Design, synthesis, and X-ray crystal structure of classical and nonclassical 2-Amino-4-oxo-5-substituted-6-ethylthieno[2,3-d]pyrimidines as dual thymidylate synthase and dihydrofolate reductase inhibitors and as potential antitumor agents

Article abstract of DOI:10.1021/jm900490a

N-{4-[(2-Amino-6-ethyl-4-oxo-3,4-dihydrothieno[2,3-d]pyrimidin-5-yl)thio] benzoyl}-L-glutamic acid 2 and 13 nonclassical analogues 2a-2m were synthesized as potential dual thymidylate synthase (TS) and dihydrofolate reductase (DHFR) inhibitors and as antitumor agents. The key intermediate in the synthesis was 2-amino-6-ethyl-5-iodothieno[2,3-d]pyrimidin-4(3H)-one, 7, to which various arylthiols were attached at the 5-position. Coupling 8 with L-glutamic acid diethyl ester and saponification afforded 2. X-ray crystal structures of 2 and 1 (the 6-methyl analogue of 2), DHFR, and NADPH showed for the first time that the thieno[2,3-d]pyrimidine ring binds in a "folate" mode. Compound 2 was an excellent dual inhibitor of human TS (IC₅₀=54 nM) and human DHFR (IC₅₀=19 nM) and afforded nanomolar GI₅₀ values against tumor cells in culture. The 6-ethyl substitution in 2 increases both the potency (by 2-3 orders of magnitude) as well as the spectrum of tumor inhibition in vitro compared to the 6-methyl analogue 1. Some of the nonclassical analogues were potent and selective inhibitors of DHFR from Toxoplasma gondii.

Full text of DOI:10.1021/jm900490a

4892 J. Med. Chem. 2009, 52, 4892–4902
DOI: 10.1021/jm900490a
Design, Synthesis, and X-ray Crystal Structure of Classical and Nonclassical 2-Amino-4-oxo-5-
substituted-6-ethylthieno[2,3-d]pyrimidines as Dual Thymidylate Synthase and Dihydrofolate
Reductase Inhibitors and as Potential Antitumor Agents
Aleem Gangjee,*,† Wei Li,† Roy L. Kisliuk,‡ Vivian Cody,§ Jim Pace,§ Jennifer Piraino,§ and Jennifer Makin§
†Division of Medicinal Chemistry, Graduate School of Pharmaceutical Sciences, Duquesne University, 600 Forbes Avenue,
Pittsburgh, Pennsylvania 15282, ‡Department of Biochemistry, School of Medicine, Tufts University, Boston, Massachusetts 02111, and
§Hauptman-Woodward Medical Research Institute, Inc., 700 Ellicott Street, Buffalo, New York 14203
Received April 17, 2009
N-{4-[(2-Amino-6-ethyl-4-oxo-3,4-dihydrothieno[2,3-d]pyrimidin-5-yl)thio]benzoyl}-L-glutamic acid
2 and 13 nonclassical analogues 2a-2m were synthesized as potential dual thymidylate synthase (TS)
and dihydrofolate reductase (DHFR) inhibitors and as antitumor agents. The key intermediate in the
synthesis was 2-amino-6-ethyl-5-iodothieno[2,3-d]pyrimidin-4(3H)-one, 7, to which various arylthiols
were attached at the 5-position. Coupling 8 with L-glutamic acid diethyl ester and saponification
afforded 2. X-ray crystal structures of 2 and 1 (the 6-methyl analogue of 2), DHFR, and NADPH
showed for the first time that the thieno[2,3-d]pyrimidine ring binds in a “folate” mode. Compound 2
was an excellent dual inhibitor of human TS (IC50=54 nM) and human DHFR (IC50=19 nM) and
afforded nanomolar GI50 values against tumor cells in culture. The 6-ethyl substitution in 2 increases
both the potency (by 2-3 orders of magnitude) as well as the spectrum of tumor inhibition in vitro
compared to the 6-methyl analogue 1. Some of the nonclassical analogues were potent and selective
inhibitors of DHFR from Toxoplasma gondii.
