Design, Synthesis, and In Vitro Evaluation of a Novel Probucol Derivative: Protective Activity in Neuronal Cells Through GPx Upregulation

Article abstract of DOI:10.1007/s12035-018-0939-6

Recent studies have shown that probucol (PB), a hipocholesterolemic agent with antioxidant and anti-inflammatory properties, presents neuroprotective properties. On the other hand, adverse effects have limited PB’s clinical application. Thus, the search for PB derivatives with no or less adverse effects has been a topic of research. In this study, we present a novel organoselenium PB derivative (RC513) and investigate its potential protective activity in an in vitro experimental model of oxidative toxicity induced by tert-butyl hydroperoxide (tBuOOH) in HT22 neuronal cells, as well as exploit potential protective mechanisms. tBuOOH exposure caused a significant decrease in the cell viability, which was preceded by (i) increased reactive species generation and (ii) decreased mitochondrial maximum oxygen consumption rate. RC513 pretreatment (48?h) significantly prevented the tBuOOH-induced decrease of cell viability, RS generation, and mitochondrial dysfunction. Of note, RC513 significantly increased glutathione peroxidase (GPx) activity and mRNA expression of GPx1, a key enzyme involved in peroxide detoxification. The use of mercaptosuccinic acid, an inhibitor of GPx, significantly decreased the protective activity of RC513 against tBuOOH-induced cytotoxicity in HT22 cells, highlighting the importance of GPx upregulation in the observed protection. In summary, the results showed a significant protective activity of a novel PB derivative against tBuOOH-induced oxidative stress and mitochondrial dysfunction, which was related to the upregulation of GPx. Our results point to RC513 as a promising neuroprotective molecule, even though studies concerning potential beneficial effects and safety aspects of RC513 under in vivo conditions are well warranted.

Full text of DOI:10.1007/s12035-018-0939-6

Molecular Neurobiology
https://doi.org/10.1007/s12035-018-0939-6
Design, Synthesis, and In Vitro Evaluation of a Novel Probucol
Derivative: Protective Activity in Neuronal Cells
Through GPx Upregulation
Ruth Liliám Quispe1,2 & Rômulo Faria Santos Canto3 & Michael Lorenz Jaramillo4 & Flavio Augusto Rocha Barbosa5
Antônio Luiz Braga5 & Andreza Fabro de Bem2 & Marcelo Farina1,2
&
Received: 6 November 2017 /Accepted: 28 January 2018
#
Springer Science+Business Media, LLC, part of Springer Nature 2018
Abstract
Recent studies have shown that probucol (PB), a hipocholesterolemic agent with antioxidant and anti-inflammatory properties,
presents neuroprotective properties. On the other hand, adverse effects have limited PB’s clinical application. Thus, the search for
PB derivatives with no or less adverse effects has been a topic of research. In this study, we present a novel organoselenium PB
derivative (RC513) and investigate its potential protective activity in an in vitro experimental model of oxidative toxicity induced
by tert-butyl hydroperoxide (tBuOOH) in HT22 neuronal cells, as well as exploit potential protective mechanisms. tBuOOH
exposure caused a significant decrease in the cell viability, which was preceded by (i) increased reactive species generation and
(ii) decreased mitochondrial maximum oxygen consumption rate. RC513 pretreatment (48 h) significantly prevented the
tBuOOH-induced decrease of cell viability, RS generation, and mitochondrial dysfunction. Of note, RC513 significantly in-
creased glutathione peroxidase (GPx) activity and mRNA expression of GPx1, a key enzyme involved in peroxide detoxification.
The use of mercaptosuccinic acid, an inhibitor of GPx, significantly decreased the protective activity of RC513 against tBuOOH-
induced cytotoxicity in HT22 cells, highlighting the importance of GPx upregulation in the observed protection. In summary, the
results showed a significant protective activity of a novel PB derivative against tBuOOH-induced oxidative stress and mito-
chondrial dysfunction, which was related to the upregulation of GPx. Our results point to RC513 as a promising neuroprotective
molecule, even though studies concerning potential beneficial effects and safety aspects of RC513 under in vivo conditions are
well warranted.
.
.
.
.
Keywords Probucol derivative Glutathione peroxidase Mitochondrial dysfunction HT22 cells tBuOOH
Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s12035-018-0939-6) contains supplementary
material, which is available to authorized users.
3
* Ruth Liliám Quispe
Departamento de Farmacociências, Universidade Federal de Ciências
ruth.liliam@gmail.com
da Saúde de Porto Alegre, Porto Alegre, RS, Brazil
* Marcelo Farina
marcelo.farina@ufsc.br
4
5
Departamento de Biologia Celular, Embriologia e Genética,
Universidade Federal de Santa Catarina, Campus Universitário,
Florianópolis, SC, Brazil
1
Programa de Pós-Graduação em Neurociências, Universidade
Federal de Santa Catarina, Campus Universitário, Florianópolis, SC,
Brazil
2
Departamento de Química, Centro de Ciências Biológicas,
Universidade Federal de Santa Catarina,
Florianópolis, SC 88040-900, Brazil
Departamento de Bioquímica, Centro de Ciências Biológicas,
Universidade Federal de Santa Catarina, Campus Universitário,
Trindade, Bloco C, CEP, Florianópolis, Santa Catarina, Brazil

Mol Neurobiol
Abbreviations
synaptosomes exposed to 3-NP [14]. On the other hand, the
clinical use of PB in humans has been associated with adverse
effects, such as reduction of HDL cholesterol [15] and prolon-
gation of cardiac repolarization [16, 17]. In this scenario, new
PB derivatives have been synthesized in an attempt to provide
compounds that maintain PB’s beneficial properties with no
(or less) adverse effects [18].
PB
Probucol
GPx
SH
Glutathione peroxidase
Glutathione
GR
Glutathione reductase
NADPH β-Nicotinamide adenine dinucleotide phosphate
sodium salt reduced
DMSO
MTT
Dimethyl sulfoxide
3-(4,5-Dimethylthiazol- 2-yl)-2,5-diphenyltetra-
zolium bromide
Organoselenium compounds have been recognized for
their antioxidant properties. The glutathione peroxidase-like
activity has been well documented mainly for the diselenides
[19], which have been reported to show neuroprotective ef-
fects against hydrogen peroxide and in an experimental stroke
model [20, 21]. The beneficial effects of diselenides on the
central nervous system are greatly affected by small changes in
their chemical structure. For example, diphenyl diselenide can
enhance cognitive performance in rodents [22, 23], while its p-
methoxy analog inhibits acethylcholinesterase activity and pro-
tects against Aβ-induced neurotoxicity in a model of sporadic
Alzheimer-type dementia [24–27]. In addition to the glutathione
peroxidase-like activity of some organoselenium compounds, it
is noteworthy that additional mechanisms have been proposed
for their protective effects, such as the ability to oxidize the thiol
groups of proteins and to spare selenoproteins from inactivation
by soft-electrophiles [28]. Moreover, some organoselenium com-
pounds also display protective effects via induction of
peroxiredoxins [29] and activation of Nrf2 [30], which regulates
genes involved in the cellular antioxidant responses.
HT22, an immortalized murine hippocampal cell line [31],
possesses functional cholinergic properties [32] and has been
pointed as a useful in vitro model to identify potential neuro-
protective compounds [33–35]. The exposure of HT22 cells to
glutamate and/or pro-oxidative compounds induces a cascade
of cellular oxidative events that resemble those observed in
neurodegenerative conditions [36–38]. Of particular impor-
tance, tert-butyl hydroperoxide (tBuOOH), a membrane-
permeant organic oxidant, has been reported to cause several
of the aforementioned oxidative events in a variety of cells
[39–41], including in HT22 cells [42]. Based on previous
studies showing neuroprotective effects of PB [10–13], it
seems that the search for new PB derivatives could represent
a profitable strategy to discover novel neuroprotective com-
pounds. In the current study, we present a newly synthesized
probucol derivative, RC513 (Fig. 1), which represents an
organoselenium compound (diselenide). We took advantage
of cultured HT22 cells to investigate the potential beneficial
effects of this new compound against tBuOOH-induced tox-
icity, as well as to exploit mechanisms mediating these effects.
Our results show that RC513 significantly protected neuronal
HT22 cells against tBuOOH-induced decrease in cell viability
by preventing mitochondrial dysfunction and reactive species
generation, and this protection was related to a remarkable
increase in glutathione peroxidase (GPx) activity and in the
transcript levels of GPx1.
PI
Propidium iodide
D C F H 2 -2′,7′-Dichlorofluorescein diacetate
DA
tBuOOH tert-Butyl hydroperoxide
MS
DTNB
FCCP
Mercaptosuccinic acid
5,5′-Dithiobis(2-nitrobenzoic acid)
Carbonyl cyanide 4-(trifluoromethoxy)
phenylhydrazone
Dulbecco’s modified Eagle’s medium
Fetal bovine serum
DMEM
FBS
HBSS
NPSH
Hank’s balanced salt solution
Non-protein thiols
Introduction
Oxidative stress is defined as an imbalance between pro-
oxidants and antioxidants in favor of the former, leading to
the disruption of redox-mediated events and/or molecular
damage [1, 2]. Various experimental and clinical studies have
reported that oxidative stress and mitochondrial damage are
involved in the pathogenesis of several neurodegenerative dis-
eases, including Alzheimer’s disease, Parkinson’s disease,
amyotrophic lateral sclerosis, and Huntington’s disease
[3–5]. Accordingly, some lines of evidence have shown that
strategies that mitigate (pro)-oxidative events are useful in
preventing neurodegeneration [6–8].
Probucol (PB) is a phenolic lipid-lowering agent with an-
tioxidant and anti-inflammatory properties that has been used
in clinical treatment and the prevention of cardiovascular dis-
eases [9]. Of note, neuroprotective effects of this compound
have been recently described. For instance, results derived
from in vivo experiments showed that PB prevented cognitive
and hippocampal synaptic impairments induced by the intra-
cerebroventricular injection of aggregated amyloid β1–40 pep-
tide in a mouse model of Alzheimer’s disease [10]. Moreover,
PB protected against 3-nitropropionic (3-NP) acid-induced
pro-oxidative damage in rats in a model of Huntington’s dis-
ease [11], and protected against 6-hydroxydopamine-induced
neurotoxicity in mice in a model of Parkinson’s disease [12].
Protective effects of PB were also observed under in vitro
conditions in primary cultures of cerebellar neurons exposed
to MeHg [13] and rat brain mitochondria-enriched

