Welcome to LookChem.com Sign In|Join Free
  • or
2'-DEOXYCYTIDYLYL(3'5')-THYMIDINEAMMONIU M is a chemical with a specific purpose. Lookchem provides you with multiple data and supplier information of this chemical.

77710-60-2

Post Buying Request

77710-60-2 Suppliers

Recommended suppliers

  • Product
  • FOB Price
  • Min.Order
  • Supply Ability
  • Supplier
  • Contact Supplier

77710-60-2 Usage

Check Digit Verification of cas no

The CAS Registry Mumber 77710-60-2 includes 8 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 5 digits, 7,7,7,1 and 0 respectively; the second part has 2 digits, 6 and 0 respectively.
Calculate Digit Verification of CAS Registry Number 77710-60:
(7*7)+(6*7)+(5*7)+(4*1)+(3*0)+(2*6)+(1*0)=142
142 % 10 = 2
So 77710-60-2 is a valid CAS Registry Number.

77710-60-2SDS

SAFETY DATA SHEETS

According to Globally Harmonized System of Classification and Labelling of Chemicals (GHS) - Sixth revised edition

Version: 1.0

Creation Date: Aug 11, 2017

Revision Date: Aug 11, 2017

1.Identification

1.1 GHS Product identifier

Product name [5-(4-amino-2-oxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] [3-hydroxy-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl hydrogen phosphate,azane

1.2 Other means of identification

Product number -
Other names 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE

1.3 Recommended use of the chemical and restrictions on use

Identified uses For industry use only.
Uses advised against no data available

1.4 Supplier's details

1.5 Emergency phone number

Emergency phone number -
Service hours Monday to Friday, 9am-5pm (Standard time zone: UTC/GMT +8 hours).

More Details:77710-60-2 SDS

77710-60-2Downstream Products

77710-60-2Relevant academic research and scientific papers

Solid-phase synthesis of backbone-modified DNA analogs by the boranophosphotriester method using new protecting groups for nucleobases

Kawanaka, Toshihide,Shimizu, Mamoru,Shintani, Noriko,Wada, Takeshi

scheme or table, p. 3783 - 3786 (2009/04/06)

Backbone-modified DNA analogs were synthesized in good yields by the boranophosphotriester method on a solid support. The oligodeoxyribonucleoside boranophosphates, protected with 2-(azidomethyl)benzoyl groups for nucleobases, were converted into DNA and its backbone-modified analogs via the corresponding H-phosphonate intermediates. A new protecting group for the O6 position of 2′-deoxyguanosine, 4-azidobenzyl (ABn) group, was also developed. The ABn group can be quickly removed by treatment with MePPh2 and H2O in the presence of 2-mercaptoethanol.

Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

Hayakawa, Yoshihiro,Kataoka, Masanori

, p. 12395 - 12401 (2007/10/03)

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

The 2-(acetoxymethyl)benzoyl (AMB) group as a new base-protecting group, designed for the protection of (phosphate) modified oligonucleotides

Kuijpers,Huskens,Van Boeckel

, p. 6729 - 6732 (2007/10/02)

The 2-(acetoxymethyl)benzoyl (AMB) group is a new base-protecting group that facilitates the synthesis of labile, modified nucleotides, since it can be rapidly cleaved under mild basic conditions.

O-2,4-DICHLOROPHENYL S-METHYL PHOSPHOROCHLORIDOTHIOATE: A VERSATILE AGENT IN THE FORMATION OF THE 3'-5' INTERNUCLEOTIDIC LINKAGE BY THE PHOSPHOTRIESTER APPROACH TO OLIGONUCLEOTIDE SYNTHESIS

Caruso, Pier Bartolomeo,Sindona, Giovanni,Liguori, Angelo,Uccella, Nicola

, p. 253 - 256 (2007/10/02)

O-2,4-dichlorophenyl S-methyl phosphorochloridothioate can be used as a phosphorylating agent in the formation of (3'-5') dinucleoside phosphates and phosphorothioates.The former have beeen obtained by removal of the methylthio function from the protected

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1 Customer Service

What can I do for you?
Get Best Price

Get Best Price for 77710-60-2