Introduction
transported into cells via the reduced folate carrier (RFC) and
undergoes rapid polyglutamylation by the enzyme folylpoly-
glutamate synthetase (FPGS).14,15 Raltitrexed is approved as
a first-line agent for advanced colorectal cancer in several
European countries, Australia, Canada, and Japan. In peme-
trexed a pyrrole ring replaces the pyrazine of folic acid and a
methylene group replaces the N10-nitrogen in the bridge.11
Pemetrexed contains a 6-5 fused pyrrolo[2,3-d]pyrimidine
scaffold and is designated a multitargeted antifolate (MTA).
Pemetrexed and its polyglutamylated metabolites are reported
to be inhibitors of several important folate-dependent enzymes
including TS, DHFR, glycinamide ribonucleotide formyltrans-
ferase (GARFT), and aminoimidazole carboxamide ribo-
nucleotide formyltransferase (AICARFT).11,16,17
As part of a continuing effort to develop novel classical
antifolates as antitumor agents, Gangjee et al.18 reported the
synthesis of N-{4-[(2-amino-6-methyl-4-oxo-3,4-dihydrothie-
no[2,3-d]pyrimidin-5-yl)sulfanyl]benzoyl}-L-glutamic acid 1
(Figure 2) as a potent dual inhibitor of TS and DHFR with
IC50 values in the 10-8 M range. Compound 1 also demon-
strated moderate inhibitory activity against the growth of
several human tumor cell lines in the National Cancer In-
stitute (NCI)19 preclinical in vitro screen, with GI50 values of
10-5-10-6 M or lower. The dual TS/DHFR inhibitory
potency and tumor cell inhibitory activities of 1 were, in part,
attributed to its C6-methyl group. Molecular modeling using
SYBYL8.020 indicatedthatcompound1 could bind to human
DHFR in the “flipped” mode compared to folic acid, in which
the sulfur atom of thieno ring is superimposed onto the 4-oxo
moiety of folate. Additionally, molecular modeling of 1 in
human TS suggested that homologation of the C6-methyl
Folate metabolism has long been recognized as an impor-
tant and attractive target for chemotherapy because of its
crucial role in the biosynthesis of nucleic acid precursors.1,2
Inhibitors of folate-dependent enzymes have found clinical
utility as antitumor, antimicrobial, and antiprotozoal agents2-5
(Figure 1). Thymidylate synthase (TSa), which catalyzes the
reductive methylation of deoxyuridylate (dUMP) to thymi-
dylate(dTMP), hasbeenof particularinterest.6,7 This reaction
affords 7,8-dihydrofolate (7,8-DHF), which is reduced by di-
hydrofolate reductase (DHFR) to tetrahydrofolate (THF).3,5-7
Thus, TS and DHFR are crucial for the synthesis of dTMP in
dividing cells. Several TS and DHFR inhibitors, as separate
entities, have found clinical utility as antitumor agents.8-12
Usually a 2,4-diamino-substituted pyrimidine ring is consid-
ered important for potent DHFR inhibitory activity, while a
2-amino-4-oxopyrimidine or 2-methyl-4-oxopyrimidine ring
is considered important for potent TS inhibitory activity.3,7,8
Examples of clinically used TS and DHFR inhibitors are
raltitrexed,12 pemetrexed,11 and methotrexate13 (MTX), illu-
strated in Figure 1. Raltitrexed is a quinazoline analogue that is
*To whom correspondence should be addressed. Phone: 412-396-
6070. Fax: 412-396-5593. E-mail: gangjee@duq.edu.
a Abbreviations: TS, thymidylate synthase; dUMP, deoxyuridylate;
dTMP, deoxythymidylate; 7,8-DHF, 7,8-dihydrofolate; DHFR, dihy-
drofolate reductase; MTX, methotrexate; RFC, reduced folate carrier;
FPGS, folylpolyglutamate synthetase; GARFT, glycinamide ribonu-
cleotide formyltransferase; AICARFT, aminoimidazole carboxamide
ribonucleotide formyltransferase; AIDS, acquired immunodeficiency
syndrome; P. carinii, Pneumocystis carinii; T. gondii, Toxoplasma gondii;
E. coli, Escherichia coli; PTX, piritrexim; NCI, National Cancer In-
stitute.
r
pubs.acs.org/jmc
Published on Web 07/16/2009
2009 American Chemical Society

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15 4893
Figure 1. Representative antifolates.
