protons were observable. Mass spectrometry (MS) was performed via atmospheric pressure
chemical ionization (APCI) or electron scatter (ESI) ionization sources. Silica gel chromatog-
raphy was performed using a medium pressure Biotage or ISCO system using columns pre-
packaged by various commercial vendors including Biotage and ISCO. Whatman precoated
silica gel plates (250 μm) were used for analytical TLC. Microanalyses were performed by
Quantitative Technologies Inc. and were within 0.4% of the calculated values.
Liquid chromatography mass spectrometry (LCMS) was performed as follows:
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
15 / 36

Selective inhibition of ribosome nascent chain complexes
Analytical UPLC-MS method 1. Column: Waters Acquity HSS T3, C18 2.1 x 50 mm,
1.7 μm; Column T = 60˚C. Gradient: Initial conditions: A-95%:B-5%; hold at initial from 0.0–
0.1 min; linear ramp to A-5%:B-95% over 0.1–1.0 min; hold at A-5%:B-95% from 1.0–1.1 min;
return to initial conditions 1.1–1.5 min. Mobile phase A: 0.1% formic acid in water (v/v).
Mobile phase B: 0.1% formic acid in acetonitrile (v/v). Flow rate: 1.25 mL/min
Analytical UPLC-MS method 2. Column: Waters Acquity HSS T3, C18 2.1 x 50 mm,
1.7 μm; Column T = 60˚C. Gradient: Initial conditions: A-95%:B-5%; hold at initial from 0.0–
0.1 min; linear ramp to A-5%:B-95% over 0.1–2.6 min; hold at A-5%:B-95% from 2.6–2.95
min; return to initial conditions 2.95–3.0 min. Mobile phase A: 0.1% formic acid in water (v/
v). Mobile phase B: 0.1% formic acid in acetonitrile (v/v). Flow rate: 1.25 mL/min.
High-performance liquid chromatography purity assessment was performed as follows:
Analytical HPLC method 1. Column: Waters BEH C8 2.1 x 100 mm, 1.7 μm. Gradient:
Initial conditions: A-95%:B-5%; linear ramp to A-0%:B-100% over 0.0–8.20 min; hold at A-
0%:B-100% from 8.2–8.7 min; return to initial conditions 8.7–8.8 min; hold at A-95%:B-5%
from 8.8–10.3 min. Mobile phase A: 0.2% of 70% perchloric acid in water (v/v). Mobile phase
B: acetonitrile. Flow rate: 0.5 mL/min. Detection: UV-210 nm.
tert-butyl (3R)-3-[(3-chloropyridin-2-yl)amino]piperidine-1-carboxylate. A mixture of
2-bromo-3-chloropyridine (203.8 g, 1.06 moles), sodium tert-amylate (147 g, 1.27 moles), tert-
butyl (3R)-3-aminopiperidine-1-carboxylate (249.5 g, 1.25 moles) in toluene (2 L) was heated to
80˚C. To this solution was added chloro(di-2-norbornylphosphino)(2-dimethylaminoferrocen-
1-yl) palladium (II) (6.1 g, 10.06 mmol) followed by heating to 105˚C and holding for 3 h. The
reaction mixture was cooled to room temperature, 1 L of water was added, then the biphasic
mixture was filtered through Celite. After layer separation, the organic phase was washed with 1
L of water followed by treatment with 60 g of Darco G-60 at 50˚C. The mixture was filtered
through Celite and concentrated to a final total volume 450 mL, resulting in the precipitation of
solids. To the slurry of solids was added 1 L of heptane. The solids were collected via filtration
and then dried to afford the title compound as a dull orange solid (240.9 g, 73% yield). 1H NMR
(CDCl3, 600 MHz) δ 8.03 (d, J = 4.7 Hz, 1H), 7.45 (d, J = 6.7 Hz, 1H), 6.57–6.51 (m, 1H), 5.08
(br s, 1H), 4.14 (br s, 1H), 3.85–3.30 (m, 4H), 2.00–1.90 (m, 1H), 1.80–1.55 (m, 4H), 1.43 (br s,
9H); 13C NMR (CDCl3, 100.5 MHz) δ 150.0, 153.2, 146.0, 135.9, 115.3, 112.9, 79.5, 48.6, 46.4,
43.7, 29.8, 28.3, 22.4; UPLC (UPLC-MS method 1): tR = 0.72 min. MS (ES+) 312.0 (M+H)+;
HRMS (m/z) [M+H]+ calcd for C15H23ClN3O2, 312.1473; found, 312.1467.
4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzoic acid. The following synthesis is based
on that reported in [41]. Step 1: To a solution of 2-chloro-3-nitropyridine (95.0 g, 0.600 mol)
and ethyl 4-aminobenzoate (99.0 g, 0.600 mol) in toluene (3 L) was added K2CO3 (166 g, 1.20
mol), BINAP (7.40 g, 11.8 mmol), Pd(OAc)2 (2.80 g, 12.5 mmol), and NaI (2.70 g, 18.0 mmol).
The mixture was stirred at 110˚C for 6 h. The reaction mixture was cooled to 30˚C, filtered
through Celite, and the filtrate was concentrated in vacuo. The residue was transferred to a
separatory funnel with water (300 mL) and extracted with EtOAc (3 x 300 mL). The organic
layers were dried over Na2SO4, filtered, and the filtrate was concentrated in vacuo to give a
dark solid residue, which was washed with acetone/water (5/1, 100 mL) and filtered to afford a
yellow solid (142 g, 82%).1H NMR (DMSO-d6) δ 8.60–8.57 (m, 2H), 7.96–7.94 (m, 2H), 7.89–
7.87 (m, 2H), 7.12 (dd, 1H), 4.31 (q, 2H), 1.33 (t, 3H). Step 2: To a solution of ethyl 4-((3-nitro-
pyridin-2-yl)amino)benzoate from step 1 (120 g, 0.417 mol), in ethanol (2.00 L), was added
Raney-Ni (30 g). The reaction mixture was hydrogenated under a H2 atmosphere (50 psi) at
30˚C for 20 h. The mixture was filtered through Celite. The filtrate was dried over Na2SO4, fil-
tered, and the filtrate was concentrated in vacuo to afford a yellow solid. The yellow solid was
washed with dichloromethane to give a yellow solid (75 g, 70%). 1H NMR (DMSO-d6) δ 10.05
(br, 1H), 7.94 (d, 2H), 7.54 (d, 1H), 7.46 (d, 2H), 7.40 (d, 1H), 7.09 (dd, 1H), 4.30 (q, 2H), 1.31
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
16 / 36

