Synthesis of puromycin derivatives with backbone-elongated substrates and associated translation inhibitory activities

Article abstract of DOI:10.1016/j.bmc.2009.02.006

We have synthesized a series of 5′-phosphorylated and 5′-cytidylyl-(3′-5′)-cytidylyl-(3′-5′)-puromycin derivatives that have backbone-elongated substrates. All the synthesized puromycin derivatives showed good solubility in water and were applied to trans

Full text of DOI:10.1016/j.bmc.2009.02.006

Bioorganic & Medicinal Chemistry 17 (2009) 2381–2387
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Synthesis of puromycin derivatives with backbone-elongated substrates
and associated translation inhibitory activities
*
*
Keigo Mizusawa, Kenji Abe, Shinsuke Sando , Yasuhiro Aoyama
Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Nishikyo-ku, Kyoto 615-8510, Japan
a r t i c l e i n f o
a b s t r a c t
We have synthesized a series of 50-phosphorylated and 50-cytidylyl-(30–50)-cytidylyl-(30–50)-puromycin
derivatives that have backbone-elongated substrates. All the synthesized puromycin derivatives showed
good solubility in water and were applied to translation inhibitory assay in a reconstituted Escherichia coli
translation system.
Article history:
Received 16 January 2009
Revised 5 February 2009
Accepted 6 February 2009
Available online 13 February 2009
Ó 2009 Elsevier Ltd. All rights reserved.
Keywords:
Cell free translation
Inhibitor
Puromycin
Ribosome
1. Introduction
elongated substrates usable for ribosomal synthesis is still very
limited.10 The next challenge is to find factors affecting the incor-
The ribosomeisa highlysophisticatedRNAmachine thatpolymer-
izes amino acids to produce size, shape, and sequence-defined poly-
mers, that is, proteins. Although the ribosomal translation system
poration efficiency of backbone-elongated substrates in order to
extend the diversity of the ribosomally decodable products.
Puromycin (Pmn)-based assay is a method used for investigat-
ing the substrate adaptability at the A-site of the ribosome.11–14
Pmn is a simplified mimic of the 30-end A76 of aminoacyl-tRNA
(Fig. 1), which enters the A-site of the ribosome and inhibits trans-
lation by attacking the carbonyl group of the nascent peptidyl
chain on the P-site. Since the Pmn derivatives enter the A-site of
the ribosome by their own ability without any assistance from
EF-Tu or the tRNA body, the translation inhibitory activity can be
used as an indicator of substrate adaptability at the A-site of the
ribosome, supporting our understanding of the permissible modi-
fication of substrates. Therefore, Pmn derivatives with backbone-
elongated substrates could be useful indicators for investigating
the A-site adaptability of substrates. In this report, we show the
synthesis of a series of Pmn derivatives with backbone-elongated
substrates and the associated translation inhibitory activities in
the E. coli system.
has evolved for the polymerization of natural a-amino acids, recent
efforts have revealed that the translation machinery can use nonnat-
ural substrates beyond the 20 canonical ones. Because of these find-
ings, there has currently been a great deal of interest in using the
ribosomal translation system for the synthesis of sequence-pro-
grammed peptidomimetics1–7 or nonnatural biopolymers.8
The most intriguing part of this context is the substrate accept-
ability of the ribosome. Extensive work has revealed a remarkable
tolerance of the translation machinery for side-chain modifications
of its substrates (amino acids).9 In contrast, this translation system
has strict limitations on substrates with elongated backbones, as
demonstrated by the fact that homologous b-amino acid is a less
efficient substrate compared to its natural
a
-counterparts.1b,4a
Very recently, we found an unexpected loophole in the Escherichia
coli (E. coli) translation system for the incorporation of backbone-
elongated substrates.6b Interestingly, b-hydroxypropionic acid
(b-HPA in Fig. 1) could be incorporated into proteins or oligopep-
tides with higher efficiency than b-alanine (b-ala in Fig. 1) under
our experimental conditions. It is remarkable and even surprising
that less-nucleophilic b-HPA is a better substrate than b-ala for
the E. coli translation system. However, the number of backbone-
2. Results and discussion
2.1. Synthesis of phosphorylated Pmn derivatives
Various Pmn derivatives have so far been synthesized by cou-
pling puromycin aminonucleoside (PANS 1 in Scheme 1) with a
substrate. However, such simple Pmn derivatives sometimes suffer
from the problem of low solubility, especially when the substrate
possesses a large hydrophobic side chain or hydroxyl group as a
* Corresponding authors. Tel.: +81 75 383 2766; fax: +81 75 383 2767 (S.S).
E-mail addresses: ssando@sbchem.kyoto-u.ac.jp (S. Sando), aoyamay@sbchem.
kyoto-u.ac.jp (Y. Aoyama).
0968-0896/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2009.02.006

2382
K. Mizusawa et al. / Bioorg. Med. Chem. 17 (2009) 2381–2387
Figure 1. Chemical structures of backbone-elongated substrates and puromycin.