Figure 2. 6-Methyl and target 6-ethyl-2-amino-4-oxo-5-substituted thieno[2,3-d]pyrimidines.
infections caused by Pneumocystis carinii (P. carinii)31 and
to an ethyl could further enhance the hydrophobic interaction
with Trp109 and perhaps the antitumor activity as well.
A disadvantage of classical antifolates as antitumor agents
is that they require an active transport mechanism to enter
cells, which, when impaired, causes tumor resistance.21,22 In
addition, cellsthatlack thesetransportmechanisms, including
many bacterial and protozoan cells, are not susceptible to the
action of classical antifolates.23-26 In an attempt to overcome
these potential drawbacks, nonclassical lipophilic antifolates
have been developed as antitumor agents that do not require
the folate transport system(s) but enter cells via diffusion.
These lipophilic nonclassical antifolates such as nolatrexed
(Figure 1) lack the polar glutamate moiety and hence do not
depend on FPGS for their inhibitory activity.27,28 In addition,
nonclassical antifolates do not require the reduced folate
carrier (RFC) system for active uptake into the cell, since they
are lipophilic and are passively transported into cells.
Toxoplasma gondii (T. gondii).32 Current therapy includes the
use of selective but weak inhibitors of protozoal DHFR such
as trimethoprim (TMP) (Figure 1), in combination with
sulfonamides to enhance potency. Toxicity of the sulfa drug
component of these combinations is often a serious pro-
blem.32 The potent but toxic nonclassical antifolates trime-
trexate (TMQ) and piritrexim (PTX) (Figure 1), coadmini-
stered with leucovorin for host rescue, are also used. Serious
toxicities associated with the use of TMQ and PTX often
force the cessation of treatment. Thus, it is of considerable
interest to incorporate selectivity and potency into a single
nonclassical antifolate that can be used alone to treat these
infections.
Gangjee et al.18 recently described the design and synthesis
of several nonclassical 2-amino-4-oxo-5-arylthio-substituted-
6-methylthieno[2,3-d]pyrimidines 1a-1i (Figure 2) as dual
TS/DHFR inhibitors. All of the nonclassical analogues were
reasonably potent inhibitors of human TS with IC50 values
ranging from 0.11 to 4.6 μM. The electronic nature of the
substitutent on the side chain phenyl was an important factor
in determining inhibitory potency. Analogues with electron
An additional aspect of our interest in nonclassical dual TS-
DHFR inhibitors lies in the treatment of opportunistic infec-
tions in immunocompromised patients such as those with
acquired immunodeficiency syndrome (AIDS).29,30 The prin-
cipal cause of death in patients with AIDS is opportunistic

4894 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15
Gangjee et al.
Scheme 1a
a Reagents: (a) ethyl cyanoacetate, Et3N, sulfur, DMF, 55 ꢀC, 3 h; (b) carbamimidic chloride hydrochloride, DMSO2; 120 ꢀC, 1 h; (c) (1) Hg(AcO)2,
AcOH, 100 ꢀC, 3 h; (2) I2, CH2Cl2, room temp, 5 h; (d) thiols, Pd2(dba)3, Xantphos, i-Pr2NEt, DMF, microwave, 190 ꢀC, 30 min; (e) 1 N NaOH, MeOH;
(f) L-glutamate hydrochloride, 2-chloro-4,6-dimethoxy-1,3,5-triazine, N-methylmorpholine, DMF, room temp, 5 h; (g) 1 N NaOH, EtOH.
withdrawing substitutions on the phenyl ring were more
potent than analogues with electron donating substitutions
or the unsubstituted phenyl. Structure-activity relationship
(SAR) studies demonstrated that analogues with electron
withdrawing groups at the 3- and/or 4-position of the phenyl
side chain provided optimum inhibitory potency against hu-
man TS. Nonclassical analogues such as 1b (IC50=0.26 μM),
1c (IC50=0.11 μM), 1e (IC50=0.11 μM), 1g (IC50=0.12 μM),
or 1h (IC50 = 0.28 μM) were much more potent than the
clinically used raltiterxed and pemetrexed against human TS;
thus, nonclassical analogues 2a-2m containing similar phe-
nyl substituents were also synthesized. Interestingly, all the
nonclassical compounds 1a-1i18were potent inhibitors of
T. gondii DHFR with IC50 values ranging from 0.028 to
0.12 μM. The IC50 values of compounds 1b-1i against
T. gondii DHFR were similar in potency to MTX and were
about 243-fold more potent than the clinically used TMP. In
addition, all the nonclassical compounds showed good to
excellent selectivity against T. gondii DHFR compared to
human DHFR. Analogue 1c (IC50=0.56 μM) was the most
potent compound in this series against human DHFR, and it
was 28-fold less potent against human DHFR than MTX but
was more than 12-fold more potent than pemetrexed. Com-
pound1dwitha 2,5-dimethoxysubstitutiononthe phenylring
was marginally active against human DHFR (IC50=22 μM)
but very potent against T. gondii DHFR (IC50 = 56 nM),
exhibiting 393-fold selectivity compared to human DHFR.
