76512-82-8

Usage

Chemical Properties

White solid

Upstream product

• 98533-06-3 5‘-O-(di-p-methoxytrityl)-4-N-(N-methylpyrrolidin-2-ylidene)-2’-deoxycytidine 
• 40615-36-9 4,4'-dimethoxytrityl chloride 
• 3992-42-5 2'-deoxycytidine monohydrochloride 
• 199800-56-1 2'-deoxy-5'-O-(4,4'-dimethoxytrityl)-N⁶-phthaloylcytidine 
• 951-77-9 2'-Deoxycytidine 
• 117032-49-2 4-(1,2,4-triazol-1-yl)-5'-O-(4,4'-dimethoxytriphenylmethyl)-3'-O-trimethylsilyl thymidine 
• 98533-08-5 4-N-(N-methylpyrrolidin-2-ylidene)-2’-deoxycytidine 
• 199800-43-6 2'-deoxy-N⁶-phthaloylcytidine 
• 289712-62-5 2-Azidomethyl-N-[1-((2R,4S,5R)-4-hydroxy-5-hydroxymethyl-tetrahydro-furan-2-yl)-2-oxo-1,2-dihydro-pyrimidin-4-yl]-benzamide 
• 51432-42-9 4-Amino-1-((2R,4S,5R)-4-trimethylsilanyloxy-5-trimethylsilanyloxymethyl-tetrahydro-furan-2-yl)-1H-pyrimidin-2-one 
• 138509-92-9 1-{(2R,4S,5R)-5-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-trimethylsilanyloxy-tetrahydro-furan-2-yl}-1H-pyrimidine-2,4-dione 
• 23669-79-6 DMT-dU 
• 67219-55-0 4-N-Benzoyl-2'-deoxy-5'-O-(4,4'-dimethoxytrityl)cytidine 
• 109-76-2 Trimethylenediamine 

Downstream Products

• 102064-49-3 Succinic acid mono-{(2R,3S,5R)-5-(4-amino-2-oxo-2H-pyrimidin-1-yl)-2-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-tetrahydro-furan-3-yl} ester 
• 951-77-9 2'-Deoxycytidine 
• 80594-29-2 1-{(2R,4S,5R)-5-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-tetrahydro-furan-2-yl}-4-{[bis-(4-methoxy-phenyl)-phenyl-methyl]-amino}-1H-pyrimidin-2-one 
• 140613-57-6 5'-O-(4,4'-dimethoxytrityl)-2'-deoxycytidine-3'-O-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite] 
• 600723-92-0 N⁴-bis(2-cyanoethoxy)phosphoryl-2'-deoxy-5'-O-(4,4'-dimethoxytrityl)cytidine 
• 102434-70-8 4-Amino-1-[(2R,4S,5R)-5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-(tert-butyl-dimethyl-silanyloxy)-tetrahydro-furan-2-yl]-1H-pyrimidin-2-one 
• 1234342-07-4 5'-O-DMTr-2'-deoxycytidine 3'-O-oxazaphospholidine 
• 104579-03-5 5'-O-(4,4'-dimethoxytriphenylmethyl)-2'-deoxy-N⁴-benzoyl-5-methylcytidine 
• 100663-71-6 C₄₉H₅₁ClN₅O₁₅P 
• 77710-60-2 2'-deoxycytosylyl-(3',5')-thymidine ammonium salt 
• 600723-94-2 N⁴-bis(2-cyanoethoxy)phosphoryl-2'-deoxy-5'-O-(4,4'-dimethoxytrityl)-P-(2-cyanoethyl)cytidylyl-(3'->5')-3'-O-acetylthymidine 

Relevant academic research and scientific papers

MODIFIED NUCLEOTIDES FOR SYNTHESIS OF NUCLEIC ACIDS, A KIT CONTAINING SUCH NUCLEOTIDES AND THEIR USE FOR THE PRODUCTION OF SYNTHETIC NUCLEIC ACID SEQUENCES OR GENES

A modified nucleotide, intended for the synthesis of long chain nucleic acids by enzymatic processes, comprising a “natural” nitrogenous base or a natural nitrogenous base analogue, a ribose or deoxyribose carbohydrate, and at least one phosphate group, characterized in that said nucleotide comprises at least one R group, termed the modifier group, carried by said nitrogenous base or analogue and/or by the oxygen in position 3′ of the ribose or deoxyribose molecule, making it possible to block the polymerization of said nucleotide and/or to allow the interaction of said nucleotide with another molecule, such as a protein, during the nucleic acid synthesis, R comprising at least one functional terminal group.