Scheme 1. Reagents and conditions: (a) FmocOSu, dry DMF, rt, 2 h, 94%; (b) DMTrCl, DMAP, dry pyridine, rt, overnight, quant; (c) Ac2O, dry pyridine, rt, overnight, 61%; (d) 3%
TCA in CH2Cl2, rt, 30 min, 27%; (e) (i) bis(2-cyanoethyl)-N,N-diisopropylphosphoramidite, 1H-tetrazole, dry CH2Cl2, rt, 4 h; (ii) 0.02 M I2 in THF/pyridine/H2O, rt, 20 min; (f)
25% ammonium hydroxide/CH3OH = 15:2, 55 °C, overnight, 5% in three steps; (g) AcOSu in aqueous NaHCO3/CH3CN, rt, 1 h, 55%; (h) (i) O-TBDMS-
a-(R)-Me-b-HPA-OSu in
aqueous NaHCO3/CH3CN, 42 °C, 2 h; (ii) 50% aqueous TFA, on ice, 30 min, 5% in two steps; (i) (i) N-Boc-
a-(R)-Me-b-ala-OSu in aqueous NaHCO3/CH3CN, rt, 1 h; (ii) 50%
aqueous TFA, on ice, 30 min, 48% in two steps.
nucleophile. This was the case for our substrates. Synthesized Pmn
derivative Pmn(b-HPA), wherein the -amino acid of puromycin
was replaced by b-HPA, was highly insoluble in water. In order
to overcome this problem of solubility, we used 50-phosphorylated
Pmn (pPmn) as a new scaffold.
pPmn derivatives with backbone-elongated substrates were
synthesized according to Scheme 1. 50-Phosphorylated PANS 7
(pPANS) was prepared from commercially available PANS in six
steps. The 30-amino group of PANS 1 was selectively protected with
a Fmoc group to yield 30-Fmoc protected 2. Compound 2 was then
converted by the selective coupling of 50- and 20-hydroxyl groups
with p,p0-dimethoxytrityl chloride (DMTrCl) and anhydrous acetic
acid (Ac2O), respectively, to give 50-O-DMTr-30-N-Fmoc-20-O-Ac-
protected PANS 4 (57% in three steps). Then, the DMTr group was
removed selectively using 3% trichloroacetic acid (TCA) in dichloro-
methane in a 27% yield. The free 50-hydroxyl group was again re-
acted with bis(2-cyanoethyl)-N,N-diisopropylphosphoramidite in
the presence of 1H-tetrazole, and the product was then oxidized
using I2 in THF/pyridine/H2O to give 6. Compound 6 was fully
deprotected and purified via HPLC to yield pPANS 7 (5% yield in
three steps, MALDI-TOF [(M+H)+]: calcd 375.30, found 374.97).
The derivatization of the 30-amino group of pPANS 7 was
achieved by coupling with a substrate activated as succinimidyl es-
ter. Acetic acid succinimidyl ester (AcOSu) readily reacted with
pPANS 7 to give pPmn derivative 8 in a 55% yield after HPLC puri-
fication (MALDI-TOF [(M+H)+]: calcd 417.33, found 416.88). With a
facile derivatization method in hand, we then prepared pPmn
a
derivatives that have
a-(R)-Me-b-HPA and
a-(R)-Me-b-ala as acyl-
ated substrates (Fig. 1). The methyl substituent at the
a-(R) posi-
tion on the elongated backbone was revealed to be preferable for
E. coli translation machinery.6b According to the reaction condi-
tions described above, succinimidyl esters of O-TBDMS-a-(R)-Me-

K. Mizusawa et al. / Bioorg. Med. Chem. 17 (2009) 2381–2387
2383
b-HPA and N-Boc-a-(R)-Me-b-ala were subjected to the coupling
support and then coupled with the 50-CC moiety (mimic of C75
reaction with pPANS. The coupling products were isolated by HPLC
and then deprotected by acidic treatment to give the final com-
and C74 sequences). CCPmn(
a-(R)-Me-b-HPA) 15 was synthesized
as shown in Scheme 2.
pounds pPmn(
a
-(R)-Me-b-HPA) 9 (MALDI-TOF [(M+H)+]: calcd
The 30-amino group of PANS 1 was derivatized selectively with
461.16, found 460.94) and pPmn(
a
-(R)-Me-b-ala) 10 (MALDI-TOF
O-TBDMS-a
-(R)-Me-b-HPA succinimidyl ester. The 50 and 20 hydro-
[(M+H)+]: calcd 460.40, found 459.92).
xyl groups were reacted with DMTrCl and succinic anhydride,
respectively, to give 13 in a 44% yield in three steps. Compound
13 was then attached onto a commercially available LCAA-CPG
support and the loading quantities were determined spectroscopi-
In contrast to the simple Pmn derivatives, all the synthesized
pPmn derivatives are soluble in water at mM range. However,
translation inhibition assay indicated that compounds 9 and 10
both showed no apparent inhibitory effects even at high
lM range
cally by the DMTr cation method (typically 30 lmol/g loading). The
(data not shown). In addition, a recent report has suggested that
the C75 and C74 bases of tRNA are indispensable for inducing
the conformational change of the ribosome to peptidyl transfer
(PT)-reaction active form.15 Thus, it might be reasonable to assume
that simple Pmn or pPmn derivatives are not a true mimic of A-site
tRNA, owing to the lack of C75 and C74 sequences. We then fo-
cused on cytidylyl-(30–50)-cytidylyl-(30–50)-puromycin (CCPmn)
derivatives as mimics of acylated tRNA at the ribosome A-site.