Selective inhibition of ribosome nascent chain complexes
(t, 3H). Step 3: To a solution of ethyl 4-((3-aminopyridin-2-yl)amino)benzoate from step 2
(70.0 g, 0.272 mol) in a mixture of AcOH (70 mL) and water (70 mL) was added NaNO2 (23.8
g, 0.345 mol) at 0˚C. The mixture was stirred at 30˚C for 20 min. The mixture was diluted with
dichloromethane (100 mL) and washed with water (3 x 50 mL). The organic phase was dried
over Na2SO4, filtered, and the filtrate was concentrated in vacuo to afford a dark solid. The
solid was washed with acetone (30 mL) to afford a white solid (63 g, 86%). 1H NMR (DMSO-
d6) δ 8.91 (d, 1H), 8.91 (dd, 1H), 8.50 (d, 2H), 8.24 (d, 2H), 7.66 (dd, 1H), 4.37 (q, 2H), 1.36 (t,
3H). Step 4: To a solution of ethyl 4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzoate from step
3 (60.0 g, 0.224 mol) in MeOH (700 mL) was added 2N NaOH (260 mL, 0.520 mmol). The
mixture was stirred at 60˚C for 2 h. The mixture was acidified with 1N HCl so that the pH of
the solution was approximately pH 1. The reaction mixture was extracted with EtOAc (3 x 100
mL). The combined organic layers were dried over Na2SO4, filtered, and the filtrate was con-
centrated in vacuo to afford a white solid (52 g, 97%).1H NMR (DMSO-d6, 600 MHz) δ 13.23
(br, 1H), 8.91 (d, 1H), 8.76 (d, 1H), 8.48 (d, 2H), 8.24 (d, 2H), 7.67 (dd, 1H); 13C NMR
(DMSO-d6, 100.5 MHz) δ 166.5, 151.6, 144.7, 139.2, 137.4, 130.9, 130.1, 129.4, 121.1, 120.5;
HRMS (m/z) [M+H]+ calcd for C12H9N4O2, 241.0720; found, 241.0719.
N-(3-chloropyridin-2-yl)-N-[(3R)-piperidin-3-yl]-4-(3H-[1,2,3]triazolo[4,5-b]pyridin-
3-yl)benzamide (PF-06446846). Step 1: Oxalyl chloride (8.1 mL, 91.9 mmol) was added to a
mixture of 4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzoic acid (20.1 g, 83.5 mmol) in
dichloromethane (200 mL) and N,N-dimethylformamide (1 mL). The reaction mixture was
stirred at room temperature for 2 h and then evaporated. The residue was diluted with toluene,
evaporated to dryness, and dried under vacuum overnight. The crude acid chloride was com-
bined with tert-butyl (3R)-3-[(3-chloropyridin-2-yl)amino]piperidine-1-carboxylate (26.7 g,
85.5 mmol) in THF (250 mL) and cooled to 0˚C. Lithium bis(trimethylsilyl)amide (83 mL, 83
mmol, 1 M solution in THF) was added dropwise. The resulting mixture was warmed to room
temperature and stirred overnight. The reaction mixture was diluted with water and extracted
with EtOAc (2 × 80 mL). The combined organic layers were dried over MgSO4, filtered, and
the filtrate was concentrated. The residue was purified by silica gel column chromatography
eluting with a gradient of 0%–60% EtOAc/heptane to provide 35.2 g (79%) of the product as a
solid. UPLC (UPLC-MS method 2): tR = 0.75 min. MS (ES+): 534.3 (M+H)+. Step 2: A solution
of tert-butyl (3R)-3-(4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)-N-(3-chloropyridin-2-yl)benza-
mido)piperidine-1-carboxylate from Step 1 (33.0 g, 61.8 mmol) in dichloromethane (200 mL)
and MeOH (40 mL) was treated with HCl (4 M solution in 1,4-dioxane) (309 mL, 1,240
mmol). After stirring at room temperature overnight, the reaction mixture was concentrated.
The resulting residue was suspended in a mixture of EtOAc (300 mL)/MeOH (50 mL) and stir-
red at room temperature overnight. The solids were filtered, slurried in MeOAc overnight, fil-
tered, and dried under vacuum to provide 28.5 g (98%) of crystalline N-(3-chloropyridin-
2-yl)-N-[(3R)-piperidin-3-yl]-4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzamide hydrochlo-
ride. An analytical sample could be recrystallized from MeOH/EtOAc, m.p.: 249–251˚C; TLC
(CH2Cl2:MeOH, 80:20, v/v): RF = 0.22; [α]D25 = +55.9˚ (c = 1.965, MeOH); 1H NMR (d4-
MeOH, 400 MHz, mixture of rotomers) d8.81 (dd, J = 1.6, 4.7 Hz, 1H), 8.62 (br d, J = 3.5 Hz,
1H), 8.56 (dd, J = 1.2, 8.2 Hz, 1H), 8.33–8.25 (m, 2H), 7.87–7.79 (m, 1H), 7.66–7.55 (m, 3H),
7.42 (dd, J = 7.8, 4.7 Hz, 1H), 5.19–5.06 and 4.84–4.70 (m, 1H), 3.89–3.73 (m, 1H), 3.70–3.57
(m, 1H), 3.39 (br d, J = 12.5 MHz, 1H), 3.00–2.88 (m, 1H), 2.42–2.37 and 2.20–1.85 (m, 3H),
1.57–1.44 (m, 1H); 13C NMR (d4-MeOH, 100.5 MHz) d22.9, 26.6, 44.7, 47.7, 52.4, 120.9, 122.0,
126.8, 130.0, 130.9, 132.2, 136.1, 138.9, 139.2, 141.1, 146.1, 149.0, 151.4, 152.4, 170.8; IR (neat):
1658 cm-1; HPLC purity (analytical HPLC method 1): 99.52%, tR = 3.048 min; HRMS (m/z)
[M+H]+ calcd for C22H21ClN7O, 434.1491; found, 434.1492; analysis (hydrochloride salt) (%
calcd, % found for C22H20ClN7O. HCl. 0.5 MeOH. 0.65 H2O): C (54.26, 54.07), H (4.92, 4.65),
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
17 / 36

Selective inhibition of ribosome nascent chain complexes
N (19.68, 19.71), Cl (14.24, 13.98); analysis (freebase) (% calcd, % found for C22H20ClN7O): C
(60.90, 60.88), H (4.65, 4.51), N (22.60, 22.44), Cl (8.17, 8.24).
Single crystal X-ray analysis for N-(3-chloropyridin-2-yl)-N-[(3R)-piperidin-3-yl]-4-(3H-
[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzamide PF-06446846 (CCDC 1449348). Data collec-
tion was performed on a Bruker APEX diffractometer at room temperature. Data collection
consisted of three omega scans at a low angle and three at a high angle, each with 0.5 step. In
addition, two phi scans were collected to improve the quality of the absorption correction. The
structure was solved by direct methods using SHELX software suite in the space group P1. The
structure was subsequently refined by the full-matrix least squares method. All nonhydrogen
atoms were found and refined using anisotropic displacement parameters. The compound
crystallizes with two independent molecules in the asymmetric unit in the chiral space group
of P1, but exhibits pseudo-inversion symmetry, emulating P-1, that relates the two molecules
to each other. Inversion symmetry is broken by the chirality of the molecules, with both mole-
cules having the same stereochemistry.
All hydrogen atoms were placed in calculated positions and were allowed to ride on their
carrier atoms. The final refinement included isotropic displacement parameters for all hydro-
gen atoms. Analysis of the absolute structure using likelihood methods [42] was performed
using PLATON [43]. The results indicate that the absolute structure has been correctly
assigned. The method calculates that the probability that the structure is correct is 100.0. The
Hooft parameter is reported as 0.06 with an esd of 0.019.
The final R-index was 3.8%. A final difference Fourier map revealed no missing or mis-
placed electron density. Pertinent crystal, data collection, and refinement are summarized in
S1 Table. Atomic coordinates, bond lengths, bond angles, torsion angles, and displacement
parameters are listed in S2–S7 Tables.
Cells and reagents
Huh7 cells were obtained from the Japanese Collection of the Research Bioresources Cell Bank
and were maintained in RPMI (Life Technologies 11875–093) supplemented with 10% FBS
(Sigma F4135), 1% penicillin/streptomycin (Life Technologies 15410–112), and 4 mM Gluta-
max (Life Technologies 35050–061) at 37˚C under a 5% CO2 atmosphere. The cells were tested
for mycoplasma using the Gen-Probe Mycoplasma Tissue Culture NI (MTC-IN) Rapid Detec-
tion method. HeLa cells were obtained from the American Type Culture Collection (ATCC)
and grown in CD293 media (Life Technologies 11913–019) supplemented with 10% FBS
(Sigma F4135), 1% penicillin/streptomycin (Life Technologies 15410–112), and 4 mM Gluta-
max (Life Technologies 35050–061) at 37˚C under a 5% CO2 atmosphere. PF-06446846 was
synthesized as described above. Isotopically labelled L-lysine and L-arginine were obtained
from Cambridge Isotope laboratories.
Inhibition of PCSK9 expression in Huh7 cells
3,200 Huh7 cells were seeded in each well of a 96-well plate and allowed to attach and grow
overnight. The media was replaced with fresh media containing the indicated concentration of
PF-06446846 and 0.5% DMSO vehicle, and the cells were incubated overnight. 50 μL condi-
tioned media was recovered from each well, and PCSK9 levels were measured using the
human PCSK9 ELISA assay (Quantikine DPC900) according to manufacturer’s instructions.
Metabolic labelling
24-well cell culture plates (Bioexpress T-3026) were seeded with 18,000 Huh7 cells per well
and returned to the incubator overnight. The media was aspirated and the cells were washed
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
18 / 36