As indicated above, molecular modeling (SYBYL 8.0) sug-
gested that an extension of the 6-methyl group to an ethyl
group might enhance the potency and selectivity against
pathogenic TS and DHFR. To determine the effect of
6-ethyl homologation on human TS and DHFR inhibitory
activity in the classical and nonclassical analogues, com-
pounds 2-2m (Figure 2) were synthesized. The synthesis
and biological activities of analogues 2-2m are the subject
of this report.
Chemistry
The synthetic strategy for target compounds 2-2m is
shown in Scheme 1. The key intermediate in the synthesis
was 2-amino-6-ethyl-5-iodothieno[2,3-d]pyrimidin-4(3H)-one,
6 (Scheme 1), which could undergo microwave assisted palla-
dium catalyzed coupling reactions with appropriate arylthiols
to afford target compounds 2a-2m and intermediate 7 for the
synthesis of classical analogue 2.
The required intermediate ethyl 2-amino-5-ethylthiophene-
3-carboxylate 4 was synthesized from commercially available
butyraldehyde 3 with ethylcyanoacetate, sulfur, and triethyl-
amine via reported methods of Gewald.33 With compound 4
in hand, we turned our attention to its conversion to the
2-amino-6-ethylthieno[2,3-d]pyrimidin-4-(3H)-one, 5. A lit-
erature search revealed that the synthesis of compound 5
was not reported. Gangjee et al.34 had previously reported
that chloroformamidine hydrochloride on cyclization with
ethyl 2-amino-5-methylthiophene-3-carboxylate gave 2-ami-
no-6-methylthieno[2,3-d]pyrimidin-4(3H)-one in reasonably
good yield. Thus, heating a mixture of 4 and chloroformami-
dine hydrochloride in DMSO2 under N2 for a period of 2 h
at 120-125 ꢀC gave 5 in good yields (86%) after column
chromatography.
Recently, we reported a convenient C5-bromination for the
2-amino-4-oxo-6-methylthieno[2,3-d]pyrimidine template with
Br2 under microwave irradiation.18 To our surprise, all efforts
to perform this halogenation of 5 with Br2 or NBS using a
variety of reaction conditions of time and temperature varia-
tions proved fruitless. Thus, we had to consider an alternative
halogenation method. A search of the literature revealed that

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15 4895
there was no synthetic or other report for 6. However, Taylor
et al.35 had reported a mercuration methodology that could
be adopted for the synthesis of the key intermediate 2-amino-
6-ethyl-5-iodothieno[2,3-d]pyrimidin-4(3H)-one 6. Extending
this methodology to the synthesis of 6 required the 5-chloro-
mercury derivative, which was obtained by mercuration of 5
with mercurate acetate in glacial acetic acid at 100 ꢀC for 3 h,
followed by treatment with NaCl solution. Without separation,
this 5-chloromercury derivative was treated with iodine in
CH2Cl2 at room temperature for 5 h to afford 6 in 42% yield
(over two steps). With the key intermediate 6 in hand, attention
was turned to its conversion to the target compounds 2a-2m
and intermediate 7 (Scheme 1). Palladium-catalyzed cross-
coupling reactions36 to form carbon-sulfur bonds with aryl
bromides and arylthiols appeared attractive for the synthesis of
the target compounds 2a-2m and intermediate 7. Initial
attempts to react the iodo derivative 6 with corresponding
arylthiols catalyzed by Pd2(dba)3 with variations of time (up to
8 h) and temperature (up to reflux) were unsuccessful.