resulting solid support 14 was subjected to solid-phase coupling
with N-acetyl-protected cytidine phosphoramidite using normal
phosphoramidite coupling chemistry. The resulting trinucleotide
was detached from the solid support and was fully deprotected un-
der alkaline conditions. Subsequent purification by reverse-phase
HPLC yielded CCPmn(
a
-(R)-Me-b-HPA) 15 (MALDI-TOF [(MꢀH)ꢀ]:
calcd 989.26, found 989.53) in a 26% yield from 14. Other CCPmn
derivatives, CCPmn(
a
-(R)-Me-b-ala) 16 (MALDI-TOF [(MꢀH)ꢀ]:
calcd 988.27, found 988.61) and CCPmn(Ac) 17 (MALDI-TOF
[(MꢀH)ꢀ]: calcd 945.23, found 945.70), were synthesized success-
fully by the same method using succinimidyl esters of N-trifluoro-
2.2. Synthesis of CCPmn derivatives
The CCPmn derivatives were prepared by solid-phase synthe-
sis.12c Fully protected Pmn derivatives were attached onto a solid
acetyl-
a-(R)-Me-b-ala and acetic acid, respectively, as a coupling
reagent with PANS in the first step (Fig. 2). CCPmn 18 (MALDI-
Scheme 2. Reagents and conditions: (a) O-TBDMS-
a-(R)-Me-b-HPA-OSu, dry DMF, rt, overnight, 85%; (b) DMTrCl, DMAP, dry pyridine, rt, 12 h, 89%; (c) succinic anhydride,
DMAP, dry pyridine, rt, overnight, 58%; (d) DCC, DMAP, DhbtOH, LCAA-CPG, dry DMF, rt, 24 h, 30
l
mol/g; (e) solid-phase DNA synthesis and deprotection.

2384
K. Mizusawa et al. / Bioorg. Med. Chem. 17 (2009) 2381–2387
Figure 2. Chemical structures of the CCPmn and CCPmn derivatives synthesized and used in this study.
TOF [(MꢀH)ꢀ]: calcd 1080.30, found 1080.52) was synthesized
using commercially available Puromycin-CPG (Glen Research). All
of these products showed good solubility in water up to at least
0.8 mM.
This result is consistent with our previous finding that b-HPA could
be incorporated into proteins/peptides through the ribosomal
translation system.6b Interestingly, CCPmn(
a
-(R)-Me-b-ala) 16
showed an IC50 value of 33
l
M,16 lower than that of negative con-
trol CCPmn(Ac) 17. Though careful investigation is indispensable,
simply, this suggests that b-amino acids are also adaptable to the
ribosomal A-site, implying that b-amino acids are promising sub-
strates for the ribosomal translation system.
2.3. Biological assay
As we now had CCPmn derivatives with backbone-elongated
substrates, we then moved on to investigate the translation inhib-
itory activity of these derivatives. Inhibition experiments were car-
ried out using a reconstituted E. coli translation system. An mRNA
for firefly luciferase protein was translated in the absence and
3. Conclusion
In conclusion, we described the synthesis of a series of pPmn
and CCPmn derivatives that have backbone-elongated substrates.
The procedure can be easily applied to other Pmn scaffold such
as CPmns with backbone-elongated substrates. All of the synthe-
sized derivatives were found to be soluble in an aqueous solution,
allowing us to use these probes for translation inhibition assay in
an E. coli translation system. Our simple inhibition assay suggested
that the backbone-elongated substrates can adapt to the ribosomal
A-site. However, it should be noted that the present inhibition effi-
ciency is not completely proportional to the chemical compatibility
of substrates with ribosomal PT reaction at the A-site. The inhibi-
tory reaction is composed of multiple-step processes including a
binding to the A-site and the following PT reaction. Under the pres-
presence of various concentrations (2.5–30 lM) of CCPmn deriva-
tives 15, 16, 17, and CCPmn 18. Translation efficiency was deter-
mined by comparing the translated luciferase activity with that
of a calibration set of control luciferase that was translated in the
absence of CCPmns. The results are summarized in Figure 3. Nega-
tive control CCPmn(Ac) 17 showed no inhibitory activity in this
concentration range (IC50 = 66
high inhibitory activity of positive control CCPmn 18 (IC50 = 5
Interestingly, CCPmn( -(R)-Me-b-HPA) 15 actually inhibited the
E. coli translation system to give IC50 = 12 M, which is slightly
l
M),16 in marked contrast to the
M).
l
a
l
higher than positive control 18, suggesting that the b-HPAs are
substrates that are potentially adaptable to the ribosome A-site.
Figure 3. Inhibition of luciferase translation in the E. coli translation system by the presence of various concentrations of CCPmns (2.5–30 lM). Translation efficiency (%) was
determined by comparing the luciferase activity (c.p.s.) with that from the serial dilution of control luciferase translated in the absence of CCPmns. Error bars represent
standard deviations of three independent experiments.

K. Mizusawa et al. / Bioorg. Med. Chem. 17 (2009) 2381–2387
2385
ent experimental conditions, there is no guarantee that the PT
reaction is a rate limiting step in overall events at the A-site.17
However, a series of these soluble CCPmns, or CPmns that could
be synthesized according to the similar procedure, can also be sub-
jected to further experiments, such as stopped-flow PT reaction as-
say.12b,d,13 These experiments could reveal such details, leading to
important implications for the rational expansion of ribosomally
adaptable substrates. Further work is now in progress along these
lines.
chromatography to give 4: Yield = 61%; 1H NMR (DMSO-d6,
500 MHz) d: 8.30–7.15 (m, 20H), 6.76 (m, 4H), 6.18 (m, 1H), 5.81
(m, 1H), 4.93 (m, 1H), 4.35 (m, 1H), 4.25–4.18 (m, 3H), 3.66 (s,
6H), 3.44 (br, 6H), 3.28–3.20 (m, 2H), 2.06 (s, 3H); HRMS (FAB):
m/z calcd for C50H49O8N6 [(M+H)+] 861.3612, found 861.3620.