Selective inhibition of ribosome nascent chain complexes
two times with 37˚C PBS. 250 μL methionine, cysteine, and glutamine-free RPMI (Sigma
R7513) supplemented with 10% dialyzed FBS (Life Technologies 26400036) 2 mM glutamine,
4 mM Glutamax, and 1% Penstrep was added to the cells. The cells were returned to the incu-
bator for 30 min. PF-06446846, cycloheximide, or vehicle was added to the media to the indi-
cated final concentration. The final concentration of DMSO was 0.5%. 27.5 μCi 35S-
methionine-cysteine cell-labelling mix (PerkinElmer, Inc. NEG772002MC) was added to the
cells, and they were returned to the incubator for 30 min. The media was aspirated and the
cells were washed once with PBS then lysed by incubation in 50 μL RIPA lysis buffer (25 mM
Tris-HCl pH 7.6, 150 mM NaCl, 1% v/v NP-40, 1% w/v sodium deoxycholate, and 1% w/v
SDS). 10 μL Lysate was run on an SDS page gel. The gel was dried and exposed to a phosphoi-
maging screen for 1–4 d. 35S-Met/Cys incorporation was measured by quantifying the full
lanes using Image-Quant TL.
SILAC analysis
SILAC was used to facilitate proteomic analysis of the effects of PF-06446846 on the protein
population secreted from Huh7 cells. Cells were grown in 10% dialyzed fetal bovine serum in
RPMI medium initially lacking L-lysine and L-arginine but supplemented at 0.47 mM (L-argi-
nine) and 0.46 mM (L-lysine) with one of the following combinations: L-lysine and L-arginine
of standard isotopic composition (light label); L-arginine:HCl ([13C6], 99%) and L-lysine:2HCl
([2H4], 96–98%) (medium label); or L-arginine:HCl ([13C6,15N4], 99%) and L-lysine:2HCl
([13C6,15N2], 99%) (heavy label). Cells were passaged for five to six doublings with density
maintained to keep them actively growing in log phase (30%–90% confluency), after which the
incorporation efficiency for the isotopically substituted amino acids was measured as >95%.
Cells were next cultured to full confluence to synchronize them in G0/G1 phase. Analysis with
propidium bromide showed that 75% of the cells were in G0/G1 phase. The isotopically dis-
tinct populations were then replated in fresh medium supplemented with 0.5% dialyzed fetal
bovine serum containing the appropriate isotopic forms of L-lysine and L-arginine and
allowed to plate down for 2 h before being treated with a test compound or vehicle. The timed
experiment was initiated by adding 30 mL of the appropriate medium with 0.5% fetal bovine
serum to plated cells as a medium change. Light cells were treated with medium containing
vehicle, and the medium and heavy cells were treated with medium containing 0.25 μM and
1.25 μM PF-06446846, respectively. Separate samples of each differentially labeled population
were incubated for 4 or 16 h, at the end of which periods the medium was removed and treated
with protease/phosphatase inhibitors before being stored at –80˚C to await proteomic analysis.
To 28 mL of conditioned medium from each time/dose sample was added 0.28 mL of Halt
Protease and Phosphatase Inhibitor Cocktail (100X) (Thermo Fisher Scientific). For each time-
point (1 h, 4 h, and 16 h), 25 mL of medium from each SILAC condition was combined, and
the mixed samples were depleted of bovine serum albumin using anti-BSA agarose beads
(Sigma). Depletion was performed on 15 mL portions of samples with 5 mL of beads according
to the manufacturer’s instructions. Flow-through fractions for each timepoint were combined,
concentrated to 0.8 mL using 3 kDa MWCO spin columns, treated with 1/20 volume of 20%
SDS to give a final SDS concentration of 1%, and then mixed with 0.05 mL of 1 M Tris-HCl,
pH 8.5, and 0.2 mL of 4X SDS loading buffer. DTT was added to a concentration of 10 mM
and samples were heated to 70˚C for 10 min, after which they were allowed to cool to room
temperature and treated with 25 mM iodoacetamide for 30 min. A two-thirds portion of each
sample (0.7 mL) was loaded to a 1-well 4%–12% NuPAGE Novex Bis-Tris gel (Life Technolo-
gies) and run in NuPAGE MOPS SDS running buffer, and the remaining material from each
timepoint was fractionated on another gel of the same kind run in NuPAGE MES SDS running
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
19 / 36

Selective inhibition of ribosome nascent chain complexes
buffer to resolve lower-mass proteins. Following staining with Coomassie Blue and destaining,
each gel was cut into 15 and 12 horizontal slices, respectively, and each sample was subjected
to in-gel digestion with trypsin by standard methods. Digest supernatant samples were col-
lected, gel pieces were extracted with 0.5% formic acid in 50% acetonitrile, and extracts were
combined with the corresponding original digests. The samples were desalted using StageTips
[44], dried in a centrifugal concentrator, and stored at –20˚C.
Peptide mixtures were reconstituted in 0.1% formic acid, and an aliquot of each sample was
loaded onto a C18 PicoFrit column (75 μm × 10 cm) (New Objective) coupled to an LTQ Orbi-
trap Velos mass spectrometer (Thermo Fisher Scientific). Peptides were fractionated using a 2
h linear gradient of acetonitrile in 0.1% formic acid. The instrumental method consisted of a
full MS scan followed by data-dependent CID scans of the 20 most intense precursor ions,
with dynamic exclusion activated to maximize the number of ions subjected to fragmentation.
Peptide identification and relative protein quantification were carried out by searching the
mass spectra against a database in which the UniProtHuman and UniProtBovine databases
were combined with a database of common contaminant sequences (keratins, trypsin, etc.).
Searches were performed using the Mascot search engine [45] (Matrix Science) operating
under Proteome Discoverer 1.4 (Thermo Fisher Scientific). The search parameters took into
account static modification of S-carboxamidomethylation at Cys, and variable modifications
of S-oxidation on Met and stable isotopic substitution (medium and heavy forms) of Lys and
Arg. Peptide identifications were made at a 1% false discovery rate. Compound-induced
changes in the protein levels were calculated from the peak intensity ratios of unlabeled and
isotopically substituted peptides. The ratios of medium-labeled peptides to controls reported
effects of 0.25 μM PF-06446846, and the ratios of heavy-labeled peptides to their controls
reported effects of 1.25 μM compound. As an important precaution, only sequence-unique
peptides were used for these calculations in order to minimize contamination of results for
human proteins by peak signals from their bovine orthologs. Specifically, the option "Use Only
Unique Peptides" was selected under the Protein Quantification tab in the Workflow Editor of
Proteome Discoverer 1.4. In further settings, the options "Replace Missing Quan Values with
Minimum Intensity" and "Use Single-Peak Quan Channels" were not selected, and the option
to "Reject All Quan Values If Not All Quan Channels Are Present" was activated. The Maxi-
mum Allowed Fold Change was set to 15. Further constraints placed on the reporting of
SILAC ratios included requiring a minimum of 4 unique peptides per protein, a maximum
overall variability of 60% for SILAC ratios, a minimum of 10% sequence coverage, and a mini-
mum of 10 peptide spectral matches per protein. Results for keratins and trypsin were deleted
from the output. Protein hit lists (by UniProt accession) were also searched against the Uni-
Prot database to identify those designated as "Secreted," and those lacking this designation
were designated for present purposes as "Not Secreted." Results exported from Proteome Dis-
coverer were first managed collectively in Microsoft Excel, then exported for graphic viewing
using TIBCO Spotfire software.
Proteomic analysis was also performed on the cellular proteomes of the same SILAC-
labeled Huh7 cells as those used in the secretome analyses. Each cell pellet was lysed using 0.5
ml of 0.05 M Tris HCl, pH 8.0, 4% glycerol, 1% SDS, 1 mM EDTA, and Halt protease/phospha-
tase inhibitor cocktail (Thermo Fisher Scientific) at the recommended level. Cell lysates were
centrifuged at 13,000 × g at 4˚C for 10 min, and the protein concentration in each supernatant
was measured using the BCA assay (Thermo Fisher Scientific). In separate analyses of cells
treated for 4 h and 16 h, equivalent amounts of protein (200 μg) from each of the three SILAC
conditions were mixed. Each mixture was concentrated to 70 μl and fractionated by SDS-poly-
acrylamide gel electrophoresis as described. Gel lanes were cut into 12 horizontal slices and the
protein was digested in-gel by standard methods using trypsin. Digests were desalted using
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
20 / 36