Failure of the above attempts led us to explore an alter-
native strategy to perform this palladium-catalyzed cross-
coupling reaction. Microwave irradiation has been widely
applied in organic synthesis, resulting in faster and cleaner
reactions that sometimes exhibit different reactivities due to
specific microwave absorption. It was therefore of interest to
attempt this cross-coupling reaction under microwave irradia-
tion. Thus, heating a mixture of 6, the appropriate arylthiols,
and i-Pr2NEt in DMF in the presence of Pd2(dba)3 and
Xantphos under microwave irradiation at 190 ꢀC for 1 h
afforded the corresponding target compounds 2a-2m in
yields of 67-87%.
For the synthesis of the classical compound 2, the requi-
red intermediate, methyl 4-[(2-amino-6-ethyl-4-oxo-3,4-dihy-
drothieno[2,3-d]pyrimidin-5-yl)thio]benzoate, 7 (Scheme 1),
was prepared using the same synthetic strategy as shown for
2a-2m. Methyl 4-mercaptobenzoate was used to afford 7 in a
yield of 76%. Ester hydrolysis of 7 with 1 N NaOH at room
temperature for 18 h afforded the corresponding free acid 8 in
96% yield. Coupling of the acid 8 (Scheme 1) with L-glutamic
acid diethyl ester hydrochloride and 2-chloro-4,6-dimethoxy-
l,3,5-triazine as the activating agent followed by column
chromatographic purification afforded 9 in 70% yield. The
1H NMR of 9 revealed the newly formed peptide NH proton
at 8.61 ppm as a doublet, which exchanged on addition of
D2O. Compound 9 was characterized on the basis of NMR
and MS. Hydrolysis of 9 with aqueous NaOH at room
temperature, followed by acidification with 3 N HCl under
ice cold conditions, afforded target compound 2 in 94% yield.
Figure 3. Difference electron density map (2Fo-Fc, 1σ, blue; Fo-Fc,
3σ, green) for the ternary complex of NADPH and 1 in human
DHFR.
In these structures, the thieno ring has no hydrogen donor
function. Nevertheless, the S7 of the thieno[2,3-d]pyrimidine
ring makes intermolecular contacts with the carbonyl of Ile7
˚
˚
˚
(3.6 A), Val115 (3.9 A), the hydroxyl of Tyr121 (3.8 A), and
˚
the carbonyl of the nicotinamide ring (3.4 A) (Figure 4). These
values are longer than those observed for the 2,4-diamino-
pyrrolo[2,3-d]pyrimidine and furo[2,3-d]pyrimidine struc-
tures that showed a flipped orientation.29,37,38 Although
molecular modeling studies carried out previously18 predicted
that both a flipped and folate binding orientation was possible
for 2-amino-4-oxo-6-methylthieno[2,3-d]pyrimidine, the struc-
tural data for four examples of 1 and 2 bound to mutant
human DHFR all show binding in the folate orientation
(Figure 5).
Biological Evaluation and Discussion
The classical analogue 2 and the nonclassical analogues
2a-2m were evaluated as inhibitors of human, Escherichia
coli (E. coli), and T. gondii DHFR39 and TS.40 The inhibitory
potencies (IC50) are listed in Table 1 and compared with those
of pemetrexed, PDDF, MTX, and trimethoprim and the
previously reported values for 1.
The classical analogue 2 (Table 1) was an excellent dual
inhibitor of human TS (IC50 =54 nM) and human DHFR
(IC50=19nM). Against humanTS, 2 was similarinpotencyto
the previously reported compound 1 and about 2-fold more
potent than PDDF and a remarkable 238-fold more potent
than the clinically used pemetrexed.
X-ray Crystal Structure
Against human DHFR (Table 1)2 was similarinpotency to
1 and the clinically used MTX (Table 1) and was 330-fold
more potent than pemetrexed. Interestingly, compound 2 was
9-fold more potent against T. gondii DHFR than human
DHFR, indicating a significant species difference. Compound
2 was somewhat more potent than 1 as an inhibitor of human
DHFR. This increase in activity against human DHFR of 2
over 1 may be attributed to increased hydrophobic interaction
of the 6-ethyl moiety of 2 and Val115 in human DHFR
as predicted from molecular modeling and confirmed by the
X-ray crystal structure (Figure 6). The biological data (IC50)
of compounds 1 and 2 indicate that the methyl and ethyl
groups atthe C6-position, respectively, are both conducivefor
potent human TS and DHFR inhibition.