Mol Neurobiol
Fig. 1 RC513 compound. a
Molecular hybridization toward
seleno-probucol derivative
RC513. b Synthesis of the target
RC513 compound in room tem-
perature (r.t.)
Materials and Methods
reported (in ppm) relative to the TMS (1H NMR) and the
solvent (13C NMR). APPI and APCI-micrOTOF-Q II mea-
surements were performed with a micrOTOF Q-II (Bruker
Daltonics) mass spectrometer equipped with an automatic sy-
ringe pump (KD Scientific) for sample injection. The mass
spectrometer was operated in the positive ion mode. The sam-
ple was injected using a constant flow (3 μL/min). The solvent
was a chloroform/methanol mixture. The APPI or APCI-
micrOTOF-Q II instrument was calibrated in the mass range
of 50–3000 m/z using an internal calibration standard (low-
concentration tuning mix solution) supplied by Agilent
Technologies. Data were processed employing Bruker
Compass Data Analysis software (version 4.0). Column chro-
matography was carried out using Merck Silica Gel (230–400
mesh). Thin-layer chromatography (TLC) was conducted
using Merck Silica Gel GF254 (0.25 mm thickness). For vi-
sualization, the TLC plates were either placed under ultravio-
let light or stained with iodine vapor or acidic vanillin. All
common reagents and solvents were used as purchased unless
otherwise noted.
Chemicals
β-Nicotinamide adenine dinucleotide phosphate sodium salt
reduced (NADPH), dimethyl sulfoxide (DMSO), glutathione
reductase (GR) from baker’s yeast, reduced glutathione,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-
mide (MTT), propidium iodide (PI), 2′,7′-dichlorofluorescein
diacetate (DCFH2-DA), tert-butyl hydroperoxide (tBuOOH),
Tri-reagent, mercaptosuccinic acid (MS), 5,5′-dithiobis(2-
nitrobenzoic acid) (DTNB), proton ionophore carbonyl cya-
nide 4-(trifluoromethoxy) phenylhydrazone (FCCP),
antimycin A, and oligomycin were purchased from Sigma-
Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle’s
medium (DMEM) and fetal bovine serum (FBS) were obtain-
ed from Gibco Life Technologies (Carlsbad, CA).
MitoSOX™ Red probe was obtained from Invitrogen
(USA). RQ1 RNase-Free DNase, GoScript™ Reverse
Transcription System, and GoTaq qPCR Master Mix were
purchased from Promega Corporation (USA). All other
chemicals were of the highest grade available commercially.
RC513 was chemically synthesized by using a procedure
followed described.
Compound RC513 was synthesized in a two-step synthetic
route from 2,6-di-tert-butylphenol.
Synthesis of 2,6-di-tert-Butyl-4-selenocyanatophenol (RC490)
Synthesis of Probucol Derivatives
In a round-bottomed flask, malononitrile (5 mmol) and SeO2
(10 mmol) were mixed in DMSO (6 mL). The mixture was
stirred for 20 min at room temperature, and then, 2,6-di-tert-
butylphenol (5 mmol) was added. After 30 min, the reaction
NMR spectra (1H NMR and 13C NMR) were recorded on a
Bruker Avance 200 spectrometer. Chemical shifts (d) are

Mol Neurobiol
mixture was diluted with AcOEt and extracted with water and
brine. The organic phase was dried over MgSO4, filtrated, and
evaporated. The crude was purified by column chromatogra-
phy using hexane as eluent.
RC513 Toxicity
Cells were seeded into 96-well plates with growth medium
(described above) at a density of 1 × 103 cells/well at 37 °C
in 5% CO2. Twenty-four hours after seeding, cells were incu-
bated with different RC513 concentrations (1–10 μM, diluted
in 0.05% DMSO) for 48 h. Cell viability assays (described
below) were performed.
1H NMR (200 MHz, CDCl3) 1.43 (s, 18H), 5.52 (s, 1H),
7.46 (s, 2H). 13C NMR (50 MHz, CDCl3) 29.99, 34.56,
102.59, 110.59, 131.60, 138.38, 155.81. HRMS (APCI-
TOF) calcd. for C15H21NOSe (M+) 311.0783, found
311.0785.
Protection of RC513 Against tBuOOH Toxicity
Synthesis of 4,4′-Diselanediylbis(2,6-di-tert-butylphenol)
(RC513)
Cells were seeded into 96-well plates with growth medium
(described above) at a density of 1 × 103 cells/well at 37 °C
in 5% CO2. Twenty-four hours after seeding, cells were incu-
bated with vehicle (DMSO, 0.05%) or different RC513 con-
centrations (1, 2, and 5 μM) for 48 h. Then, the medium was
replaced by fresh medium followed by exposure to tBuOOH
(40 μM). Parallel experiments were performed using 5 mM
mercaptosuccinic acid (MS, an inhibitor of GPx activity),
which was added to the culture medium after the treatment
with RC513 (2 μM, for 48 h) and 30 min before the addition
of tBuOOH (40, 70, and 100 μM). Twelve hours after
tBuOOH treatment, cell viability assays (described below)
were performed.
In a round-bottomed flask, 2,6-di-tert-butyl-4-
selenocyanatophenol (RC490, 0.32 mmol) was diluted in
THF (3 mL) at room temperature and then NaBH4
(0.32 mmol) was added. The mixture was stirred for 10 min
at room temperature and then 3 mL of a saturated solution of
NH4Cl was added. After 10 min of stirring, the reaction media
was diluted with AcOEt and extracted with water and brine.
The organic phase was dried over MgSO4, filtrated, and evap-
orated. Compound RC513 is sensitive to the light and must be
kept refrigerated, in the dark.
1H NMR (200 MHz, CDCl3) 1.39 (s, 18H), 5.26 (s, 1H),
7.43 (s, 2H). 13C NMR (50 MHz, CDCl3) 30.30, 34.57,
121.39, 130.21, 136.85, 154.37. HRMS (APCI, TOF) calc.
for C28H42O2Se2 570.1515 (M+), found 570.1511
Cell Viability Assays
Cell Culture
Cell viability was measured by two different assays, which
evaluate different events of the cellular homeostasis. (1) The
reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra-
zolium bromide (MTT assay), which assesses the activity of
labile mitochondrial dehydrogenases, was conducted as pre-
viously described [43]. (2) PI, which is excluded by living
cells but rapidly enters cells with damaged membranes and
binds to DNA, rendering them brightly fluorescent, was eval-
uated as previously described [44]. Results of MTT tests were
expressed as percentage of untreated cells. Results of PI up-
take assays were expressed as percentage of PI uptake (per-
centage death, where the 100% value represents control cells
treated with 2% Triton X-100 for 15 min). All experiments
were performed in technical triplicate.
The mouse hippocampal HT22 cell line was gently donated
by Dr. David Schubert (Salk Institute, La Jolla, CA, USA).
Cells were cultured in growth medium [DMEM medium sup-
plemented with 5% of heat-inactivated fetal bovine serum
(FBS), 2 mM glutamine, 100 units/mL penicillin, and
100 μg/mL streptomycin] at 37 °C in a 5% CO2 incubator.
Cells were subcultured at confluences (80–90%), used be-
tween the 3rd and 12th passages.
Treatments
tBuOOH Toxicity
HT22 cells were seeded into 96-well plates with growth me-
dium (described above) at a density of 1 × 103 cells/well at
37 °C in 5% CO2. Twenty-four hours after seeding, cells were
incubated with 0.05% DMSO (used as vehicle in further ex-
periments) and, after 48 h, cells were exposed to different
tBuOOH concentrations (10, 20, 40, 70, and 100 μM) for
12 h. In parallel experiment, cells were exposed to a single
tBuOOH concentration (40 μM) for different time points (2, 4,
6, 9, and 12 h). Cell viability assays (described below) were
performed.
Determination of Reactive Species (RS) Generation
Intracellular RS generation was measured using the (i)
DCFH2-DA probe, conducted as previously described [39],
and (ii) mitochondrial superoxide anion generation was mea-
sured using a MitoSOX probe. Briefly, HT22 cells at a density
of 1 × 103 cells/well were cultured into 96-well plates for 24 h
followed by the treatment with RC513 (2 μM) or vehicle
(DMSO, 0.05%) for 48 h.