Selective inhibition of ribosome nascent chain complexes
C18 StageTips, and peptide identification and ratiometric quantification was performed by liq-
uid chromatography/mass spectrometry (LC-MS/MS) as described above.
Saturation binding
Saturation binding was conducted to measure total and nonspecific binding of [3H] PF-
06446846 to purified HeLa 80S ribosomes (purified as described previously [46]). [3H] PF-
06446846 (21 Ci/mmol, 1 mCi/mL in 100% EtOH) was dried under nitrogen and resuspended
in water. Varying concentrations of the tritiated ligand were added to a Costar 3365 96-well
plate, alone (total binding), or along with a 200-fold concentration of unlabeled PF-06446846
(nonspecific binding). 0.6 μM of HeLa 80S ribosomes in assay buffer (20 mM HEPES pH 7.6,
100 mM KCl, 5 mM Mg(OAc)2, 10 mM NH4Cl) were added to the assay plate. The reaction
was incubated at room temperature on a rotating platform shaker for 30 min before the reac-
tion mixture was filtered onto a GF/B filter plate (pretreated with 0.3% polyethylenimine)
using a PerkinElmer Unifilter 96 Harvester. The plate was allowed to dry overnight before add-
ing 50 μL of Microscint and counting on a Trilux counter. Data were analyzed in GraphPad
Prism using the one site-specific binding equation. Specific binding was calculated by subtrac-
tion of the nonspecific binding from the total binding at each concentration of [3H]-PF-
06446846. The Kd and Bmax values were calculated from three independent replicates consist-
ing of 39 specific binding values and are reported along with their 95% confidence intervals.
The radioligand [3H]-PF-06446846 was prepared from the 6-bromo PF-06446846 precursor,
made by the same methods described for the synthesis of PF-06446846 but starting from
5-bromo-2-chloro-3-nitropyridine. Tritium incorporation was accomplished by tritiolysis of
the corresponding 6-bromo derivative in methanol/NaHCO3 in the presence of 10% Pd/C to
afford [3H]-PF-06446846.
Generation of mRNA for cell-free translation
For HeLa-based, cell-free translation assays, PCSK9, PCSK9 truncations and mutations, and
off-target stall sites identified by ribosome profiling were cloned as N-terminal fusions to fire-
fly luciferase in plasmid pT7CFE1 (Life Technologies). Translation was driven by an EMCV
IRES encoded in the mRNA. All mRNAs used the native translation start site except one
PCSK9 encoding mRNA used in Fig 1G and 1H, in which the mRNA encoded an additional
12 residues (MATTHMGSEFAT) encoded as part of the EMCV IRES. The complete EMCV
IRES increased the overall translation of this PCSK9 construct, allowing the stalled ribosome
trimer peak to be visualized in sucrose gradient profiles.
For rabbit reticulocyte–derived and wheat germ–derived cell-free translation assays, the
EMCV IRES was replaced by the rabbit β-globin 50-untranslated region (50 UTR). For yeast-
derived cell-free translation, the EMCV IRES was replaced by a short synthetic 50 UTR (50-
GGGAGAAATTAGAATTCAACAC-30) that included the yeast Kozak sequence (50- AACA-
CAATGGG-30; start codon underlined). The yeast Kozak sequence necessitated the mutation
of PCSK9 Gly2 to serine. For E. coli, transcription templates were made using a two-step PCR
amplification. PCSK9(1–33)-luciferase was amplified first with primers 50AGGGGAATTGTA
TAAGGAGGAAAAAACatgggatcGgaattTgataaacttaagcttgcc30 and 50AAACCCCTCCGATT
AGAGAGGGGTTATGCTAGttacacggcgatctttccgc30, then with 50GCGAATTAATACGACT
CACTATAGGGGAATTGTATAAGGAGGAAAAAACa30 and 50AAACCCCTCCGATTAG
AGAGGGGTTATGCTAGttacacggcgatctttccgc30. Luciferase was amplified with 50ACTATA
GGGCTTAAGTATAAGGAGGAAAAAATATGGAAGACGCCAAAAACATAAAGAAAG30
and 50AAACCCCTCCGATTAGAGAGGGGTTATGCTAGttacacggcgatctttccgc30 followed by
50GCGAATTAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAAT30 and
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
21 / 36

Selective inhibition of ribosome nascent chain complexes
50AAACCCCTCCGATTAGAGAGGGGTTATGCTAGttacacggcgatctttccgc30. For E. coli cell-
free translation, transcription was carried out using the PCR product.
For in vitro transcription, vectors were linearized with PmeI (NEB Cat # 0560L) then puri-
fied with Zymo DNA clean and concentrator kit. Reactions were set up with 5 mM each NTP
(Sigma) (pH adjusted to 7), 30 mM Tris-CL pH 8.1, 25 mM MgCl2, 0.01% Triton X-100, 10
mM DTT, 1U/mL pyrophosphatase (Sigma), 50 ng/μL DNA, and 0.1 mg/mL T7 RNA. Reac-
tions were incubated for 1–4 h at 37˚C. DNaseI (Promega) was added to a final concentration
of 0.1 U/μL, and the reactions were incubated an additional 15 min at 37˚C. RNA was purified
using the Zymo Research RNA clean and concentrator kit. For yeast lysate, capped mRNA was
synthesized using modified reaction conditions containing 2 mM ATP, UTP, and CTP; 0.2
mM GTP; 2 mM Ribo m7G Cap Analog (Promga P1712); 10 mM DTT; 1.2 U/μL RNAsin Plus
(Promega); 50–100 ng/μL DNA template; and 0.1 mg/mL T7 RNA polymerase. For wheat
germ translation, the mRNA was capped using the Vaccina capping kit (NEB) and tailed using
Poly-A polymerase (NEB) using the manufacturer’s recommended conditions.
HeLa-derived cell-free translation system
Translationally active HeLa lysates were prepared as described previously [47]. HeLa cell paste
was thawed and resuspended in an equal volume of hypotonic lysis buffer (20 mM HEPES pH
7.5, 10 mM potassium acetate, 1.8 mM magnesium acetate, and 1 mM DTT), and cells were
incubated on ice for 10 min then lysed in a Dounce homogenizer. One-fourteenth of the total
volume of a solution consisting of 20 mM HEPES-pH 7.5, 997.5 mM potassium acetate, 1.15
mM potassium chloride, 1.8 mM magnesium acetate, and 1 mM DTT was added to bring the
salt and buffer composition in the lysate to 20 mM HEPES-KOH pH 7.5, 76.5 mM potassium
acetate, 76.5 mM potassium chloride, 1.8 mM magnesium acetate, and 1 mM DTT. The lysate
was centrifuged twice at 1,200 x g for 5 min, and the supernatant was recovered each time.
Supernatants were aliquoted, flash-frozen in liquid nitrogen, and stored at -80˚C. Lysates were
freeze-thawed only once, as a significant loss of translational activity was observed with each
freeze–thaw cycle.
A 50 μL translation reaction was set up by combining 25 μL translationally active lysate,
4.5 μL mix 1, 5 μL mix 2, 1 μL RNasin Plus (Promega), 1 μg RNA template and 5 μL PF-
06446846 solution in 5% DMSO or 5% DMSO control. Mix 1 consisted of 17.7 mM magne-
sium acetate, 1.24 M potassium acetate, 300 mM HEPES-KOH pH 7.5, and 50 mM DTT. Mix
2 consisted of 12.6 mM ATP, 1.2 mM GTP, 200 mM creatine phosphate (Sigma), 0.6 mg/mL
creatine kinase (Sigma), 0.92 mg/mL bovine tRNA (Sigma), and 1.7X MEM essential amino
acids, 3.4X MEM nonessential amino acids, and 0.7 mM glutamine (Life Technologies). Total
reaction volumes were scaled based on the needs of downstream analyses, with 10 μL reactions
typically being used for luciferase assays and 50μL reactions for toeprinting. Reactions were
incubated at 30˚C for 45 min for full-length, PCSK9-encoding mRNAs. Other validation
mRNAs were found to be more translationally active in the HeLa cell-free systems and were
incubated for only 15 min. For luciferase assays, 5–10 μL of the translation mixture was com-
bined with 50 mL Steady-Glo luciferase substrate (Promega), and luminescence was measured
using a Veritas microplate luminometer (Turner Biosystems).
Yeast-derived cell-free translation systems
Translationally active yeast lysates were prepared as described previously [48]. The L-A virus-
cured yeast strain, YWG3 [48], was grown in YPD at 30˚C to an OD600 of 3–5, then chilled on
ice. Cells were pelleted by centrifugation at 4,000 rpm 3,300 x g in a Beckman Coulter J6-M1
centrifuge for 10 min with a JS-4.2 rotor. Cells were washed by resuspending and pelleting
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
22 / 36