4.1.5. 4-(((9H-Fluoren-9-yl)methoxy)carbonylamino)-2-(6-
(dimethylamino)-9H-purin-9-yl)-5-(hydroxymethyl)-
tetrahydrofuran-3-yl acetate (5)
50-O-DMTr-30-N-Fmoc-20-O-Ac-protected PANS
4
(170 mg,
4. Experiments
4.1. Synthesis
0.2 mmol) was dissolved in 15 ml of 3% trichloroacetic acid in
CH2Cl2 and the resulting solution was stirred for 30 min at room
temperature. The reaction solution was diluted with CHCl3 and
washed with H2O. The organic layer was dried with MgSO4 and
evaporated to dryness. The crude products were purified by col-
umn chromatography (silica gel) to give 5: Yield = 27%; 1H NMR
(DMSO-d6, 500 MHz) d: 8.41 (s, 1H), 8.22 (s, 1H), 7.89 (d,
J = 7.5 Hz, 2H), 7.83 (m, 1H), 7.69 (d, J = 7.5 Hz, 2H), 7.41 (m, 2H),
7.33 (m, 2H), 6.17 (m, 1H), 5.61 (m, 1H), 5.29 (m, 1H), 4.56 (m,
1H), 4.37 (m, 1H), 4.29–4.20 (m, 2H), 4.08 (m, 1H), 3.73–3.52 (m,
2H), 3.47 (br, 6H), 2.00 (s, 3H); HRMS (FAB): m/z calcd for
C29H31O6N6 [(M+H)+] 559.2305, found 559.2307.
4.1.1. General
Reagents and solvents were purchased from standard suppliers
and used without further purification. Wakogel C-200 was used for
silica gel chromatography. NMR spectra were measured on a JEOL
JNM-A500 (500 MHz) NMR. The coupling constants (J values) are
reported in Hertz. The FAB and MALDI-TOF mass spectra were re-
corded on a JEOL JMS HX110A spectrometer and an Applied Biosys-
tems Voyager Elite, respectively. HPLC analyses and purifications
were performed on a SHIMADZU SCL-10AVP system with Wakosil
5C18 columns.
4.1.6. (3-Amino-5-(6-(dimethylamino)-9H-purin-9-yl)-4-
hydroxytetrahydrofuran-2-yl)methyl phosphate (7)
4.1.2. (9H-Fluoren-9-yl)methyl 5-(6-(dimethylamino)-9H-
purin-9-yl)-4-hydroxy-2-(hydroxymethyl)tetrahydrofuran-3-
ylcarbamate (2)
1H-Tetrazole (18 mg, 0.256 mmol) and bis(2-cyanoethyl)-N,N-
diisopropylphosphoramidite (70 mg, 0.258 mmol) were added to
the solution of 30-N-Fmoc-20-O-Ac-protected PANS
4 (75 mg,
Puromycin aminonucleoside (100 mg, 0.34 mmol) was mixed
with 9-fluorenylmethyl succinimidyl carbonate (FmocOSu,
138 mg, 0.41 mmol) in dry DMF (5 ml). The solution was stirred
for 2 h at room temperature and the solvent was removed in vacuo.
The crude products were purified by preparative layer chromatog-
raphy to give 2: Yield = 94%; 1H NMR (DMSO-d6, 500 MHz) d: 8.43
(s, 1H), 8.22 (s, 1H), 7.89–7.33 (m, 9H), 5.97 (m, 1H), 5.94 (br, 1H),
5.23 (br, 1H), 4.46 (br, 1H), 4.28–4.21 (m, 4H), 4.06 (m, 1H), 3.74–
3.53 (m, 2H), 3.44 (br, 6H); HRMS (FAB): m/z calcd for C27H29O5N6
[(M+H)+] 517.2199, found 517.2218.
0.134 mmol) in CH2Cl2 (3 ml). The resulting mixture was stirred
for 2 h at room temperature and additional bis(2-cyanoethyl)-
N,N-diisopropylphosphoramidite (70 mg, 0.258 mmol) was added
to the solution. After stirring for 2 h, 0.02 M I2 in THF/pyridine/
water (10 ml) was added to the solution and the resulting solution
was stirred at room temperature for 20 min. The solvents were
evaporated to dryness. The resulting residue was redissolved in
CHCl3, and washed with aqueous sodium bisulfite (twice) and
brine. The organic layer was dried with MgSO4 and evaporated to
dryness. The crude products containing 6 were redissolved in
CH3OH (2 ml). 15 ml of 25% aqueous ammonium solution was
added to the solution and the mixture was incubated at 55 °C over-
night. The resulting solution was lyophilized and again dissolved in
a 100 mM TEAA buffer (3 ml), and purified via HPLC to give pPANS
7: Yield = 5%; 1H NMR (D2O, 500 MHz) d: 8.27 (s, 1H), 8.03 (s, 1H),
6.02 (m, 1H), 4.77 (m, 1H), 4.42 (m, 1H), 4.02 (m, 1H), 4.00 (m, 2H),
3.26 (br, 6H); MALDI-TOF Mass m/z calcd for C12H20O6N6P
[(M+H)+] 375.30, found 374.97.
4.1.3. (9H-Fluoren-9-yl)methyl 2-((bis(4-methoxyphenyl)-
(phenyl)methoxy)methyl)-5-(6-(dimethylamino)-9H-purin-9-
yl)-4-hydroxytetrahydrofuran-3-ylcarbamate (3)
30-N-Fmoc-protected PANS 2 was dried by co-evaporation with
pyridine. DMAP (catalytic amount) and DMTrCl (260 mg,
0.77 mmol) were added to 2 (165 mg, 0.32 mmol) in dry pyridine.
The mixture was stirred overnight at room temperature. The sol-
vent was removed in vacuo; the resulting residue was redissolved
in CHCl3, and washed with aqueous sodium bisulfite (twice). The
organic layer was dried with MgSO4 and evaporated to dryness.