Mol Neurobiol
(i) 1 μM DCFH2-DA was added to the culture medium, and
after 30 min incubation at 37 °C, the medium was re-
moved and changed by fresh Hank’s balanced salt solu-
tion (HBSS). Cells were exposed to tBuOOH (40, 70, or
100 μM), and the fluorescence intensity, which represents
the oxidation of DCFH2 by RS, was kinetically recorded
for 2 h (Spectramax Paradigm) with excitation at 490 nm
and emission at 520 nm. The results were expressed as
the area under the curve (AUC).
(ii) Five-micromolar MitoSOX dissolved in medium HBSS
was incubated for 15 min at 37 °C. Thereafter, the me-
dium was removed and changed by fresh HBSS. Cells
were exposed to tBuOOH (40, 70, or 100 μM) for 4 h,
and the fluorescence intensity was recorded in a fluori-
metric microplate reader (Spectramax Paradigm) with
excitation at 510 nm and emission at 580 nm. The
MitoSOX results were expressed as percentage of un-
treated cells.
different substrates, under continuous stirring at 750 rpm at
37 °C, as indicated in the representative experiment (Fig. 5).
Basal OCR, which is defined as the oxygen consumption with
the physiological substrates present in culture medium, was
measured after stabilization of the signal. Afterwards, cells
were treated with oligomycin (1.25 μM), and uncoupled
OCR (OCR independent of ATP production) was recorded,
followed by titration with the proton ionophore carbonyl cya-
nide 4-(trifluoromethoxy) phenylhydrazone (FCCP—0.5 μM/
tritation) for determination of their maximum respiratory ca-
pacity (maximum OCR). Respiration was inhibited by appli-
cation of antimycin A (2.5 μM), which inhibits selectively
complex III activity, to determine the non-mitochondrial
OCR (residual oxygen consumption—ROX). DatLab soft-
ware (Oroboros Instruments) was used for data acquisition
and analysis.
Measurement of GPx Activity
HT22 cells were seeded at a density 1 × 105 cells/well in six-
well plates for 24 h at 37 °C, followed by treatment with
RC513 (2 μM) or vehicle (DMSO, 0.05%) for an additional
48 h. Then, the culture medium was removed and cells were
washed once with phosphate-buffered saline (PBS). Cells
were dissociated with 0.05% trypsin/1 mM EDTA for 2 min,
and culture medium (DMEM with 5% FBS) was added (1:1
ratio) to inactivate trypsin. Cells were centrifuged at 500×g for
3 min at room temperature, and cell pellets were stored at −
80 °C until assays. For assay, cell pellets were resuspended in
50 μL of ice-cold buffer at pH 7.4 (20 mM TrisHCl, 0.25 M
sucrose; containing 0.4 mM β-mercaptoethanol) and were
sonicated three times by 10 min on ice (vortex of 20 s in each
time interval) followed by centrifugation at 10,000×g for
15 min at 4 °C. Supernatant was collected after centrifugation,
and GPx activity was evaluated according to Wendel [46] and
optimized for HT22 cell lysates [47]. The concentrations in
the enzyme assay medium were tert-butyl hydroperoxide
(0.32 mM), GSH (1.88 mM), GR (84 mU), EDTA (1 mM),
NaN3 (1 mM), NADPH (0.2 mM), and Tris-HCl pH 7.6
(0.1 M). Enzyme activity was expressed as nanomoles
NADPH consumed per minute per milligram of protein. In
another set of experiments, cells (at the same density) were
seeded for 24 h at 37 °C followed by treatment with RC513
(2 μM) or vehicle (DMSO, 0.05%) for 43 h; then, the medium
was removed and changed by fresh medium. Thereafter, MS
(5 mM) was added to the culture medium and incubated for
12 h, followed by the determination of GPx activity as
aforementioned.
Determination of Direct Antioxidant (Scavenger)
Activity
The method described by Brand-Williams et al. [45] was used
to evaluate the possible direct antioxidant activity of RC513.
This method is based on the spectrophotometric measurement
of the free radical 2,2-diphenyl-1-pricrilhydrazyl (DPPH) at
517 nm, which disappears upon reduction by an antioxidant
(antiradical) compound. RC513 was tested at the final concen-
tration of 25 μM, as well as the positive control (Trolox). The
solutions were incubated with a 500-μM DPPH solution for
30 min at room temperature, and spectrophotometer reading
was performed at a wavelength of 517 nm. The compounds’
capability of reducing DPPH (% antioxidant activity) was
calculated using the following equation:
À
Á
scavenging activityð%Þ ¼ A1‐A2 Â 100
A1
where A1 is the absorbance of the DPPH solution (at 517 nm)
without sample and A2 is the absorbance of the DPPH solution
(at 517 nm) with sample.
High-Resolution Respirometry
HT22 cells were seeded into a Petri dish (100 × 20 mm) at a
density of 3 × 105 cells/dish. After 24 h, cells were treated with
RC513 (2 μM) or vehicle (DMSO, 0.05%) for 48 h and then
exposed to tBuOOH (40 μM) for an additional 2 or 4 h.
Approximately one million suspended cells (in DMEM 5%
FBS) were charged in OROBOROS Oxygraph-2k chambers.
After stabilization of the signal, the basal oxygen consumption
ratio (OCR) was recorded and cells were incubated with
Determination of Non-protein Thiol (NPSH) Content
Non-protein thiol (NPSH) content was determined using
spectrophotometry-based assay as described previously by

Mol Neurobiol
Ellman [48]. HT22 cells (1 × 105 cells/well) were seeded in six-
well plates. After 24 h, cells were treated with RC513 (2 μM) or
vehicle (DMSO, 0.05%) for 48 h. Then, cells were harvested in
100 μL of PBS buffer (0.05% Triton X-100, pH 7.4) and mixed
with 1:1 trichloroacetic acid 10% solution followed by centrifu-
gation (5000×g at 4 °C for 10 min); the protein pellet was
discarded and supernatant was used in the assay. The absorbance
was read at 412 nm in a microplate reader (SpectraMax
Paradigm). The values were corrected for milligram protein
and expressed as percent of control (vehicle).
using SDS software v2.4 (Applied Biosystems). Transcript
levels of Gpx1 were normalized using Gapdh gene and calcu-
lated using the 2−ΔΔCT method [51]. The quantification of
number copy of cytosolic and mitochondrial Gpx4 of each
sample was realized using Cq values from the curves of plas-
mid (108 to 104 copies) containing the Gpx4 isoforms and
Gapdh gene [52].
Statistics Analysis
Results were expressed as means SEM. One-way or two-
way analysis of variance (ANOVA) followed by Tukey post
hoc test was used to compare significant differences among
the groups. Student’s t test was used to compare means in
experiments with only two groups. Statistical analyses were
performed using the STATISTICA software system, version
7.0. (StatSoft, Inc., 2008). All graphics were made using the
GraphPad PRISM® software version 6.00 for Windows
(GraphPad Software, San Diego, CA, USA). Significant dif-
ferences were statistically considered at the level of p < 0.05.
Quantification of Transcripts of GPx1 and GPx4
Isoforms
A two-step real-time RT-PCR protocol was performed to mea-
sure the transcripts of Gpx1 and Gpx4 genes. HT22 cells at a
density of 1 × 105 cells/well were seeded in six-well plates.
After 24 h, cells were treated with RC513 (2 μM) or vehicle
(DMSO, 0.05%) for 30 h. Total RNA extraction from HT22
cells was performed according to the TRI Reagent (Sigma-
Aldrich) protocol. DNAse treatment of RNA samples was
performed using RQ1 RNase-Free DNase (Promega) at room
temperature (25 °C) for 1 h. Then, RNA samples were precip-
itated with acetate sodium (0.3 M) and isopropyl alcohol at
room temperature for 10 min followed by centrifugation at
12,000×g for 10 min at 4 °C. The pellet was washed with
70% alcohol, centrifuged at 12,000×g for 10 min at 4 °C,
dried, and resuspended in diethylpyrocarbonate (DEPC)-treat-
ed water. PCR for β-actin gene was performed prior to the
cDNA synthesis to verify the absence of DNA contaminants
from total RNA samples. Integrity of RNA was evaluated in
1.5% electrophoresis agarose gel. RNAwas quantified using a
spectrophotometer (BIO-5000-BI/ KASUAKI). A 260/280
and 260/230 absorbance ratio > 1.8 was considered for
cDNA synthesis. The cDNA synthesis (20 μL) was carried
out using the GoScript™ Reverse Transcription System
(Promega), according to the manufacturer’s instructions, with
1 μg of total RNA, 0.5 μg of oligo(dT)15, and 2.5 mM MgCl2
for each sample. The qPCRs were carried out using GoTaq
Mix qPCR Master (Promega) and 96-well reaction plates
(Axygen) with the 7900HT Fast Real-Time PCR System
(Applied Biosystems). The qPCR primer sequences used are
shown in Table 1. Primer efficiency was calculated from serial
dilutions (1/10, 1/20, 1/40; 1/80 and 1/160) of pooled cDNA
according to the equation E = 10(1/−slope). The qPCR (10 μL)
contained 5 μL of master mix, 1 μL of diluted cDNA (1/10),
0.3 μL of each primer (10 μM), 0.1 μL of carboxy-X-
rhodamine (CXR), and 3.3 μL of DEPC-water. The qPCR
cycling conditions included 2 min at 50 °C, 10 min at
95 °C, 40 amplification cycles of 15 s at 95 °C and 1 min at
60 °C, and a melting curve analysis (15 s at 95 °C, 15 s at
60 °C, and 15 s at 95 °C). Negative controls (reaction without
sample) were run for each gene. The Cq values were analyzed
Results
Design and Synthesis of Seleno-Probucol Derivative
RC513
Compound RC513 was designed through the use of the molec-
ular hybridization strategy [53, 54], by merging the structures of
PB and the bioactive diphenyl diselenide, maintaining its poten-
tial pharmacophore groups in the final structure (Fig. 1a).
Synthesis of the target compound RC513 started with the
electrophilic aromatic substitution of 2,6-di-tert-butylphenol
(1) with triselenodicyanide (NCSeSeSeCN) prepared in situ
from SeO2 and malononitrile [55]. The selenocyanide RC490
was obtained in 76% yield after 30 min reaction at room
temperature. RC513 was obtained after deprotection of the
selenium atom using NaBH4 in THF with air oxidation to
the respective diselenide [56] in excellent yield (Fig. 1b).
Effect of RC513 on HT22 Cells Exposed to tBuOOH
tBuOOH has been used as oxidative challenge in experimental
studies due to its ability to generate free radicals [57] and
cause oxidative damage to biological systems, including in
HT22 cells [42]. Here, we observed that both tBuOOH-
induced decrease of metabolic cell viability (MTT assay,
Fig. 2a) and tBuOOH-induced increase in plasma membrane
disruption (IP uptake, Fig. 2b) presented a concentration-
dependent profile. When cells were exposed to 40 μΜ
tBuOOH during different periods, a time-dependent profile
with significant effects on metabolic cell viability (Fig. 2c)
and plasma membrane disruption (Fig. 2d) were observed