Selective inhibition of ribosome nascent chain complexes
four times in an ice-cold buffer containing 30 mM HEPES-KOH pH 7.4, 100 mM potassium
acetate, 2 mM magnesium acetate, and 8.5% w/v mannitol. Pellets were stored at –80˚C until
needed. For preparation of translationally active lysates, pellets were resuspended in an equal
volume of lysis buffer (30 mM HEPES-KOH pH 7.4, 100 mM potassium acetate, 2 mM mag-
nesium acetate, 8.5% w/v mannitol, 2 mM DTT, and 0.5 mM phenylmethanesulfonyl fluoride).
The cell-buffer slurry was combined with 0.5 mm diameter glass beads in a round-bottom
tube, and yeast were lysed by manually shaking the tube in a vertical motion of 50 cm, 2 times
per second for 3 1-min sessions with 1 min of chilling on ice in between. The lysate was recov-
ered with a Pasteur pipette and centrifuged at 30,000 x g for 15 min, after which supernatants
were retained. It was found that at this stage they could be aliquoted, flash-frozen, and stored
at –80˚C with minimal loss of activity. The cleared lysates were then buffer exchanged into 30
mM HEPES-KOH pH 7.4, 100 mM potassium acetate, 2 mM magnesium acetate, and 2 mM
DTT using a 10-mL G-25 spin column (Zeba). Lysates were aliquoted, flash frozen in liquid
nitrogen, and stored at –80˚C.
For translation reactions, individual aliquots were thawed once. Calcium acetate was
added to a final concentration of 1 mM, micrococcal nuclease (Sigma) was added to a final
concentration of 10 μg/mL, and the lysates were incubated at room temperature for 10 min
to degrade endogenous mRNA. EGTA was added to a final concentration of 9.4 mM to inac-
tivate the micrococcal nuclease. For a typical translation reaction, 6.3 μL lysate was combined
with 1 μL Mix 1 (220 mM HEPES-KOH pH 7.4, 1.2 M potassium acetate, 15 mM magnesium
acetate, and 17 mM DTT), 1 μL Mix 2 (30 mM HEPES-KOH pH 7.4, 7.5 mM ATP, 1 mM
GTP, 250 mM creatine phosphate, 3.3 mg/mL creatine phosphokinase, 2X MEM essential
amino acids, 4.1X MEM nonessential amino acids, and 0.85 mM glutamate [Life Technolo-
gies]), 0.34 μL RNAsin Plus (Promega), 0.33 μL capped mRNA, 1 μL PF-06446846, or vehicle
at 10 times the final concentration and water to 10 μL. Reactions were incubated 1 h at room
temperature, and luciferase activity was measured using the Steady-Glo luciferase assays sys-
tem (Promega).
Rabbit reticulocyte lysate cell-free translation
Rabbit reticulocyte lysate cell-free translation systems were obtained from Promega and used
according to the manufacturer’s instructions. 10 μL reactions were programmed with 0.2 μg
noncapped mRNA and 50 μM PF-06446846 or vehicle. Reactions were incubated at 30˚C for
45 min and luciferase activity was measured using the Steady-Glo luciferase assay system
(Promega).
Wheat germ cell-free translation
Wheat germ cell-free translation kits were obtained from Promega and used according to the
manufacturer’s instructions, except that the mRNA was not denatured at 67˚C prior to transla-
tion reactions. 10 μL reactions were programmed with 0.5 μg capped and tailed mRNA and
reactions were incubated at room temperature for 60 min. Luciferase activity was measured
using the Steady-Glo luciferase assay system (Promega).
E. coli cell-free translation
Translationally active cell extracts were prepared from E. coli MRE-600 as described previously
[49]. 5 μL reactions were programmed with 0.34 μg mRNA and 100 μM PF-06446846 or vehi-
cle. Reactions were incubated at 30˚C for 30 min, and luciferase activity was measured using
the Steady-Glo reagent (Promega).
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
23 / 36

Selective inhibition of ribosome nascent chain complexes
Ribosomal toeprinting
For ribosomal toeprinting, a 50 μL HeLa-based, cell-free translation reaction was carried out
in the presence of PF-06446846 or vehicle according to the above protocol. Translation reac-
tions were transferred to ice and supplemented with 0.5 mM each dNTP, 50 mM Tris-Cl pH
8.3, 9.4 mM MgCl2, 10 mM DTT, 0.8 U/μL RNasin Plus (Promega), and 0.1 mg/mL cyclohexi-
mide. The mix was incubated at 55˚C for 2 min. This step was found to be necessary and had
previously been determined to be necessary for the successful detection of ribosomal toeprints
from Saccharomyces cerevisiae and Neurospora crassa extracts [50]. The reactions were cooled
to room temperature, and 50-FAM-labelled primers (IDT) were added to a final concentration
of 2 μM and AMV reverse transcriptase (Promega) was added to a final concentration of 0.5
U/μL. The primer used for full-length PCSK9 constructs was 50-ATCTTGGTGAGGTAT
CCCCG-30. For truncated constructs, a primer annealing to the luciferase gene with the
sequence 50-GATATGTGCATCTGTAAAAG-30 was used. The total volume of each reverse
transcription reaction was 100 μL. The reactions were incubated at 37˚C for 45 min, then 70˚C
for 5 min. 20 μL 0.5 M EDTA and 20 μL 1 M NaOH were added and the reactions were incu-
bated at 65˚C for a further 15 min. 200 μL nuclease-free water was added to the reactions, and
bulk proteins were removed using two extractions with basic phenol–chloroform. Reverse
transcription products were purified and concentrated from the aqueous phase using the DNA
clean and concentrator-5 Kit (Zymo Research). HiDi Formamide was added to a final concen-
tration of at least 50%, and samples were subject to capillary electrophoresis on an Applied
Biosystem 3730XL DNA Analyzer along with the Genescan 500 LIZ-labelled size standards
(Life Technologies). DNA fragment lengths were determined using the Peak Scanner 2 soft-
ware (Agilent Technologies).
To correct for small changes in fragment mobility because of the FAM tag and the specific
sequence, ddGTP sequencing lanes were generated using the parent vectors, the FAM-labelled
primers, and the Sequenase V2 DNA sequencing kit (USB) following manufacturer’s instruc-
tions, except that in the labeling reaction, 0.65 μM dATP was substituted for α-32P-dATP. The
sequencing products were cleaned using the Zymo-5 DNA clean and concentrator kit (Zymo
Research) and run alongside the toeprinting products. The observed differences between the
apparent lengths based on the commercial size standards and the ddGTP termination products
in the region of interest were between three and four nucleotides. These differences were taken
into account in the reported toeprint positions.
Sucrose density separation of stalled products
In vitro translation reactions (50 μL) were carried out with 100 μM PF-06446846 using the
Pierce human (Hela cell) in vitro translation kit and programmed with 2 μg of mRNA encod-
ing the full-length PCSK9 coding sequence plus 12 N-terminal, vector-derived residues. To
radiolabel the products, reactions were supplemented with 10 μCi of 35S-methionine (Perki-
nElmer NEG709A). Reactions were incubated at 30˚C for 45 min and then placed on ice.
40 μL of each was diluted with 60 μL of buffer (10 mM Tris-Cl pH 7.5, 100 mM potassium
chloride, 5 mM magnesium chloride, and 1 mM DTT) and loaded onto a 10%–50% (w/v)
sucrose density gradient made in the same buffer. Gradients were centrifuged at 50,000 rpm
(237,000 x g) in a Beckman Coulter SW55Ti rotor for 1.25 h at 4˚C and then fractionated on
an ISCO Inc. gradient fractionator fitted with a UA-6 absorbance cell. Absorbance traces at
254 nm were recorded, and 24 fractions of approximately 200 μL each were recovered. Adja-
cent fractions from the polysome region of the sucrose density gradient were pooled to gener-
ate four pools of two fractions. 7.2 μL of 10 mg/mL oyster glycogen was added to each followed
by 1 mL ethanol. After overnight incubation at –20˚C, samples were pelleted and resuspended
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
24 / 36