Monomers for oligonucleotide synthesis with linkers carrying reactive residues: I. The synthesis of deoxynucleoside derivatives with methoxyoxalamide groups in heterocyclic bases

A number of monomers for the standard phosphoamidite oligodeoxynucleotide synthesis that carry reactive methoxyoxalamide groups attached to the thymidine, 2′-deoxycytidine, and 2′-deoxyadenosine heterocyclic bases were prepared.

Antisense modulation of PPP3CB expression

Antisense compounds, compositions and methods are provided for modulating the expression of PPP3CB. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PPP3CB. Methods of using these compounds for modulation of PPP3CB expression and for treatment of diseases associated with expression of PPP3CB are provided.

Aminooxy functionalized oligomers

The present invention provides oligomers which are specifically hybridizable with a selected sequence of RNA or DNA wherein at least one of the nucleoside moieties of the oligomer is modified to include an aminooxy linkage. These oligomers are useful for

Commercial-scale synthesis of protected 2′-deoxycytidine and cytidine nucleosides

Transformation of 2′-deoxyuridine and uridine analogs to protected 2′-deoxycytidine and cytidine analogs has been investigated by two different methods. First, traditional triazolation protocol and second p-nitrophenoxylation method. Our studies conclude

2-(Azidomethyl)benzoyl as a new protecting group in nucleosides

A new protecting group, 2-(azidomethyl)benzoyl (AZMB), which can be easily removed by treatment with MePPh2 in dioxane-H2O or reduction with HCOONH4-Pd/C in dioxane-MeOH, was developed for protection of the hydroxy and amino functions of deoxyribonucleosides.

Nucleotides: Part LXI: Phthaloyl strategy: A new concept of oligonucleotide synthesis

A new alternative strategy of oligonucleotide synthesis was developed by use of the phthaloyl protecting group for the exocyclic amino functions of the nucleobases (see 9-12). This approach combines the advantages of cheap and easily accessible monomeric building blocks (see 17- 20), standard machine-aided oligonucleotide synthesis, and a fast deprotection protocol which is orthogonal to the cleavage procedure from the solid support. The crude oligonucleotides show high purity and require, in general, no further chromatographic purification.

Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

Nucleotides. Part L. Aglycone protection by the (2-dansylethoxy)carbonyl (= {2-{5-(dimethylamino)naphthalen-1-yl]sulfonyl}ethoxy}carbonyl; dnseoc) group - A new variation in oligodeoxyribonucleoside synthesis

The (2-dansylethoxy)carbonyl (= {2-{[5-(dimethylamino)naphthalen-1-yl]sulfonyl}ethoxy}carbonyl; dnseoc) group was employed for protection of the amino functions of the aglycone residues. The lactam function of 2'-deoxyguanosine was on the one hand unprotected and on the other hand alkylated at O6 of the aglycone with the 2-(4-nitrophenyl)ethyl (npe) and 2-(phenylsulfonyl)ethyl (pse) group, respectively. The syntheses of monomeric building blocks, both phosphoramidites and nucleoside-functionalized supports, are described for the three common 2'-deoxynucleosides (2'-deoxycytidine, 2'-deoxyadenosine, 2'-deoxyguanosine). As kinetic studies with the tritylated nucleosides showed, the dnseoc group is more labile towards DBU cleavage than the corresponding 2-(4-nitrophenyl)ethyl-(npe) and [2-(4-nitrophenyl)ethoxy]carbonyl(npeoc)-protected analogues. These results were confirmed by the very fast deprotection rate of the dnseoc groups at some oligonucleotides.