Mol Neurobiol
Table 1 Primer sequences used for RT-qPCR experiments
Gene
Forward/reverse primer
(5′–3′)
Amplicon size
(bp)
Reference
This study
Symbol Name
Gpx1
Glutathione peroxidase 1
CTCACCCGCTCTTTACCTTC
CAAAGTTCCAGGCAATGTCG
CCGCCGAGATGAGCTGG
GTCGATGTCCTTGGCTGAG
129
158
mtGpx4 Mitochondrial glutathione peroxidase 4
Casañas-Sánchez et al. [49]; this
study
Mitochondrial and cytosolic glutathione
peroxidase 4
GTCTGGCAGGCACCATGT
GTCGATGTCCTTGGCTGAG
83
This study
mcG-
px4
Gapdh Gliceraldehyde-3-phosphate dehydrogenase
CATCACTGCCACCCAGAAGA 153
CTG
Know et al. [50]
ATGCCAGTGAGCTTCCCGTT
CAG
Tr2
Thioredoxin reductase 2
GTGTCCTTAGCTCAGCAGGG 164
GGATAAGTGTGGGGCTTCA
This study
from 6 and 9 h, respectively. The treatment of cells with
RC513, at concentrations that did not significantly decrease
cell viability (Fig. 3a, b), completely protected against a
tBuOOH-induced decrease of metabolic cell viability
(Fig. 3c), as well as against a tBuOOH-induced increase of
plasma membrane disruption (Fig. 3d).
Effect of RC513 on the tBuOOH-Induced Oxidative
Stress in HT22 Cells
Because tBuOOH toxicity is classically related to oxidative
stress, we further evaluated whether RC513 protects HT22
cells from tBuOOH-induced reactive species (RS) generation
Fig. 2 Concentration and time-dependent effects of tBuOOH in cell via-
bility. HT22 cells were exposed to different tBuOOH concentrations (10–
100 μM) for 12 h (a, b) or to 40 μM from 0 to 12 h (c, d). Cell viability
was evaluated by the reduction of MTT (a, c) and cell death by IP uptake
(b, d). Results of the MTT test are expressed as the percentage of MTT
reduction with respect to control values. Results of the IP test are
expressed as percent of IP uptake, where the 100% of cell death value
represents control cells treated with 2% Triton X-100 for 15 min. Data are
represented as mean SEM (a, b; n = 4) (c, d; n = 3). One asterisk,
p < 0.05; two asterisks, p < 0.01; and three asterisks, p < 0.001 indicate
statistical difference from the control by one-way ANOVA, followed by
the Tukey post hoc test

Mol Neurobiol
Fig. 3 Effects of RC513 against tBuOOH-induced toxicity in HT22 cells.
a, b Determination of non-toxic concentrations of RC513. HT22 cells
were treated with different concentrations of RC513 (1, 3, 6, and
10 μM) for 48 h followed by cell viability assays. c, d RC513 prevents
tBuOOH-induced decrease of cell viability. Cells were treated with a non-
toxic low concentration of RC513 (1, 2, and 5 μM) for 48 h followed by
exposure to tBuOOH (40 μM) for 12 h. Cell viability was evaluated by
the reduction of MTT (a and c) and by measuring plasma membrane
disruption via PI uptake (b and d). Results of the MTT test are expressed
as the percentage of MTT reduction with respect to control values (dotted
line). Results of PI assays are expressed as percent of PI uptake, where the
100% of cell death value represent cells treated with 2% Triton X-100 for
15 min. Data are represented as mean SEM (a, b n = 3; c, d n = 6). Three
asterisks, p < 0.001, indicate statistical difference from the control (dotted
line) in MTT and the control (white bar) in PI uptake assay by one-way
ANOVA followed by the Tukey post hoc test. Cont., control
(Fig. 4a). Our results showed that the treatment with RC513
(2 μM) for 48 h totally prevented the peroxide-induced RS
generation at low tBuOOH concentration (40 μM) (Fig. 4b),
but partially prevented RS generation at high (70 and 100 μM)
tBuOOH concentrations (Fig. 4c, d). Moreover, our results
using MitoSOX showed that the treatment with RC513
(2 μM) for 48 h prevented the peroxide-induced mitochondri-
al superoxide anion generation at either 40, 70, or 100 μM
tBuOOH concentration (Fig. 4e–g).
Effect of RC513 on GPx Activity, GPx mRNA
Expression, and NPSH Levels in HT22 Cells
Considering the beneficial effects of RC513 against tBuOOH-
induced RS generation in HT22 cells (Fig. 4) and because glu-
tathione peroxide (GPx) represents a key enzyme involved in
tBuOOH detoxification [58], we investigated the effects of
RC513 treatment on GPx activity, as well as on the expression
of Gpx1 and Gpx4 genes and NSPH levels. RC513 significantly
increased the GPx activity (p < 0.0001, tenfold, Fig. 6a) in HT22
cells after 48 h of treatment in comparison to the control group. In
addition, RC513 treatment increased the transcript levels of Gpx1
(p < 0.001, 4.4-fold, Fig. 6c) at 30 h after treatments in compar-
ison to the control group, while transcripts of Gpx4 were not
upregulated by RC513 treatments (Fig. 6d, e). No significant
changes were observed in the levels of NPSH (Fig. 6b), whose
composition consists of approximately 90% glutathione [59].
Effect of RC513 on Mitochondrial Function in HT22
Cells Exposed to tBuOOH
Because mitochondrial dysfunction represents a common con-
sequence of oxidative stress, we evaluated the potential dele-
terious effects of tBuOOH (40 μM) on mitochondrial function
(cell respiration), as well as the potential beneficial effects of
RC513 (Fig. 5). We observed a significant decrease in the
maximum respiratory capacity in HT22 cells even at 2 h after
tBuOOH exposure, which was prevented by RC513 treatment
(p < 0.05, Fig. 5b). An evident mitochondrial dysfunction was
observed after a longer tBuOOH exposure (4 h). The oxidant
challenge caused a profound decrease in routine respiration
(basal OCR) and in the maximum OCR, which were effec-
tively prevented by RC513 treatment (p < 0.001, Fig. 5c).
Mercaptosuccinic Acid (MS) Decreases the Protective
Effect of RC513 on HT22 Cells
Based on the aforementioned results (especially Fig. 4 and
Fig. 6), we hypothesized that RC513-induced protection
against tBuOOH could be related, at least in part, to its stim-
ulatory effects on GPx. To test this hypothesis, we

Mol Neurobiol
Fig. 4 Protective effects of RC513 against tBuOOH-induced RS generation.
HT22 cells were treated with RC513 (2 μM) or vehicle (DMSO, 0.05%) for
48 h. (1) After incubation with 1 μM DCFH2-DA for 30 min, cells were
washed and exposed to tBuOOH (40, 70, or 100 μM) in HBSS. The fluo-
rescence intensity (excitation at 490 nm and emission at 520 nm), which
represents the oxidation of DCFH2 by RS, was kinetically monitored for
2 h. a Representative time curve of the production of RS in HT22 cells treated
with RC513 and vehicle followed by the exposure to different concentrations
of tBuOOH (40–100 μM). b–d Oxidation rate of DCFH2-DA. Area under
the curve (AUC) calculated from the kinetics shown in a. RC513 decreased
RS generation induced by tBuOOH b 40 μM, c 70 μM, and d 100 μM. Data
are represented as mean SEM (n = 4–5). (2) After incubation with 5 μM
MitoSOX for 15 min, cells were washed and exposed to tBuOOH (40, 70, or
100 μM) in HBSS. The fluorescence intensity (excitation at 510 nm and
emission at 580 nm) was recorded at 4 h. One asterisk, p < 0.05; two asterisks,
p < 0.01; three asterisks, p < 0.001; and four asterisks, p < 0.0001 indicate the
statistical differences compared to the control group (white bar), and three
number signs, p < 0.001; two number signs, p < 0.01, and one number sign, p
< 0.05, indicate the differences between tBuOOH and RC513 + tBuOOH
groups. Two-way ANOVA followed by the Tukey post hoc test was realized
investigated whether mercaptosuccinic acid (MS), an inhibitor
of GPx activity, could mitigate the protective effect induced
by RC513 in tBuOOH-exposed HT22 cells. As previously
observed, RC513 induced a significant increase of GPx activ-
ity in HT22 cells and MS significantly decreased (approxi-
mately 80%) this effect (Fig. 7a). MS treatment, which did
not affect cell viability per se, significantly decreased
RC513-induced protection (Fig. 7b, c).
Discussion
Recent studies have reported the neuroprotective properties of
probucol (PB) [10–13]. On the other hand, adverse effects
have been described after the clinical use of PB in humans
[15–17]. In this context, the search for new PB derivatives
with less (or no) adverse effects could represent an interesting
strategy to discover novel neuroprotective and safer