Selective inhibition of ribosome nascent chain complexes
in 10 μL of water containing 0.25 units of benzonase (Novagen) and then prepared for electro-
phoresis on a Novex 10%–20% polyacrylamide tricine SDS gel according to the manufacturer’s
instructions. A lane of Novex SeeBlue2 prestained protein markers was run on the same gel for
molecular weight estimation. The gel was subsequently rinsed in water on a shaker twice for
10 min, then dried, exposed to a phosphor screen, and imaged on a GE Typhoon scanner.
In vivo activity and safety evaluation of PF-06446848
Male Sprague-Dawley (Crl:CD [SD] rats, five per group; 6–8 wk old at initiation of dosing)
were administered PF-06446846 (Lot No. PF-06446846-01-0003, 92.2%) at 5, 15, or 50 mg/kg/
day in a vehicle of 200 mM citrate buffer in 0.5% methylcellulose (w/v) by oral gavage. A con-
trol group of five animals received 200 mM citrate buffer in 0.5% methylcellulose (w/v) by oral
gavage. The dose volume for all animals was 5 mL/kg/day based on the most recent individual
body weight. All animals were observed daily during the pretreatment period, predose, at
approximately 1 and 4 h postdose, at the end of the day, and once on the day of necropsy. All
animals were weighed pretreatment, prior to dosing on days 1, 3, 7, 10, 14, and at termination
(fasted on day 15). Individual food consumption for all animals was recorded on days 7, 10,
and 14. Other measurements and analyses from the day 15 terminal sample collection included
hematology, coagulation, clinical chemistry, and immunophenotyping. Plasma PF-06446846
and PCSK9 concentrations were measured from all animals on days 1 and 12 at approximately
1, 3, 6, and 24 h postdose. At the end of the treatment period, animals were humanely killed
and necropsied. After necropsy, gross organ examination was performed; the liver was
weighed, and a selected set of tissues was collected, processed, and examined microscopically.
Hematology and clinical chemistry measurements
Hematology endpoints including red blood cells, red cell distribution width, hemoglobin,
reticulocytes, hematocrit, platelets, mean cell volume, mean platelet volume, mean cell hemo-
globin, white blood cells, mean cell hemoglobin concentration, and white cell differential were
determined using the Siemens Advia 120/2120 Hematology platform following manufacturer’s
protocols. The clinical chemistry panel included measurements of alanine aminotransferase,
gamma glutamyltransferase, albumin, globulin, glucose, alkaline phosphatase, high-density
lipoprotein cholesterol, aspartate aminotransferase, total protein, low density lipoprotein cho-
lesterol, blood urea nitrogen, phosphorous, calcium, potassium, chloride, sodium, total choles-
terol, and creatine. The panel was performed using Siemens Advia 1800 Clinical Chemistry
Platform following manufacturer’s protocols.
Measurement of plasma PCSK9 concentration
A CircuLex Mouse/Rat PCSK9 ELISA Kit (Cat# CY-8078) was used to measure PCSK9 levels
in the plasma. Briefly, plasma samples were diluted 1:200 in sample buffer and 100 mL of sam-
ple in duplicate was added to the supplied microplate (coated with anti-PCSK9 polyclonal anti-
body). A mouse PCSK9 standard sample was serially diluted 2-fold and also added in
duplicate. The plate was incubated at room temperature for 1 h before washing with wash
buffer. A detection reagent containing anti-PCSK9 polyclonal antibody conjugated to horse-
radish peroxidase was then added to the plate and incubated for 1 h at room temperature.
After washing, a chromogenic substrate tetra-methylbenzidine (TMB) was added for 15 min
before adding a stop reagent. Absorbance was measured using a spectrophotometric micro-
plate reader at dual wavelengths of 450/540 nm, and data were converted to ng/mL using the
mouse PCSK9 standard.
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
25 / 36

Selective inhibition of ribosome nascent chain complexes
Measurement of plasma PF-06446846 concentration
A LC-MS/MS assay was used to determine PF-06446846 concentrations in rat plasma. PF-
06446846 plasma standards were prepared over the concentration range of 1 ng/mL to 2,500
ng/mL. Proteins were precipitated from 25-μL aliquots of matrix blanks, standards, and
plasma study samples by the addition of 200 μL of 4 ng/mL of terfenadine in acetonitrile as an
internal standard. Following mixing and centrifugation, the final sample extracts were pre-
pared by diluting 120 μL of supernatant with 240 μL of water. Extracts were separated chro-
matographically using a 4-min linear gradient of acetonitrile and 0.1% formic acid in water on
a Phenomenex (Torrance, CA), Kinetix C18 2.1 mm x 30 mm, 2.6 μm particle chromatography
column. Analytes were ionized by electrospray in the positive ion mode and detected using a
Sciex (Toronto) API-5500 triple quadrupole mass spectrometer in the multiple reaction moni-
toring (MRM) mode. Mass-to-charge transitions were m/z 434.2 to 167.1 for PF-06446848 and
472.0 to 436.0 for terfenadine. Calibration curves were constructed by the weighted linear
regression (1/x2) of the chromatographic peak area ratios (analyte/internal standard) versus
standard concentration. Unknown sample extracts were quantified against the standard curve
based on the analyte/internal standard peak area ratios.
Ribosome profiling
All python scripts used for processing ribosome profiling data are included in S1 Text. Huh7
cells were grown in 10-cm plates to a confluence of 50%–80%. The cells were always passaged
into fresh media within 24 h of the experiment. The media was replaced with fresh, prewarmed
media containing 1.5 μM or 0.3 μM PF-06446846 or vehicle (0.5% DMSO), and the plates
were immediately returned to the incubator. Because the effects of small molecules such as
harringtonine [19], lactimidomycin [51], and cycloheximide that act directly on the ribosome
are observable in ribosome profiling experiments with treatment times of a few minutes, we
chose treatment times of 10 and 60 min for these studies. Treatment time was measured from
the time that the fresh PF-06446846–containing media was added to the cells to the time it was
removed. The cells were harvested by aspiration of media and immediate addition of ice-cold
PBS containing 100 μg/mL cycloheximide. The PBS plus cycloheximide was aspirated with a
vacuum aspirator and 400 μL lysis buffer (20 mM Tris-Cl pH 7.4, 150 mM NaCl, 5 mM
MgCl2, 1 mM dithiothreitol, 100 μg/mL cycloheximide, 1% Triton X-100, and 25 U/mL
DNase I [Promega]) was added. Cells were lysed, ribosome footprints were generated and
purified, and deep sequencing libraries were prepared as previously described [24]. For
mRNA-seq libraries, total RNA was extracted from lysates using Trizol (Thermo Fisher Scien-
tific Cat # 15596–026), and poly-A-tailed RNA was isolated using Trizol reagent according to
manufacturer’s instructions. Poly-A mRNA was fragmented using (Thermo Fisher Scientific
Cat # 61002) according to manufacturer’s instructions. The 26–34 nt fragment range was
selected by UREA-PAGE, and libraries were prepared using the same protocol as for ribosome
footprints. Barcoded libraries were multiplexed and sequenced using an Illumina HiSeq2000
(QB3 Vincent J. Coates Genomics Sequencing Laboratory, University of California, Berkeley).
Ribosome profiling data processing
De-multiplexed reads were stripped of 30 cloning adapters using the Fast-X toolkit (http://
hannonlab.cshl.edu/fastx_toolkit/). Reads were aligned to the human ribosomal RNA
sequences using Bowtie [52] and ribosomal reads were removed. A reference transcriptome
was generated by downloading the CDS, 50 UTR, and 30 UTR regions of known protein-coding
transcripts from Ensembl’s Biomart (www.ensembl.org/biomart) and combined into single
transcript sequences using a custom python script. The database selected in Ensembl Biomart
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
26 / 36