The crude products were purified by column chromatography (sil-
ica gel) to give 3: Yield = quant; 1H NMR (DMSO-d6, 500 MHz) d:
8.31–7.14 (m, 20H), 6.77 (m, 4H), 6.04 (m, 1H), 6.00 (m, 1H),
4.63 (m, 1H), 4.50 (m, 1H), 4.30–4.18 (m, 4H), 3.66 (s, 6H), 3.45
(br, 6H), 3.29–3.21 (m, 2H); HRMS (FAB): m/z calcd for
C48H47O7N6 [(M+H)+] 819.3506, found 819.3522.
4.1.7. (3-Acetamido-5-(6-(dimethylamino)-9H-purin-9-yl)-4-
hydroxytetrahydrofuran-2-yl)methyl phosphate (8)
pPANS 7 (0.89
of acetic acid succinimidyl ester (10
(100 l), and 10% aqueous NaHCO3 (100 l) was added to the solu-
l
mol) in TEAA (100
ll) was added to a solution
l
mol) in acetonitrile
l
l
tion. The reaction solution was incubated for 1 h at room temper-
ature and purified by reverse-phase HPLC using a linear gradient of
0–75% acetonitrile in a 100 mM TEAA buffer (pH 7.0). pPmn(Ac)
thus obtained was further purified by reverse-phase HPLC using
4.1.4. 4-(((9H-Fluoren-9-yl)methoxy)carbonylamino)-5-((bis(4-
methoxyphenyl)(phenyl)methoxy)methyl)-2-(6-(dimethyl-
amino)-9H-purin-9-yl)tetrahydrofuran-3-yl acetate (4)
a
linear gradient of 0–20% acetonitrile in distillated water:
Yield = 55%; MALDI-TOF Mass m/z calcd for C14H22O7N6P
[(M+H)+] 417.33, found 416.88.
Ac2O (68.6 l
l, 0.73 mmol) was added to 50-O-DMTr-30-N-Fmoc-
protected PANS 3 (270 mg, 0.33 mmol) in dry pyridine (5 ml) and
the resulting solution was stirred overnight at room temperature.
The solvent was removed in vacuo; the resulting residue was redis-
solved in CHCl3, and washed with aqueous sodium bisulfite (twice)
and brine. The organic layer was dried with MgSO4 and evaporated
to dryness. The crude products were purified by preparative layer
4.1.8. (5-(6-(Dimethylamino)-9H-purin-9-yl)-4-hydroxy-3-((R)-
3-hydroxy-2-methylpropanamido)tetrahydrofuran-2-yl)methyl
phosphate (9)
pPANS 7 (44.3 nmol) in TEAA (5
(R)-3-(tert-butyldimethylsilyloxy)-2-methyl-3-hydroxypropionic
acid succinimidyl ester (O-TBDMS- -(R)-Me-b-HPA-OSu, 5 mol)
ll) was added to a solution of
a
l

2386
K. Mizusawa et al. / Bioorg. Med. Chem. 17 (2009) 2381–2387
in acetonitrile (5
l
l), and 10% aqueous NaHCO3 (5
l
l) was added to
3H), 0.89 (s, 9H), 0.06 (ds, 6H); HRMS (FAB): m/z calcd for
the solution. The reaction solution was incubated for 2 h at 42 °C,
and purified by reverse-phase HPLC using a linear gradient of 0–
75% acetonitrile in a 100 mM TEAA buffer (pH 7.0). 50% trifluoro-
acetic acid (20 ll) was added to pPmn(O-TBDMS-a-(R)-Me-b-
HPA) (3.0 nmol). After incubation for 30 min on ice, the solvent
C43H56O7N6Si [M+] 796.3980, found 796.3983.
4.1.12. 4-(5-((Bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-
4-((R)-3-(tert-butyldimethylsilyloxy)-2-methylpropanamide)-
2-(6-(dimethylamino)-9H-purin-9-yl) tetrahydrofuran-3-
yloxy)-4-oxobutanoic acid (13)
was removed by blowing N2 gas. The product was redissolved in
a 100 mM TEAA buffer (100
l
l) and purified by HPLC using a linear
Compound 12 (399 mg, 0.50 mmol) was dried by co-evapora-
tion with pyridine. DMAP (62 mg, 0.51 mmol) and succinic anhy-
dride (493 mg, 4.93 mmol) were added to 12 in dry pyridine
(10 ml). The solution was stirred overnight at room temperature.
The solvent was removed in vacuo; the resulting residue was redis-
solved in CHCl3, and subsequently washed with aqueous sodium
bisulfite (twice). The organic layer was dried with MgSO4 and
evaporated to dryness. The crude products were purified by col-
umn chromatography (silica gel) to give 13: Yield = 58%; 1H NMR
(CDCl3, 500 MHz) d: 8.29 (s, 1H), 7.95 (s, 1H), 7.42–7.16 (m, 9H),
6.82–6.76 (m, 4H), 6.48 (m, 1H), 6.18 (m, 1H), 5.66 (m, 1H),
5.17–5.12 (m, 1H), 4.10–4.06 (m, 1H), 3.75 (s, 6H), 3.72–3.52 (m,
2H), 3.51 (br, 6H), 3.43–3.35 (m, 2H), 2.70–2.64 (m, 4H), 2.57 (m,
1H), 0.99 (m, 3H), 0.85 (s, 9H), 0.04 (m, 6H); HRMS (FAB): m/z calcd
for C47H60O10N6Si [M+] 896.4140, found 896.4159.
gradient of 0–40% acetonitrile in a 100 mM TEAA buffer (pH 7.0).
The product was further purified by reverse-phase HPLC using a
linear gradient of 0–20% acetonitrile in distillated water: Yield = 5%
in two steps; MALDI-TOF Mass m/z calcd for C16H26O8N6P [(M+H)+]
461.16, found 460.94.