Mol Neurobiol
investigation of its effects against tBuOOH-induced oxidative
stress and mitochondrial dysfunction, which represent two
common events involved in the pathogenesis of the neurode-
generative diseases [60]. Our results showed that RC513 sig-
nificantly protected neuronal HT22 cells against tBuOOH-
induced oxidative stress, mitochondrial dysfunction, and de-
crease in cell viability. Of note, this protection was related to a
significant increase in GPx activity and in the transcript levels
of GPx1.
The pro-oxidant effects of tBuOOH have been extensively
reported in the literature, especially in in vitro experimental
models using cell cultures [39, 41]. In this regard, tBuOOH-
induced RS generation and mitochondrial dysfunction have
been reported to culminate in cell death [61–63].
Accordingly, our study showed that tBuOOH caused a rapid
increase of DCF-monitored RS generation, followed by mito-
chondrial superoxide anion generation, mitochondrial dys-
function, and reduction of cell viability in HT22 neuronal
lineage. In line with our results, in vitro studies also have
described pro-oxidant effects of tBuOOH in neuronal cells,
which have been responsible for the inhibition of axonal trans-
port via peroxidation, with subsequent degenerative changes
in organelles such as mitochondrial membrane, culminating in
cell death [64–66].
The newly synthesized compound RC513 showed no evi-
dent cytotoxic effects on HT22 cells at the evaluated concen-
trations (1–10 μM). Moreover, this compound (2 μM) was
able to protect HT22 cells from the effects caused by
tBuOOH, including decreased cell viability (Fig. 3c, d) and
RS overgeneration (Fig. 4). These results suggest that RC513-
treated cells were more able to detoxify tBuOOH or, alterna-
tively, tBuOOH-derived RS. Taking into account that (i) the
observed protective effects were derived from an experimental
protocol based on the pretreatment with this PB derivative and
that (ii) the direct antioxidant (scavenger) effect of RC513 is
significantly lower when compared to classic antioxidants,
such as trolox (Supplemental Fig. S1), we hypothesized that
the protection observed in this study likely involved the in-
crease of endogenous antioxidant system(s) instead of a direct
reaction between RC513 with tBuOOH (or derived RS). In
line with this idea, beneficial effects of PB and its derivative
(succinobucol) have been reported to be related to the increase
of endogenous antioxidant defense systems [67, 68].
Mitochondria represent a main source of reactive species
and, therefore, also represent a target of oxidative stress and its
deleterious consequences [60, 69]. Considering the oxidative
metabolic profile of neurons, aerobic oxidative phosphoryla-
tion (OXPHOS) is crucial for the proper obtainment of meta-
bolic energy in these cells. Thus, neurons die rapidly after
inhibition of mitochondrial respiration compared to astro-
cytes, which are more competent in using anaerobic glycolytic
pathway to obtain ATP [70]. In our study, a significant mito-
chondrial dysfunction of HT22 cells was observed at 2 h after
Fig. 5 Effects of RC513 on oxygen consumption rates (OCR) in HT22
cells. a Representative respirometry assay using HT22 cells exposed or
not with tBuOOH (40 μM) for 2 h in the culture medium. After OCR
stabilization, the following electron transport system (ETS) modulators
were added: oligomycin (1.25 μM) to measure uncoupled OCR, sequen-
tial additions (0.5 μM) of FCCP to achieve maximum OCR, and
antimycin A (2.5 μM) to determine residual OCR. b OCR records of
HT22 cells in DMEM-5% FBS treated or not with tBuOOH for 2 h.
The following conditions were assessed: basal OCR, after inhibition of
ATP synthase with oligomycin (Uncoup., uncoupled OCR), upon titra-
tion with FCCP (Max, maximum OCR), and after inhibition of respira-
tory complex III with antimycin A (Rox, residual respiration). c OCR
records of HT22 cells in DMEM-5% FBS treated or not with tBuOOH
for 4 h in similar conditions in b. Data are represented as mean SEM
(n = 3–4). One asterisk, p < 0.05; three asterisks, p < 0.001; asterisks in-
dicate the statistical differences compared to the control group (vehicle)
that was not exposed to tBuOOH (white bar). Two-way ANOVA follow-
ed by the Tukey post hoc test was realized
compounds. In the current study, the new organoselenium PB
derivative, RC513, was synthesized followed by the

Mol Neurobiol
Fig. 6 Effect of RC513 on the GPx antioxidant defense system in HT22
cells. HT22 cells were treated with 2 μM RC513 or vehicle for 48 h (a
and b) or 30 h (c, d, and e). Cellular GPx activity (a) is expressed as
nanomoles NADPH consumed per minute per milligram of protein.
NPSH levels (b) are expressed as percent of control. Transcript levels
of Gpx1 (c) were normalized with the Gapdh gene and calculated by
the 2−ΔΔCT method. Copy numbers of transcripts of cytosolic (d) and
mitochondrial (e) Gpx4 were calculated in relation to copy numbers of
Gapdh using the standard curve of plasmids containing these genes.
Values are represented as mean SEM (a n = 6; b n = 3; c–f n = 4).
One asterisk, p < 0.05; three asterisks, p < 0.001; and four asterisks,
p < 0.0001, indicate statistical difference from the control group
(Student’s t test)
exposure to 40 μM tBuOOH (Fig. 5). Of note, no significant
effects of 40 μM tBuOOH were observed toward cell viability
at this time point (2 h) (Fig. 2c, d), indicating that tBuOOH-
induced loss of mitochondrial homeostasis preceded
tBuOOH-induced decrease of cell viability. Giving support
to our results, Perron et al. [71] described cellular stress result-
ed from an early loss of mitochondrial reserve capacity in
cultured 661W cells, without affecting basal respiration at
30 min after (50 μM) tBuOOH exposure, with subsequent cell
death at 24 h. In this regard, some lines of evidence indicate
Fig. 7 Glutathione peroxidase inhibition decreases RC513-induced pro-
tection in HT22 cells exposed to tBuOOH. a HT22 cells were treated with
RC513 (2 μM) or vehicle for 43 h followed by incubation with
mercaptosuccinic acid (MS) (5 mM, GPx inhibitor) for ~ 12 h, and GPx
activity was evaluated. Results are shown as mean SEM. Three aster-
isks, p < 0.001, indicate statistical difference from the control (vehicle)
and three number signs, p < 0.001, indicate statistical difference between
RC513 and RC513 + MS groups by two-way ANOVA followed by the
Tukey post hoc test. b HT22 cells were treated with RC513 or vehicle for
48 h and exposed to tBuOOH (40, 70, and 100 μM) for 12 h, in the
presence or absence of MS (5 mM). Then, viability assays [PI uptake
(b) and MTT reduction (c)] were performed. Results of the MTT test
are expressed as the percentage of MTT reduction with respect to control
values. Results of the IP test are expressed as percent of IP uptake, where
the 100% of cell death value represents control cells treated with 2%
Triton X-100 for 15 min. Results are shown as mean SEM. Two aster-
isks, p < 0.01, and three asterisks, p < 0.001, indicate statistical difference
from the control (vehicle) not exposed to tBuOOH, and one number sign,
p < 0.05, and two number signs, p < 0.001, indicate statistical difference
between RC513 and RC513 + MS both exposed to tBuOOH. Two-way
ANOVA followed by the Tukey post hoc test was realized

Mol Neurobiol
Fig. 8 Representative scheme of
the protective effect of RC513
through GPx upregulation against
tBuOOH-induced oxidative stress
and mitochondrial dysfunction in
HT22 neuronal cells
that drugs that improve mitochondrial functions (or
chemoprevent mitochondrial dysfunction) represent a promis-
ing strategy to counteract the deleterious effects of RS [72]. In
our study, RC513 protected against tBuOOH-induced RS gen-
eration and mitochondrial dysfunction and, accordingly,
protected against tBuOOH-induced decrease of cell viability
and cell death. Moreover, RC513 prevented peroxide-induced
mitochondrial superoxide anion generation at different
tBuOOH concentrations (40, 70, and 100 μM) (Fig. 4e–g),
reinforcing the idea that RC513-induced protection involved
the maintenance of proper mitochondrial function in HT22
cells. Based on these results, it is possible to state that the
observed RC513-mediated mitoprotective effects were re-
sponsible for the maintenance of cell survival in tBuOOH-
exposed cells.
As previously mentioned, our results concerning RC513-
mediated inhibition of RS overproduction (Fig. 4) and main-
tenance of mitochondrial homeostasis (Fig. 5) in tBuOOH-
treated cells suggest that RC513-mediated cytoprotection
was related with increased RS detoxification. Taking into ac-
count that peroxides are classically detoxified by peroxidases
and that glutathione peroxidases represent a major family of
proteins involved in peroxide detoxification [73, 74], we in-
vestigated whether RC513 would be able to modulate this
antioxidant system, with a specific focus on the two major
glutathione peroxidase isoenzymes (Gpx1 and Gpx4).
RC513 significantly increased the expression levels of Gpx1,
and this result correlated with increased GPx activity in HT22
cells. Despite the statistical significance (p < 0.05) regarding
the decrease of Gpx4 expression, it is reasonable to suppose
that the observed changes in the expression of this gene (1.3-
fold change) do not represent a biologically relevant event.
This idea is based on the functional thresholds used in quan-
titative PCR analyses [75], which establishes a minimum
change in target gene expression (1.5-fold) necessary to be
considered as a biologically significant response to treatment
(regardless of statistical significance). To evaluate the impor-
tance of GPx activity in the protection induced by RC513 in
HT22 cells, we performed experiments using
mercaptosuccinic acid (MS), an inhibitor of GPx [76, 77].
The results showed that GPx activity was significantly
inhibited (approximately 80%) after MS treatment (Fig. 7a),
but MS alone did not decrease cell viability in cells not ex-
posed to tBuOOH (Fig. 7c). However, the protective effects of
RC513 against tBuOOH-induced decrease of cell viability
were significantly decreased in MS-treated cells, indicating
that the observed increase of GPx activity in RC513-treated
cells represents a key phenomenon related to the protection
elicited by this new PB derivative. Despite the observed mod-
ulation of GPx activity after RC513 treatment, it is important
to mention that pharmacological effects of some
organoselenium compounds might be explained by their abil-
ity to oxidize the thiol groups of proteins and to spare
selenoproteins from inactivation by soft-electrophiles [28].
Moreover, some organoselenium compounds also display
protective effects via induction of peroxiredoxins [29] and
activation of Nrf2 [30], which regulates genes involved in
the cellular antioxidant responses. Therefore, we do not