Selective inhibition of ribosome nascent chain complexes
was “Ensembl genes 78” and the dataset selected was “Human genes (GRCh38.p7).” For analy-
ses, we experimentally determined the major splice isoform for each expressed protein-coding
gene by first aligning the pooled mRNA-seq reads to a reference transcriptome consisting of
all transcripts marked as “KNOWN” and “protein-coding” in ENSEMBL using Kallisto v
0.42.5 [53] with options “—single -l 28 -s 1”. From the Kallisto output, a list of transcripts con-
sisting of the most abundant splice isoform from each gene that had a transcripts-per-million
(TPM) value of 1 or greater was extracted.
For the ribosome profiling analyses, nonribosomal reads were aligned to a reference tran-
scriptome consisting of the most abundant splice isoform with a TPM of 1 or more for each
gene using Bowtie [52] with an alignment seed length of 23 and output options “-a,” “—best,”
and “—strata,” which instructs Bowtie to report all equal best alignments. In order to eliminate
reads mapping to repetitive, low-complexity regions while also allowing the analysis of genes
with close paralogs, we used only the best alignment for each individual read and considered
reads with alignments of the best quality to five or fewer sites in the reference transcriptome.
In parallel, using a reference transcriptome consisting of all transcripts that are at least 10% of
the isoforms from a given gene revealed no additional PF-06446846 targets.
Custom python scripts were used to generate readmaps consisting of the number of foot-
prints mapping to each nucleotide and codon of each CDS based on the inferred P-site posi-
tion. P-site positions were assigned based on a 14-nt offset of the 50 end of the alignment [18].
We found that for our data, a 14-nt offset placed the first major peak of ribosome footprint
data at nucleotide position +2 relative to the start and –5 relative to the stop. To generate the
ribosomal footprint density plots for Figs 4 and 5 and S13 Fig, the number of ribosomal foot-
prints aligning to each position was divided by the total number of reads aligning to the pro-
tein-coding regions, then multiplied by 1,000,000 to yield reads per million. All read density
plots represent average values for the biological replicates.
Metagene analysis of the global ribosome footprint distribution was carried out by calculat-
ing the normalized mean read density at each codon relative to the start and stop positions as
described previously [20]. Briefly, the number of reads mapping to a given position on a CDS
was divided by the average read density for that CDS. These values were then averaged across
all transcripts of sufficient length. For these analyses, only the annotated transcript with the
longest CDS for each gene was considered.
Z-score transformations
Z-score transformations [22, 54] were used to identify outlier values for log2-fold changes in
TE, changes in centers of density, and Dmax. In all cases, genes were grouped by expression
level into bins of 300 genes, and a standard deviation for the value of interest was calculated
for each gene. For TE changes, center-of-density changes, and Dmax values, the Z-score for a
given gene is the number of standard deviations the value is from the mean, based on mean
and standard deviation of the value for other genes in the same bin. This procedure allows val-
ues for TE, center of density, and Dmax to take into account the increased variability for genes
with lower read count values. A full description of the procedure applied to ribosome profiling
data used is described in [22].
Identification of additional PF-06446846–sensitive proteins
For each transcript with sufficient read density, we plotted the cumulative percentage of total
footprints aligning to each codon using the combined biological replicates from 1.5 μM PF-
06446846–treated cells and vehicle-treated cells to generate cumulative fractional read (CFR)
plots. CFR curves increase rapidly 50 to a stall site and level off 30 to a stall site. If a PF-
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
27 / 36

Selective inhibition of ribosome nascent chain complexes
06446846–induced stall is present, the codon at which the PF-06446846 and vehicle datasets
are maximally divergent occurs 30 to the last stall. We define the maximum divergence between
the drug and vehicle CFR plots as the Dmax and the codon at which Dmax occurs as the Dmax
position. To select a minimum value of Dmax for our analyses, we examined the distribution of
Dmax values obtained when a Dmax is calculated for each gene using two vehicle datasets and
the distribution obtained from a single 1.5 μM PF-06446846 dataset and a single vehicle dataset
(S12 Fig). Because we use Dmax only to choose a 50 boundary for differential expression analy-
sis, we chose a minimum Dmax Z-score of 2, knowing that most genes that fall above this mini-
mum will do so by chance (S12 Fig). For transcripts with a maximum Dmax Z-score of 2 or
higher, footprints mapping 30 to the maximum Dmax site were extracted for DeSeq analysis.
Reads mapping 30 to codon 50 were extracted for DeSeq analysis for all other genes. Decreases
were considered significant if they resulted in a DeSeq false discovery rate < 0.1. Precise stall
locations were determined by manually examining the read density plots. Results of the analy-
ses above are included in S13 Table.
Center-of-density analyses
Center-of-density analyses were done as previously described [22], except that the mean read
position was used instead of the median. For each transcript, the average position of all the
alignments was calculated. Changes in the average position between the PF-06446846 and the
vehicle treatments were calculated and subjected to a Z-score transformation to identify outli-
ers relative to the local expression level bin. Transcripts with a center-of-density Z-score of 3
or higher were manually examined for PF-06446846–induced stalls.
Measurement of transcript levels by RT-qPCR
9,600 Huh7 cells were seeded into each well of a 96-well plate and returned to the incubator
overnight. 1.5 μM PF-06446846 or vehicle (0.5% DMSO) was added to the cells, and the cells
were returned to the incubator for 4 or 24 h. Lysates were harvested using Ambion’s cell-to-Ct
kit (AM1729) following the manufacturer’s instructions. RT-qPCR was done using Life Tech-
nologies FastVirus kit (Cat # 4444432) on a Thermo Fisher Scientific Quantstudio 3 system.
The Taqman probes (Thermo Fisher Scientific, FAM-labelled) used were PCSK9;
HS00545399_m1, RPL27; Hs03044961_g1, HSD17B11; Hs00212226_m1, MST1;
Hs00360684_m1, PCBP1/2; Hs01590472_mH, CDH1; Hs01023894_m1, Transferrin; and
Hs01067777_m1. The reference probe was VIC-labelled and targeted PPIA Hs99999904_m1.
Data availability
The mass spectrometric proteomics data have been deposited to the ProteomeXchange Con-
sortium via the PRIDE [55] partner repository with the dataset identifiers PXD005822 (secre-
tome analyses) and PXD005835 (analyses of cell lysates). The ribosome profiling and
accompanying RNA-seq datasets have been deposited to the NCBI Gene Expression Omnibus
with accession number GSE94454. The atomic coordinates of PF-06446846 have been depos-
ited to the Cambridge Crystallographic Data Center (CCDC) with accession number 1149348.
The individual quantitative observations that underlie Figs 1B–D, 2, 4E, 5J–M, S9A–D, S10B–
F, S11, and S15A–B are in S14 Table.
Supporting information
S1 Fig. PF-06446846 specifically inhibits PCSK9 translation. (A) ELISA showing PCSK9
levels in conditioned media from Huh7 cells incubated overnight in the indicated
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
28 / 36