4.1.9. (3-((R)-3-Amino-2-methylpropanamido)-5-(6-(dimethyl-
amino)-9H-purin-9-yl)-4-hydroxytetrahydrofuran-2-yl)methyl
phosphate (10)
pPANS 7 (0.74
of N-Boc-(R)-3-amino-2-methylpropionic acid succinimidyl ester
(N-Boc- -(R)-Me-b-ala-OSu, 10 mol) in acetonitrile (100 l), and
10% aqueous NaHCO3 (100 l) was added to this solution. The reac-
lmol) in TEAA (100 ll) was added to a solution
a
l
l
l
tion solution was incubated for 1 h at room temperature and puri-
fied by reverse-phase HPLC using a linear gradient of 0–75%
acetonitrile in a 100 mM TEAA buffer (pH 7.0). 50% trifluoroacetic
4.1.13. 30-Amino-30-deoxy-30-((R)-3-(tert-butyldimethyl-
silyloxy)-2-methylpropionyl)-50-O-(p,p0-dimethoxytrityl)-N6,N6-
dimethyladenosine 20-O-(LCAA-CPG)succinate (14)18
acid (100
(0.21 mol). After incubation for 30 min on ice, the solvent was re-
moved by blowing N2 gas. The product was redissolved in a
100 mM TEAA buffer (10 l) and purified by HPLC using a linear
ll) was added to the pPmn(N-Boc-a-(R)-Me-b-ala)
l
N,N0-Dicyclohexylcarbodiimide (23.7 mg, 0.12 mmol), DMAP
(15.6 mg, 0.13 mmol), 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzo-
triazine (DhbtOH, 17.6 mg, 0.11 mmol), and LCAA-CPG (201 mg)
were added to 13 (62.8 mg, 0.07 mmol) in dry DMF (4 ml). The
mixture was stirred for 24 h at room temperature. The CPG was fil-
tered and washed successively with DMF, MeOH, and dry ether.
THF/pyridine/Ac2O (2 ml) and 16% 1-methylimidazole in THF
(2 ml) were added to the CPG, and the mixture was stirred for
1 h at room temperature. The support was filtered and washed suc-
cessively with CH3OH and CHCl3 to yield the product 14:
l
gradient of 0–75% acetonitrile in a 100 mM TEAA buffer (pH 7.0).
The product was further purified by reverse-phase HPLC using a
linear gradient of 0–20% acetonitrile in distillated water:
Yield = 48% in two steps; MALDI-TOF Mass m/z calcd for
C16H27O7N7P [(M+H)+] 460.40, found 459.92.
4.1.10. (2R)-3-(tert-Butyldimethylsilyloxy)-N-(5-(6-(dimethyl-
amino)-9H-purin-9-yl)-4-hydroxy-2-(hydroxymethyl)-
tetrahydrofuran-3-yl)-2-methylpropanamido (11)
Yield = 8%; nucleoside loading = 30 lmol/g.
PANS (194 mg, 0.66 mmol) was mixed with (R)-3-(tert-butyldi-
methylsilyloxy)-2-methyl-3-hydroxypropionic acid succinimidyl
4.1.14. Cytidylyl-(30–50)-cytidylyl-(30–50)-30-amino-30-deoxy-30-
ester (O-TBDMS-
a
-(R)-Me-b-HPA-OSu, 215 mg, 0.68 mmol) in dry
((R)-3-hydroxy-2-methylpropionyl)-N6,N6-dimethyladenosine
DMF (6 ml). The solution was stirred overnight at room tempera-
ture, and the solvent was removed in vacuo. The crude products
were purified by preparative layer chromatography to give 11.
Yield = 85%; 1H NMR (CDCl3, 500 MHz) d: 8.07 (s, 1H), 8.06 (s,
1H), 7.20 (m, 1H), 5.87 (m, 1H), 5.81 (br, 1H), 5.25 (br, 1H), 4.64
(m, 1H), 4.43 (m, 1H), 4.19 (m, 1H), 3.95–3.77 (m, 2H), 3.66 (m,
2H), 3.44 (br, 6H), 2.46 (m, 1H), 1.09 (m, 3H), 0.85 (s, 9H), 0.03
(ds, 6H); HRMS (FAB): m/z calcd for C22H38O5N6Si [M+] 494.2673,
found 494.2666.
(CCPmn(
a
-(R)-Me-b-HPA) 15)
-(R)-Me-b-HPA) 15 was prepared by manual oligonu-
CCPmn(
a
cleotide synthesis using standard phosphoramidite coupling chem-
istry and standard cycles.12c,17 The solid support 14 (23.0 mg,
0.69 lmol) was loaded into a typical oligonucleotide synthesis col-
umn. In each step, the reagents or solvents were loaded via syringe.
The 50-DMTr group of 14 was deprotected with 3% trichloroacetic
acid (TCA) in CH2Cl2 and nucleotide coupling was performed using
50-dimethoxytrityl-N-acetyl-cytidine,20-O-TBDMS-30-[(2-cyano-
ethyl)-(N,N-diisopropyl)]-phosphoramidite (60 mmol) in anhy-
drous acetonitrile (0.6 ml) and 0.45 M tetrazole in acetonitrile
(0.8 ml). After incubation for 15 min, the unreacted 50-hydroxyl
group was capped in THF/pyridine/Ac2O (1.2 ml) and 16% 1-meth-
ylimidazole in THF (1.2 ml) for 1 min. The resulting product was
oxidized by treatment with 0.1 M I2 in THF/pyridine/H2O (1 ml)
for 1 min (twice). Additional C was attached according to the same
scheme, and the terminal 50-DMTr group was removed by 3% TCA.