The X-ray crystal structures of the ternary complex of 2,
NADPH, and the human DHFR double mutants (Q35K/
N64F and Q35S/N64S) were determined, as well as complexes
of1 withtheQ35Ksingle mutantproteinandwildtype human
DHFR. All DHFR ternary complexstructures wererefinedto
1.3-1.5 A resolution. These results show, for the first time,
that the thieno[2,3-d]pyrimidine antifolates 1 and 2 bind in a
folate orientation such that the thienosulfur occupies the N8
position observed in the binding of folic acid. Careful analysis
of the difference electron density maps (Figure 3) was carried
out to validate the binding orientation of 1 and 2. The
difference electron density for all structures reveals that the
thieno ring of 1 and 2 bind in the folate orientation.
ꢀ
˚

4896 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15
Gangjee et al.
Figure 4. Stereoview of superposition of active site for human DHFR-Q35K/N64F double mutant ternary complex with the inhibitor 2 and
NADPH (green), human DHFR-Q35S/N64S double mutant ternary complex with the inhibitor 2 and NADPH (cyan), human DHFR-Q35K
single mutant ternary complex with 1 (violet), and human DHFR ternary complex with 1 (yellow). The figure was prepared with PyMol.
Figure 5. Stereoview of the superposition of folate (cyan) from hDHFR (PDB 1drf ) on the structure of the hDHFR NADPH double mutant
protein Q35K/N64F with 2 (green).
The nonclassical analogues 2a-2m were also evaluated as
inhibitors of TS and DHFR (Table 1). In the human TS assay,
all of the nonclassical analogues were reasonably potent
inhibitors with IC50 values ranging from 0.22 to 5.6 μM.
The electronic nature of the substitutent on the side chain
phenyl was an important factor in determining inhibitory
potency. Analogues with electron withdrawing substitutions
on the phenyl ring were more potent than analogues with
electron donating substitutions or the unsubstituted phenyl.
Electron withdrawing 4-nitro, 3,4-dichloro, 3-chloro, and
4-bromo substituents in analogues 2c, 2e, 2k and 2j, respectively,
showed the most potent inhibition against isolated human TS. In
addition, bulky substituents such as the 2-naphthyl (2g) showed
marginal activity against human TS. These data are consistent
with SAR studies previously reported for the C6-methyl analo-
gues.18 The nonclassical analogues 1b, 1c, 1e, 1g, and 1h of the
6-methyl series were potent human TS inhibitors.18 The corre-
sponding 6-ethyl analogues 2b, 2c, 2e, 2g, and 2h of this study
were similar in potency except for 2g, which was about 20-fold
less potent than 1g. This difference in potency may reflect a steric
intolerance of the larger 6-ethyl moiety with an adjacent
naphthyl ring in 2g. Similar to the classical analogue 2, all of
the nonclassical analogues were also more potent than peme-
trexed as inhibitors of human TS. This result indicates that
homologation of a 6-methyl to a 6-ethyl in thieno[2,3-d]pyrimi-
dines maintains potent human TS inhibitory activity.
In the DHFR assay, the nonclassical analogues 2a-2m
were also evaluated as inhibitors of human, E. coli, and
T. gondii DHFR. Against human DHFR, in general 2a-2m
were moderately potent inhibitors with IC50 values ranging
from 0.26 to 2.2 μM and were more potent than the corre-
sponding 6-methyl analogues.18 The most potent nonclassical
analogues contained electron withdrawing groups such as
4-nitrophenyl 2c (IC50 = 0.26 μM) and 4-bromophenyl 2j
(IC50 =0.26 μM) in the 6-ethyl (2a-2m) series. Other sub-
stitutions such as an unsubstituted phenyl 2a (IC50=2.6 μM)
and unsubstituted 2-naphthyl 2g (IC50 = 2.2 μM) cause a
10-fold drop in activity. In addition, compound 2c was the
most potent compound in the nonclassical series, also demon-
strating potent dual inhibitory activities against human TS
(IC50=0.22 μM) and human DHFR (IC50=0.26 μM). The
SAR among these analogues (2a-2m) suggests that potency

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15 4897
Table 1. Inhibitory Concentrations (IC50 in μM) against TS and
Table 2. Cytotoxic Evaluation (GI50, M) of Compounds 1 and 2 against
Selected Tumor Cell Lines
DHFRa
TS (μM)
DHFR (μM)
T.