Mol Neurobiol
disregard the participation of mechanisms other that the up-
regulation of GPx activity in the protection of RC513 in HT22
cells, which deserve to be studied later. However, in this study,
we emphasize the importance of the enzyme GPx in this pro-
tection. Indeed, we also evaluated the expression of Tr2
(thioredoxin reductase 2) gene, which encoded a selenium-
depending mitochondrial protein, and no differences were
found in its expression at different times (3, 6, 12, and 24 h)
after the treatment of HT22 cells with RC513 in comparison to
untreated HT22 cells (Supplemental Table S1).
Even though our results indicate that increased GPx activ-
ity is a main event related to the protection elicited by RC513
in HT22 cells, molecular mechanisms mediating this increase
are not yet understood. Although PB derivatives (i.e.,
succinobucol) have been reported to increase antioxidant ac-
tivity through the activation of transcription factors, such as
Nrf2 [68], additional mechanisms could be hypothesized for
RC513. In this regard, the use of inorganic selenium (after
RC513 metabolism) for the synthesis of selenoproteins (i.e.,
GPx) cannot be ruled out. The metabolic scission of the car-
bon selenium bond in organic diselenides has been reported
[78], and simple organoselenium compounds (including
diselenides) can furnish selenium to the inorganic pool of
selenium [79]. In this scenario, it seems that the inorganic
selenide released from aromatic and aliphatic selenides can
be used in the synthesis of selenoproteins (for a review, see
Rocha et al. [80]). Thus, the stimulatory effect of RC513 (an
organic diselenide) toward GPx activity could be related, at
least in part, to the increased availability of inorganic selenium
(after RC513 metabolism), which can be used for the synthe-
sis of this selenoprotein. In this scenario, one may expect that
Gpx1 isoenzyme would be preferentially synthetized com-
pared to Gpx4 because the first presented a greater amount
of transcripts in RC513-treated HT22 cells.
(Fig. 8). The marked increase in the levels of GPx1 transcripts
observed in our study represents a significant novelty because
no similar action mechanisms have been previously reported
for this class of compounds. Our results indicate that this new
PB derivative represents a promising neuroprotective mole-
cule. However, further studies concerning potential beneficial
effects and safety aspects of RC513 under in vivo conditions
are well warranted.
Acknowledgements The financial support by (i) Fundação de Apoio à
Pesquisa do Estado de Santa Catarina (FAPESC), (ii) Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES), and (iii)
Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq) is gratefully acknowledged. MF, AFB, and ALB are CNPq fel-
lowship recipients. Part of the work was performed with the support from
LAMEB (Laboratório Multiusuário de Ciências Biológicas—UFSC),
whose technicians are gratefully acknowledged. The authors are also
thankful to CEBIME-UFSC for mass analyses.
Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no conflict of
interest.
References
1. Sies H, Jones D (2007) Oxidative stress. Encycl Stress:45–48
2. Sies H (2015) Oxidative stress: a concept in redox biology and
medicine. Redox Biol 4:180–183. https://doi.org/10.1016/j.redox.
2015.01.002
3. Bozzo F, Mirra A, Carrì MT (2017) Oxidative stress and mitochon-
drial damage in the pathogenesis of ALS: new perspectives.
Neurosci Lett 636:3–8. https://doi.org/10.1016/j.neulet.2016.04.
065
4. Ganguly G, Chakrabarti S, Chatterjee U, Saso L (2017)
Proteinopathy, oxidative stress and mitochondrial dysfunction:
cross talk in Alzheimer’s disease and Parkinson’s disease. Drug
Des Devel Ther 11:797–810. https://doi.org/10.2147/DDDT.
S130514
5. Liu Z, Zhou T, Ziegler AC et al (2017) Oxidative stress in neuro-
degenerative diseases: from molecular mechanisms to clinical ap-
plications. Oxidative Med Cell Longev 2017:1–11
6. Jin H, Kanthasamy A, Ghosh A, Anantharam V, Kalyanaraman B,
Kanthasamy AG (2014) Mitochondria-targeted antioxidants for
treatment of Parkinson’s disease: preclinical and clinical outcomes.
Biochim Biophys Acta Mol Basis Dis 1842(8):1282–1294. https://
doi.org/10.1016/j.bbadis.2013.09.007
7. Sandhir R, Yadav A, Sunkaria A, Singhal N (2015) Nano-antioxi-
dants: an emerging strategy for intervention against neurodegener-
ative conditions. Neurochem Int 89:209–226. https://doi.org/10.
1016/j.neuint.2015.08.011
Although both GPx1 and GPx4 can detoxify tBuOOH,
various authors reported that tBuOOH is a better substrate
for GPx1 enzyme in comparison to GPx4 [73, 81–83], which
can explain the necessity of considerably higher concentra-
tions of tBuOOH to kill cells expressing a high level of
GPx1 [83]. These data help to explain our results in relation
to the protection observed at high tBuOOH concentrations in
HT22 cells treated with RC513, which may be in large part
related to an increase of GPx1. Moreover, we can hypothesize
that the RC513 compound would activate GPx1-specific tran-
scription factors not related to GPx4.
In conclusion, we describe the synthesis of a novel
selenium-containing PB derivative (RC513), as well as its
protective effects in an experimental model of mitochondrial
damage induced by tBuOOH treatment in the HT22 neuronal
cell line. The results showed a significant protective effect of
RC513 against tBuOOH-induced oxidative stress and mito-
chondrial dysfunction, which was related to the upregulation
of GPx, a key protein mediating peroxide detoxification
8. Ruan Q, Ruan J, Zhang W, Qian F, Yu Z (2017) Targeting NAD+
degradation: the therapeutic potential of flavonoids for Alzheimer’s
disease and cognitive frailty. Pharmacol Res. https://doi.org/10.
1016/j.phrs.2017.08.010
9. Yamashita S, Hbujo H, Arai H et al (2008) Long-term probucol
treatment prevents secondary cardiovascular events: a cohort study
of patients with heterozygous familial hypercholesterolemia in
Japan. J Atheroscler Thromb 15(6):292–303. https://doi.org/10.
5551/jat.E610