The resulting CPG was mixed with 25% ammonium hydroxide
4.1.11. (2R)-N-(2-((Bis(4-methoxyphenyl)(phenyl)methoxy)-
methyl)-5-(6-(dimethylamino)-9H-purin-9-yl)-4-hydroxytetra-
hydrofuran-3-yl)-3-(tert-butyldimethylsilyloxy)-2-methyl-
propanamide (12)
Compound 11 (276 mg, 0.56 mmol) was dried by co-evapora-
tion with pyridine. DMAP (26 mg, 0.21 mol) and DMTrCl
(392 mg, 1.16 mmol) were added to 11 in dry pyridine (10 ml).
The mixture was stirred for 12 h at room temperature. The solvent
was removed in vacuo; the resulting residue was redissolved in
CHCl3, and washed with aqueous sodium bisulfite (twice). The or-
ganic layer was dried with MgSO4 and evaporated to dryness. The
crude products were purified by column chromatography (silica
gel) to yield 12. Yield = 89%; 1H NMR (CDCl3, 500 MHz) d: 8.26 (s,
1H), 7.96 (s, 1H), 7.29–7.06 (m, 9H), 6.72 (m, 4H), 6.15 (m, 1H),
5.88 (m, 1H), 4.84 (m, 1H), 4.46 (m, 2H), 3.74 (s, 6H), 3.67–3.65
(m, 2H), 3.51 (br, 6H), 3.45–3.37 (m, 2H), 2.44 (m, 1H), 1.08 (m,
(500 ll) and 40% methylamine solution (500 ll). Further it was
incubated for 10 min at 65 °C to cleave CCPmns from LCAA-CPG,
cooled to room temperature, and the supernatant was collected
after centrifugation. The CPG was rinsed twice with CH3CH2OH/
acetonitrile/H2O (v/v/v = 3/1/1, 1 ml). The combined supernatants
were evaporated to dryness under reduced pressure. The resulting
products were dissolved in 1.0 M tetrabutylammoniumfluoride in
THF (400 ll) and stirred overnight at room temperature to depro-

K. Mizusawa et al. / Bioorg. Med. Chem. 17 (2009) 2381–2387
2387
tect the TBDMS group. The solvent was removed in vacuo and the
products were suspended in a 100 mM NH4OAc buffer (pH 4.5,
1.4 ml). The suspension was filtered and purified by HPLC using
8% acetonitrile in a 100 mM NH4OAc buffer (pH 4.5), and again fur-
ther purified using a linear gradient of 0–30% acetonitrile in distil-
ga, 100 ll), and luciferase activity was measured using a Wallac
1420 multilabel counter. Translation efficiency (%) was determined
by comparing the luciferase activity (c.p.s.) with that from the se-
rial dilution of control luciferase translated in the absence of
CCPmns.
lated water to give CCPmn(a-(R)-Me-b-HPA) 15: Yield = 26%;
HRMS (FAB): m/z calcd for C34H49O19N12P2 [(M+H)+] 991.2712,
found 991.2700; MALDI-TOF Mass: m/z calcd for C34H47O19N12P2
[(MꢀH)ꢀ] 989.26, found 989.53.
Acknowledgment
This work was supported by Grant-in-aids No.18350084 and
No. 19685016 from the Ministry of Education, Science, Sports,
and Culture, Japan.
4.1.15. CCPmn derivatives 16, 17, and 18
CCPmn derivatives 16, 17, and 18 were synthesized according to
the same method as CCPmn 15 (as described above). For 16:
Yield = 44%; HRMS (FAB): m/z calcd for C34H50O18N13P2 [(M+H)+]
990.2872, found 990.2885; MALDI-TOF Mass: m/z calcd for
C34H48O18N13P2 [(MꢀH)ꢀ] 988.27, found 988.61. 17: Yield = 43%;
HRMS (FAB): m/z calcd for C32H45O18N12P2 [(M+H)+] 947.2450,
found 947.2454; MALDI-TOF Mass: m/z calcd for C32H43O18N12P2
[(MꢀH)ꢀ] 945.23, found 945.70. 18: Yield = 25%; HRMS (FAB): m/z
calcd for C40H54O19N13P2 [(M+H)+] 1082.3134, found 1082.3145;
MALDI-TOF Mass: m/z calcd for C40H52O19N13P2 [(MꢀH)ꢀ]
1080.30, found 1080.52.
References and notes
1. (a) Tan, Z.; Blacklow, S. C.; Cornish, V. W.; Forster, A. C. Methods 2005, 36, 279.
and references therein; (b) Zhang, B.; Tan, Z.; Dickson, L. G.; Nalam, M. N. L.;
Cornish, V. W.; Forster, A. C. J. Am. Chem. Soc. 2007, 129, 11316.
2. (a) Takahashi, T. T.; Austin, R. J.; Roberts, R. W. Trends Biochem. Sci. 2003, 28,
159. and references therein; (b) Frankel, A.; Millward, S. W.; Roberts, R. W.
Chem. Biol. 2003, 10, 1043; (c) Millward, S. W.; Takahashi, T. T.; Roberts, R. W. J.
Am. Chem. Soc. 2005, 127, 14142.
3. (a) Josephson, K.; Hartman, M. C.; Szostak, J. W. J. Am. Chem. Soc. 2005, 127,
11727; (b) Hartman, M. C.; Josephson, K.; Szostak, J. W. Proc. Natl. Acad. Sci.
U.S.A. 2006, 103, 4356; (c) Hartman, M. C.; Josephson, K.; Lin, C. W.; Szostak, J.