Selective inhibition of ribosome nascent chain complexes
concentrations of PF-06446846. Note that the concentrations of PF-06446846 increase in five-
fold increments. (B) Representative SDS-PAGE of total lysates of Huh7 cells labelled with 35
S
Met/Cys in the presence of varying concentrations of PF-06446846. Cycloheximide (CHX)
was used as a control. (C) Quantitation 35S incorporation by densitometry, error bars repre-
sent one standard deviation of three replicates. (D) Translation inhibition curves for PCSK9
(1–35)-luciferase (grey circles) and luciferase alone (black squares) in HeLa-derived cell-free
translation reactions. (E) Nucleotide and amino acid sequences of constructs shown in Fig 1C.
(TIFF)
S2 Fig. 1H NMR (CDCl3, 400 MHz) spectrum of tert-butyl (3R)-3-[(3-chloropyridin-2-yl)
amino]piperidine-1-carboxylate.
(TIFF)
S3 Fig. 13C NMR (CDCl3, 100.5 MHz) spectrum of tert-butyl (3R)-3-[(3-chloropyridin-2-yl)
amino]piperidine-1-carboxylate.
(TIFF)
S4 Fig. 1H NMR (d6-DMSO, 600 MHz) spectrum of 4-(3H-[1,2,3]triazolo[4,5-b]pyridin-
3-yl)benzoicacid.
(TIFF)
S5 Fig. 13C NMR (d6-DMSO, 100.5 MHz) spectrum of 4-(3H-[1,2,3]triazolo[4,5-b]pyridin-
3-yl)benzoicacid.
(TIFF)
S6 Fig. 1H NMR (d4-MeOH, 400 MHz) spectrum of N-(3-chloropyridin-2-yl)-N-[(3R)-piper-
idin-3-yl]-4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzamidePF-06446846.
(TIFF)
S7 Fig. 13C NMR (d4-MeOH, 100 MHz) Spectrum of N-(3-chloropyridin-2-yl)-N-[(3R)-
piperidin-3-yl]-4-(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzamide PF-06446846.
(TIFF)
S8 Fig. Single crystal X-ray analysis for N-(3-chloropyridin-2-yl)-N-[(3R)-piperidin-3-yl]-4-
(3H-[1,2,3]triazolo[4,5-b]pyridin-3-yl)benzamidePF-06446846 (CCDC 1449348) ORTEP
with ellipsoids drawn at 50% confidence level.
(TIFF)
S9 Fig. PF-06446846 effects on global protein synthesis and secretion. (A-D), Stable isotope
labelling by amino acids in cell culture (SILAC) analysis of Huh7 cellular secretome after (A,B)
4-hour and (C,D) 16-hour treatment with 0.25 μM (A,C) or 1.25 μM (B,D) PF-06446846.
(E-H), SILAC analysis of the cellular fraction from the experiments shown in panels a-d
respectively. Ribosome profiling hits that are detected in the SILAC data are highlighted in red
and labelled.
(TIFF)
S10 Fig. PF-06446846-sensitivity of PCSK9 mutations. (A) General schematic of mRNA
constructs used to program cell-free translation reactions. Sites of mutations are in red and
spacer residues are in orange. (B) Constructs, sequences and PF-06446846 sensitivity of
PCSK9 mutants. Sequences are colored as in a, with the vector encoded residues in grey for the
luciferase construct. Note that PCSK9 residues 34 are 35 are the same as luciferase resides 2
and 3. All error bars represent one standard deviation of three replicates. (C-F), Inhibitory
activity of PF-06446846 in (C) Rabbit Reticulocyte Lysate (RRL) (D) Wheat Germ (E) Yeast
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
29 / 36

Selective inhibition of ribosome nascent chain complexes
and (F) E. coli cell-free translation systems. Relative luciferase activities of cell-free translation
reactions programmed with PCSK9(1–35)-luciferase in the presence of vehicle (Grey bars) or
50 μM PF’846 panels (C-E) or 100 μM PF-06446846 in (F). All error bars represent one stan-
dard deviation of three replicates. The individual quantitative observations that underlie
Fig. S10B-F are in supplementary data S14 Table.
(TIFF)
S11 Fig. Liver transaminase and albumin levels. (A) Alanine transaminase (ALT), (B) Aspar-
tate aminotransferase (AST), and (C) Albumin levels in rats measured 24-hours following 14
daily oral doses of PF-06446846. Bars represent group mean + standard deviation. Symbols
represent individual animal values. The middle horizontal bar represents the group mean +/-
standard deviation. Difference between group means relative to vehicle was performed by a
1-way ANOVA followed by a Dunnett’s multiple comparisons test; Ã p< = 0.05. The individual
quantitative observations that underlie Fig. S11 are in supplementary data S14 Table.
(TIFF)
S12 Fig. Distribution of reads relative to start and stop codons. (A) 10 minute datasets (top
panel, replicate 1, middle panel; replicate 2, bottom panel replicate 3, left 1.5 μM PF-06446846
treatment, right vehicle treatment). (B) 1 hour treatment, panels arranged as in (A). (C) Ribo-
seq datasets from second experiment. (top panel; replicate 1, bottom panel; replicate 2, Left
panels; 1.5 μM PF-06446846 treatment, Right panels; vehicle treatment. (D) mRNA-Seq data-
sets from second treatments. Panels are arranged as in (C).
(TIFF)
S13 Fig. Reproducibility of read count data; Scatterplots comparing raw read counts
between replicates for (A) 10-minute treatment times (B) 1-hour treatment times and (C)
the second ribosome profiling experiment.
(TIFF)
S14 Fig. PF-06446846-sensitive nascent chains. (A-O), (With Fig 5F–5I) Readplots for PF-
06446846-sensitive proteins identified using the “Dmax” approach. (P-S), Additional genes dis-
playing a change in the center of density. (P), VPS25, (Q), TM2D3, and (R), MAPRE1. (S) The
Cox10 stall occurs near the stop codon. (T) PF-06446846-sensitive sequences identified in the
Dmax analysis, the center of density analysis, or both. RPM stands for “Reads per million.”.
(TIFF)
S15 Fig. PF-06446846-induced expression changes are translational. Reverse-transcriptase
qPCR measurement of PF-06446846 target transcript levels in Huh7 cells after (A) 4-hour and
(B) 24-hour treatment with 1.5 μM PF-06446846. (C) mRNA-seq vs ribo-seq read counts. PF-
06446846-sensitive transcripts are highlighted in red and do not show any bias for TE levels.
The green cluster indicates histone-coding transcripts which lack poly-A tails and are thus
underrepresented in the mRNA-seq libraries. RPM stands for “Reads per million.” The indi-
vidual quantitative observations that underlie Fig. S15A-B are in supplementary data S14
Table.
(TIFF)
S1 Table. Properties of PF-06446846.
(DOCX)
S2 Table. Crystal data and structure refinement for PF-06446846 (CCDC 1449348).
(DOCX)
PLOS Biology | https://doi.org/10.1371/journal.pbio.2001882 March 21, 2017
30 / 36