Mol Neurobiol
10. Santos DB, Peres KC, Ribeiro RP, Colle D, Santos AA, Moreira
ELG, Souza DOG, Figueiredo CP et al (2012) Probucol, a lipid-
lowering drug, prevents cognitive and hippocampal synaptic im-
pairments induced by amyloid β peptide in mice. Exp Neurol
233(2):767–775. https://doi.org/10.1016/j.expneurol.2011.11.036
11. Colle D, Santos DB, Moreira ELG et al (2013) Probucol increases
striatal glutathione peroxidase activity and protects against 3-
nitropropionic acid-induced pro-oxidative damage in rats. PLoS
One 8:1–15
24. Pinton S, da Rocha JT, Zeni G, Nogueira CW (2010)
Organoselenium improves memory decline in mice: involvement
of acetylcholinesterase activity. Neurosci Lett 472(1):56–60.
https://doi.org/10.1016/j.neulet.2010.01.057
25. Pinton S, Trevisan J, Gai BM, Prigol M (2011) Neuroprotector
effect of p,p’-methoxyl- diphenyl diselenide in a model of sporadic
dementia of Alzheimer’s type in mice: contribution of antioxidant
mechanism. Cell Biochem Funct 29(3):235–243. https://doi.org/10.
1002/cbf.1741
26. Pinton S, Souza AC, Sari MHM, Ramalho RM, Rodrigues CMP,
Nogueira CW (2013) P,p’-Methoxyl-diphenyl diselenide protects
against amyloid-β induced cytotoxicity in vitro and improves mem-
ory deficits in vivo. Behav Brain Res 247:241–247. https://doi.org/
10.1016/j.bbr.2013.03.034
12. Ribeiro RP, Moreira ELG, Santos DB, Colle D, dos Santos AA,
Peres KC, Figueiredo CP, Farina M (2013) Probucol affords neuro-
protection in a 6-OHDA mouse model of Parkinson’s disease.
Neurochem Res 38(3):660–668. https://doi.org/10.1007/s11064-
012-0965-0
27. Pinton S, Brüning CA, Sartori Oliveira CE, Prigol M, Nogueira CW
(2013) Therapeutic effect of organoselenium dietary supplementa-
tion in a sporadic dementia of Alzheimer’s type model in rats. J Nutr
Biochem 24(1):311–317. https://doi.org/10.1016/j.jnutbio.2012.06.
012
13. Farina M, Campos F, Vendrell I, Berenguer J, Barzi M, Pons S,
Suñol C (2009) Probucol increases glutathione peroxidase-1 activ-
ity and displays long-lasting protection against methylmercury tox-
icity in cerebellar granule cells. Toxicol Sci 112(2):416–426. https://
doi.org/10.1093/toxsci/kfp219
28. Barbosa NV, Nogueira CW, Nogara PA, de Bem AF, Aschner M,
Rocha JBT (2017) Organoselenium compounds as mimics of
selenoproteins and thiol modifier agents. Metallomics 9(12):
1703–1734. https://doi.org/10.1039/C7MT00083A
29. Fiuza B, Subelzú N, Calcerrada P, Straliotto MR, Piacenza L,
Cassina A, Rocha JBT, Radi R et al (2015) Impact of SIN-1-
derived peroxynitrite flux on endothelial cell redox homeostasis
and bioenergetics: protective role of diphenyl diselenide via induc-
tion of peroxiredoxins. Free Radic Res 49(2):122–132. https://doi.
org/10.3109/10715762.2014.983096
30. de Bem AF, Fiuza B, Calcerrada P et al (2013) Protective effect of
diphenyl diselenide against peroxynitrite-mediated endothelial cell
death: a comparison with ebselen. Nitric Oxide 31:20–30
31. Davis JB, Maher P (1994) Protein kinase C activation inhibits
glutamate-induced cytotoxicity in a neuronal cell line. Brain Res
652(1):169–173. https://doi.org/10.1016/0006-8993(94)90334-4
32. Liu J, Li L, Suo WZ (2009) HT22 hippocampal neuronal cell line
possesses functional cholinergic properties. Life Sci 84(9-10):267–
271. https://doi.org/10.1016/j.lfs.2008.12.008
33. Poteet E, Winters A, Yan LJ, Shufelt K, Green KN, Simpkins JW,
Wen Y, Yang SH (2012) Neuroprotective actions of methylene blue
and its derivatives. PLoS One 7(10):e48279. https://doi.org/10.
1371/journal.pone.0048279
14. Colle D, Santos DB, Hartwig JM, Godoi M, Braga AL, Farina M
(2013) Mitochondrion succinobucol versus probucol : higher effi-
ciency of succinobucol in mitigating 3-NP-induced brain mitochon-
drial dysfunction and oxidative stress in vitro. Mitochondrion 13(2):
125–133. https://doi.org/10.1016/j.mito.2013.01.005
15. Tardif J-C, Gregoire J, L’Allier PL (2002) Prevention of restenosis
with antioxidants: mechanisms and implications. Am J Cardiovasc
Drugs 2(5):323–334. https://doi.org/10.2165/00129784-
200202050-00005
16. McDowell I, Brennan G, McEneny J et al (1994) The effect of
probucol and vitamin E treatment on the oxidation of low-density
lipoprotein and forearm vascular responses in humans. Eur J Clin
Investig 24(11):759–765. https://doi.org/10.1111/j.1365-2362.
1994.tb01073.x
17. Tardif JC, Grégoire J, Schwartz L, Title L, Laramée L, Reeves F,
Lespérance J, Bourassa MG et al (2003) Effects of AGI-1067 and
probucol after percutaneous coronary interventions. Circulation
107(4):552–558. https://doi.org/10.1161/01.CIR.0000047525.
58618.3C
18. Stocker R (2009) Molecular mechanisms underlying the
antiatherosclerotic and antidiabetic effects of probucol,
succinobucol, and other probucol analogues. Curr Opin Lipidol
20(3):227–235. https://doi.org/10.1097/MOL.0b013e32832aee68
19. Nogueira CW, Zeni G, Rocha JBT (2004) Organoselenium and
organotellurium compounds: toxicology and pharmacology.
Chem Rev 104(12):6255–6285. https://doi.org/10.1021/cr0406559
20. Posser T, Franco JL, dos Santos DA, Rigon AP, Farina M, Dafré
AL, Teixeira Rocha JB, Leal RB (2008) Diphenyl diselenide con-
fers neuroprotection against hydrogen peroxide toxicity in hippo-
campal slices. Brain Res 1199:138–147. https://doi.org/10.1016/j.
brainres.2008.01.004
21. Dobrachinski F, da Silva MH, Tassi CLC, de Carvalho NR, Dias
GRM, Golombieski RM, da Silva Loreto ÉL, da Rocha JBT et al
(2014) Neuroprotective effect of diphenyl diselenide in a experi-
mental stroke model: maintenance of redox system in mitochondria
of brain regions. Neurotox Res 26(4):317–330. https://doi.org/10.
1007/s12640-014-9463-2
22. Rosa RM, Flores DG, Appelt HR, Braga AL, Henriques JAP,
Roesler R (2003) Facilitation of long-term object recognition mem-
ory by pretraining administration of diphenyl diselenide in mice.
Neurosci Lett 341(3):217–220. https://doi.org/10.1016/S0304-
3940(03)00187-3
23. Stangherlin EC, Luchese C, Pinton S, Rocha JBT, Nogueira CW
(2008) Sub-chronical exposure to diphenyl diselenide enhances ac-
quisition and retention of spatial memory in rats. Brain Res 1201:
106–113. https://doi.org/10.1016/j.brainres.2008.01.061
34. Jirásek P, Amslinger S, Heilmann J (2014) Synthesis of natural and
non-natural curcuminoids and their neuroprotective activity against
glutamate-induced oxidative stress in HT-22 cells. J Nat Prod
77(10):2206–2217. https://doi.org/10.1021/np500396y
35. Lee DS, Cha BY, Woo JT, Kim YC, Jang JH (2015) Acerogenin A
from Acer nikoense maxim prevents oxidative stress-induced neu-
ronal cell death through Nrf2-mediated heme oxygenase-1 expres-
sion in mouse hippocampal HT22 cell line. Molecules 20(7):
12545–12557. https://doi.org/10.3390/molecules200712545
36. Tobaben S, Grohm J, Seiler A, Conrad M, Plesnila N, Culmsee C
(2011) Bid-mediated mitochondrial damage is a key mechanism in
glutamate-induced oxidative stress and AIF-dependent cell death in
immortalized HT-22 hippocampal neurons. Cell Death Differ 18(2):
282–292. https://doi.org/10.1038/cdd.2010.92
37. Kumari S, Mehta SL, Li PA (2012) Glutamate induces mitochon-
drial dynamic imbalance and autophagy activation: preventive ef-
fects of selenium. PLoS One 7(6):e39382. https://doi.org/10.1371/
journal.pone.0039382
38. Salvi A, Patki G, Khan E, Asghar M, Salim S (2016) Protective
effect of tempol on buthionine sulfoximine-induced mitochondrial
impairment in hippocampal derived HT22 cells. Oxidative Med
Cell Longev 2016:1–8. https://doi.org/10.1155/2016/5059043
39. Amoroso S, Gioielli A, Cataldi M, di Renzo G, Annunziato L
(1999) In the neuronal cell line SH-SY5Y, oxidative stress-