W. PLoS One 2007, 2, e972; (d) Subtelny, A. O.; Hartman, M. C.; Szostak, J. W. J.
Am. Chem. Soc. 2008, 130, 6131.
4.2. Biological assay
4. (a) Murakami, H.; Ohta, A.; Ashigai, H.; Suga, H. Nat. Methods 2006, 3, 357; (b)
Ohta, A.; Murakami, H.; Higashimura, E.; Suga, H. Chem. Biol. 2007, 14, 1315; (c)
Kawakami, T.; Murakami, H.; Suga, H. Chem. Biol. 2008, 15, 32; (d) Sako, Y.;
Goto, Y.; Murakami, H.; Suga, H. ACS Chem. Biol. 2008, 3, 241; (e) Sako, Y.;
Morimoto, J.; Murakami, H.; Suga, H. J. Am. Chem. Soc. 2008, 130, 7232; (f)
Kawakami, T.; Murakami, H.; Suga, H. J. Am. Chem. Soc. 2008, 130, 16861.
5. Merryman, C.; Green, R. Chem. Biol. 2004, 11, 575.
6. (a) Sando, S.; Kanatani, K.; Sato, N.; Matsumoto, H.; Hohsaka, T.; Aoyama, Y. J.
Am. Chem. Soc. 2005, 127, 7998; (b) Sando, S.; Abe, K.; Sato, N.; Shibata, T.;
Mizusawa, K.; Aoyama, Y. J. Am. Chem. Soc. 2007, 129, 6180; (c) Sando, S.; Masu,
H.; Furutani, C.; Aoyama, Y. Org. Biomol. Chem. 2008, 6, 2666.
7. Owczarek, A.; Safro, M.; Wolfson, A. D. Biochemistry 2008, 47, 301.
8. Link, A. J.; Tirrell, D. A. Methods 2005, 36, 291. and references therein.
9. England, P. M. Biochemistry 2004, 43, 11623. and references therein.
10. (a) Killian, J. A.; Van Cleve, M. D.; Shayo, Y. F.; Hecht, S. M. J. Am. Chem. Soc.
1998, 120, 3032; (b) Eisenhauer, B. M.; Hecht, S. M. Biochemistry 2002, 41,
11472.
11. (a) Hohsaka, T.; Sato, K.; Sisido, M.; Takai, K.; Yokoyama, S. FEBS Lett. 1993, 335,
47; (b) Sisido, M.; Hohsaka, T. Bull. Chem. Soc. Jpn. 1999, 72, 1409.
12. (a) Weinger, J. S.; Kitchen, D.; Scaringe, S. A.; Strobel, S. A.; Muth, G. W. Nucleic
Acids Res. 2004, 32, 1502; (b) Okuda, K.; Seila, A. C.; Strobel, S. A. Biochemistry
2005, 44, 6675; (c) Okuda, K.; Seila, A. C.; Strobel, S. A. Tetrahedron 2004, 60,
12101; (d) Kingery, D. A.; Pfund, E.; Voorhees, R. M.; Okuda, K.; Wohlgemuth,
I.; Kitchen, D. E.; Rodnina, M. V.; Strobel, S. A. Chem. Biol. 2008, 15, 493.
13. Beringer, M.; Rodnina, M. V. Mol. Cell 2007, 26, 311. and references therein.
14. Starck, S. R.; Qi, X.; Olsen, B. N.; Roberts, R. W. J. Am. Chem. Soc. 2003, 125, 8090.
and the earlier references therein.
4.2.1. Preparation of mRNA for firefly luciferase
The first PCR was carried out in 25 ll of a reaction mixture
containing 5 pmol of forward primer 50-(AAGGAGATATACCA-
ATGGAAGACGCCAAAAACATA)-30, 5 pmol of reverse primer 50-
(TATTCATTACACGGCGATCTTTCCG)-30, 5 ng of pGL3 vector (Prome-
ga), 5 nmol each of dNTPs, 1.25 U of Pfu Ultra HF DNA polymerase
(Stratagene), and 2.5
second PCR was then carried out in 25
l
l of 10 ꢁ Pfu Ultra HF Reaction Buffer. The
l
l of a reaction mixture
containing 5 pmol of first primer 50-(GAAATTAATACGACTCACTA
TAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTA
AGAAGGAGATATACCA)-30, 5 pmol of reverse primer 50-(TATTCAT-
TACACGGCGATCTTTCCG)-30, 1.0
each of dNTPs, and 2.5
ll of the first PCR solution, 5 nmol
ll of 10 ꢁ Pfu Ultra HF reaction buffer. The
firefly luciferase mRNAs were transcribed from the second PCR
product using a T7 MEGAshortscript kit (Ambion) and were puri-
fied with an RNeasy MinElute Clean Up kit (Qiagen).
4.2.2. Translation inhibition assay
Translation was carried out in 10
l
l of a reaction mixture con-
l of reconstituted
taining 1 g of firefly luciferase mRNA, 7
l
l
15. Schmeing, T. M.; Huang, K. S.; Strobel, S. A.; Steitz, T. A. Nature 2005, 438, 520.
16. IC50 values for 16 and 17 were determined by inhibition experiments at the
E. coli translation system (Post Genome Institute, Co., Ltd), and var-
ious concentrations of CCPmn derivatives. After 1 h incubation at
concentration range of 2.5–120 lM (data not shown).
17. Beringer, M.; Rodnina, M. V. Biol. Chem. 2007, 388, 687.
18. Walsh, A. J.; Clark, G. C.; Fraser, W. Tetrahedron Lett. 1997, 38, 1651.
37 °C, 2.5
l
l aliquots were diluted with 7.5
ll of water. The diluted
solution (10
ll) was added to the luciferase assay solution (Prome-