Mol Neurobiol
induced free radical overproduction causes cell death without any
55. Kachanov AV, Slabko OY, Baranova OV, Shilova EV, Kaminskii
VA (2004) Triselenium dicyanide from malononitrile and selenium
dioxide. One-pot synthesis of selenocyanates. Tetrahedron Lett
45(23):4461–4463. https://doi.org/10.1016/j.tetlet.2004.04.071
56. Krief A, Delmotte C, Dumont W (1997) Chemoselective reduction
of organoselenocyanates to diselenides. Tetrahedron Lett 38(17):
3079–3080. https://doi.org/10.1016/S0040-4039(97)00549-2
57. Taffess BG, Takahashin N, Kenslersii W, Masonn RP (1987)
Generation of free radicals from organic hydroperoxide tumor pro-
moters in isolated mouse keratinocytes. J Biol Chem 262:12143–
12149
58. Toppo S, Flohé L, Ursini F, Vanin S, Maiorino M (2009) Catalytic
mechanisms and specificities of glutathione peroxidases: variations
of a basic scheme. Biochim Biophys Acta Gen Subj 1790(11):
1486–1500. https://doi.org/10.1016/j.bbagen.2009.04.007
59. DeLucia AJ, Mustafa MG, Hussain MZ, Cross CE (1975) Ozone
interaction with rodent lung. III. Oxidation of reduced glutathione
and formation of mixed disulfides between protein and nonprotein
sulfhydryls. J Clin Invest 55(4):794–802. https://doi.org/10.1172/
JCI107990
participation of intracellular Ca2+ increase. Biochim Biophys Acta
Mol Cell Res 1452(2):151–160. https://doi.org/10.1016/S0167-
4889(99)00110-X
40. Bae SJ, Lee JS, Kim JM, Lee EK, Han YK, Kim HJ, Choi J, Ha YM
et al (2010) 5-Hydroxytrytophan inhibits tert-butylhydroperoxide
(t-BHP)-induced oxidative damage via the suppression of reactive
species (RS) and nuclear factor-kappaB (NF-kappaB) activation on
human fibroblast. J Agric Food Chem 58(10):6387–6394. https://
doi.org/10.1021/jf904201h
41. Kučera O, Endlicher R, Roušar T, Lotková H, Garnol T, Drahota Z,
Červinková Z (2014) The effect of tert-butyl hydroperoxide-in-
duced oxidative stress on lean and steatotic rat hepatocytes in vitro.
Oxidative Med Cell Longev 2014:1–12. https://doi.org/10.1155/
2014/752506
42. Kang T-H, Baek H-Y, Kim Y-C (2005) Protective effect of jakyak-
gamcho-tang extract and its constituents against t-BHP-induced
oxidative damage in HT22 cells. Am J Chin Med 33(02):181–
189. https://doi.org/10.1142/S0192415X05002850
43. Mosmann T (1983) Rapid colorimetric assay for cellular growth
and survival: application to proliferation and cytotoxicity assays. J
Immunol Methods 65(1-2):55–63. https://doi.org/10.1016/0022-
1759(83)90303-4
60. Lin MT, Beal MF (2006) Mitochondrial dysfunction and oxidative
stress in neurodegenerative diseases. Nature 443(7113):787–795.
https://doi.org/10.1038/nature05292
44. Riccardi C, Nicoletti I (2006) Analysis of apoptosis by propidium
iodide staining and flow cytometry. Nat Protoc 1(3):1458–1461.
https://doi.org/10.1038/nprot.2006.238
45. Brand-Williams W, Cuvelier ME, Berset C (1995) Use of a free
radical method to evaluate antioxidant activity. LWT Food Sci
Technol 28(1):25–30. https://doi.org/10.1016/S0023-6438(95)
80008-5
46. Wendel A (1981) Glutathione peroxidase. Methods Enzymol 77:
325–333. https://doi.org/10.1016/S0076-6879(81)77046-0
47. Panee J, Stoytcheva ZR, Liu W, Berry MJ (2007) Selenoprotein H
is a redox-sensing high mobility group family DNA-binding protein
that up-regulates genes involved in glutathione synthesis and phase
II detoxification. J Biol Chem 282(33):23759–23765. https://doi.
org/10.1074/jbc.M702267200
48. Ellman GL (1959) Tissue sulfhydryl groups. Arch Biochem
Biophys 82(1):70–77. https://doi.org/10.1016/0003-9861(59)
90090-6
49. Casañas-Sánchez V, Pérez JA, Fabelo N, Herrera-Herrera AV,
Fernández C, Marín R, González-Montelongo MC, Díaz M
(2014) Addition of docosahexaenoic acid, but not arachidonic acid,
activates glutathione and thioredoxin antioxidant systems in murine
hippocampal HT22 cells: potential implications in neuroprotection.
J Neurochem 131(4):470–483. https://doi.org/10.1111/jnc.12833
50. Kwon MS, Woo SK, Kurland DB, Yoon S, Palmer A, Banerjee U,
Iqbal S, Ivanova S et al (2015) Methemoglobin is an endogenous
Toll-like receptor 4 ligand-relevance to subarachnoid hemorrhage.
Int J Mol Sci 16(3):5028–5046. https://doi.org/10.3390/
ijms16035028
51. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expres-
sion data using real-time quantitative PCR and the 2−ΔΔCT method.
Methods 25(4):402–408. https://doi.org/10.1006/meth.2001.1262
52. Borchert A, Chi CW, Ufer C et al (2006) The role of phospholipid
hydroperoxide glutathione peroxidase isoforms in murine embryo-
genesis. J Biol Chem 281(28):19655–19664. https://doi.org/10.
1074/jbc.M601195200
61. Haidara K, Morel I, Abaléa V, Gascon Barré M, Denizeau F (2002)
Mechanism of tert-butylhydroperoxide induced apoptosis in rat he-
patocytes: involvement of mitochondria and endoplasmic reticu-
lum. Biochim Biophys Acta Mol Cell Res 1542(1-3):173–185.
https://doi.org/10.1016/S0167-4889(01)00178-1
62. Piret JP, Arnould T, Fuks B, Chatelain P, Remacle J, Michiels C
(2004) Mitochondria permeability transition-dependent tert-butyl
hydroperoxide-induced apoptosis in hepatoma HepG2 cells.
Biochem Pharmacol 67(4):611–620. https://doi.org/10.1016/j.bcp.
2003.09.026
63. Lv H, Liu Q, Zhou J, Tan G, Deng X, Ci X (2017) Daphnetin-
mediated Nrf2 antioxidant signaling pathways ameliorate tert-
butyl hydroperoxide (t-BHP)-induced mitochondrial dysfunction
and cell death. Free Radic Biol Med 106:38–52. https://doi.org/
10.1016/j.freeradbiomed.2017.02.016
64. Sonee M, Martens JR, Evers MR, Mukherjee SK (2003) The effect
of tertiary butylhydroperoxide and nicotinamide on human cortical
neurons. Neurotoxicology 24(3):443–448. https://doi.org/10.1016/
S0161-813X(03)00019-6
65. Isonaka R, Hiruma H, Kawakami T (2011) Inhibition of axonal
transport caused by tert-butyl hydroperoxide in cultured mouse
dorsal root ganglion neurons. J Mol Neurosci 45(2):194–201.
https://doi.org/10.1007/s12031-010-9457-3
66. Hajieva P, Bayatti N, Granold M, Behl C, Moosmann B (2015)
Membrane protein oxidation determines neuronal degeneration. J
Neurochem 133(3):352–367. https://doi.org/10.1111/jnc.12987
67. Santos DB, Colle D, Moreira ELG, Peres KC, Ribeiro RP, dos
Santos AA, de Oliveira J, Hort MA et al (2015) Probucol mitigates
streptozotocin-induced cognitive and biochemical changes in mice.
Neuroscience 284:590–600. https://doi.org/10.1016/j.
neuroscience.2014.10.019
68. Colle D, Santos DB, Hartwig JM, Godoi M, Engel DF, de Bem AF,
Braga AL, Farina M (2016) Succinobucol, a lipid-lowering drug,
protects against 3-nitropropionic acid-induced mitochondrial dys-
function and oxidative stress in SH-SY5Y cells via upregulation of
glutathione levels and glutamate cysteine ligase activity. Mol
Neurobiol 53(2):1280–1295. https://doi.org/10.1007/s12035-014-
9086-x
53. Bansal Y, Silakari O (2014) Multifunctional compounds: smart
molecules for multifactorial diseases. Eur J Med Chem 76:31–42.
https://doi.org/10.1016/j.ejmech.2014.01.060
54. Dias KST, Viegas C Jr (2014) Multi-target directed drugs: a modern
approach for design of new drugs for the treatment of Alzheimer’s
disease. Curr Neuropharmacol 12(3):239–255. https://doi.org/10.
2174/1570159X1203140511153200
69. Murphy MP (2009) How mitochondria produce reactive oxygen
species. Biochem J 417(1):1–13. https://doi.org/10.1042/
BJ20081386

Mol Neurobiol
70. Bolaños JP, Almeida A, Moncada S (2010) Glycolysis: a bioener-
getic or a survival pathway? Trends Biochem Sci 35(3):145–149.
https://doi.org/10.1016/j.tibs.2009.10.006
71. Perron NR, Beeson C, Rohrer B (2013) Early alterations in mito-
chondrial reserve capacity; a means to predict subsequent photore-
ceptor cell death. J Bioenerg Biomembr 45(1-2):101–109. https://
doi.org/10.1007/s10863-012-9477-5
72. Lyakhovich A, Graifer D (2015) Mitochondria-mediated oxidative
stress: old target for new drugs. Curr Med Chem 22(26):3040–
3053. https://doi.org/10.2174/0929867322666150729114036
73. Ursini F, Maiorino M, Brigelius-Flohé R et al (1995) Diversity of
glutathione peroxidases. Methods Enzymol 252:38–53
74. Brigelius-Flohé R, Maiorino M (2013) Glutathione peroxidases.
Biochim Biophys Acta 1830(5):3289–3303. https://doi.org/10.
1016/j.bbagen.2012.11.020
roles in protecting activated hepatic stellate cells against hydrogen
peroxide-induced cell death. Biochim Biophys Acta Mol Basis Dis
1832(12):2027–2034. https://doi.org/10.1016/j.bbadis.2013.07.008
78. Adams WJJ, Kocsis JJ, Snyder R (1989) Acute toxicity and urinary
excretion of diphenyldiselenide. Toxicol Lett 48(3):301–310.
https://doi.org/10.1016/0378-4274(89)90057-X
79. Schwarz K, Foltz C (1958) Factor 3 activity of selenium com-
pounds. J Biol Chem 233(1):245–251
80. Rocha JBT, Piccoli BC, Oliveira CS (2017) Biological and chem-
ical interest in selenium: a brief historical account. ARKIVOC:457–
491
81. Grossmann A, Wendel A (1983) Non-reactivity of the
selenoenzyme glutathione peroxidase with enzymatically
hydroperoxidized phospholipids. Eur J Biochem 135(3):549–552.
https://doi.org/10.1111/j.1432-1033.1983.tb07687.x
75. Edmunds RC, McIntyre JK, Adam Luckenbach J et al (2014)
Toward enhanced MIQE compliance: reference residual normaliza-
tion of qPCR gene expression data. J Biomol Tech 25(2):54–60.
https://doi.org/10.7171/jbt.14-2502-003
76. Chaudiere J, Wilhelmsen EC, Tappel AL (1984) Mechanism of
selenium-glutathione peroxidase and its inhibition by
mercaptocarboxylic acids and other mercaptans. J Biol Chem
259(2):1043–1050
82. Maiorino M, Gregolin C, Ursini FBT-M in E (1990) [47]
Phospholipid hydroperoxide glutathione peroxidase. In: Sies H,
Glazer A (eds) Oxygen radicals in biological systems part B: oxy-
gen radicals and antioxidants, 1st edition. Academic Press, pp 448–
457
83. Kriska T, Levchenko VV, Chu FF, Esworthy RS, Girotti AW (2008)
Novel enrichment of tumor cell transfectants expressing high levels
of type 4 glutathione peroxidase us ing 7alpha-
hydroperoxycholesterol as a selection agent. Free Radic Biol Med
45(5):700–707. https://doi.org/10.1016/j.freeradbiomed.2008.05.
022
77. Dunning S, ur Rehman A, Tiebosch MH, Hannivoort RA, Haijer
FW, Woudenberg J, van den Heuvel FAJ, Buist-Homan M et al
(2013) Glutathione and antioxidant enzymes serve complementary