compd humanb E. colib gondiic humand E. colie gondiic tgf
cell line
GI50 of 1 (M)
GI50 of 2 (M)
T.
rh/
Leukemia
9.45 ꢀ 10-5
CCRF-CEM
HL-60 (TB)
MOLT-4
8.53 ꢀ 10-7
4.97 ꢀ 10-7
4.78ꢀ 10-6
1g
2
0.04
0.054 0.018 0.09
0.04
0.036 0.02
0.019
2.6
0.2
1.0
>33
(10)
42
0.008 2.5
0.0021
0.033 79
>1.00 ꢀ 10-4
9
2a
5.6
28
8.4
Non-Small-Cell Lung Cancer
4.12 ꢀ 10-5
NCI-H460
NCI-H525
NCI-H23
9.59 ꢀ 10-7
7.80 ꢀ 10-6
9.40 ꢀ 10-6
2b
2c
2d
0.75
0.22
4.6
2.5
1.7
2.2
1.0
0.3
0.009 33
0.0087 30
>28 (0) 0.014 60
>1.00 ꢀ 10-4
0.26
0.84
39
>1.00 ꢀ 10-4
>23
(11)
2.3
>23
(29)
1.0
Colon Cancer
>1.00 ꢀ 10-4
>1.00 ꢀ 10-4
2e
2f
0.23
0.69
2.3
0.29
0.28
2.2
22 0.0081 36
>2.8 (0)0.014 20
HCC-2998
HCT-116
9.65 ꢀ 10-7
2.84 ꢀ 10-7
1.2
1.4
1.6
1.1
2g
2h
28
0.0084 262
0.017 21
0.28
2.0
1.7
0.35
>33
(17)
>31
(15)
29
Melanoma
6.56 ꢀ 10-5
LOX IMVI
M14
9.09 ꢀ 10-8
4.32ꢀ 10-6
>1.00 ꢀ 10-4
Ovarian Cancer
2i
1.3
2.9
2.6
0.62
0.025 25
0.013 20
2j
0.39
0.38
1.2
2.2
2.3
1.8
2.0
76
2.2
1.8
2.3
2.5
2.8
0.26
0.3
OVCAR-8
>1.00 ꢀ 10-4
5.79 ꢀ 10-7
2k
2l
>3.0 (0)0.012 25
>27 (0) 0.024 23
>33 (0) 0.027 22
0.54
0.6
Renal Cancer
>1.00 ꢀ 10-4
>1.00 ꢀ 10-4
2m
1.1
786-0
SN12C
8.17 ꢀ 10-7
3.31 ꢀ 10-6
pemetrexedh 9.5
6.6
1.9
230
23
0.43
0.22
15
8.6
PDDFi
MTX
trimethoprimnd
0.085 0.019 0.43
nd
nd
nd
nd
nd
0.02
>340
(22)
0.0088 0.033 0.6
0.01 6.8 >50
The classical analogue 2 was selected by the National
Cancer Institute (NCI) for evaluation in its in vitro preclinical
antitumor screening program. Approximately 60 human can-
cer cell lines of the full NCI panel are grouped into disease
subpanels, including leukemia, non-small-cell lung, colon,
central nervous system (CNS), melanoma, ovarian, renal,
prostate, and breast tumors cell lines. The ability of com-
pound 2 to inhibit the growth of tumor cell lines was measured
as GI50 values, the concentration required to inhibit the
growth of tumor cells in culture by 50% compared to a
control. In 8 of the 60 cell lines, compound 2 showed GI50
values of<10-6 M (Table 2). It was also interesting to note
that compound 2 was not a general cell poison but showed
selectivity both within a type of tumor cell line and across
different tumor cell lines with inhibitory values that in some
instances differed by 1000-fold (data not shown). In addition,
potency of tumor inhibition (GI50) was significantly increased
for 2 over 1 (Table 2) by 100- to 1000-fold, indicating that
homologation of the 6-methyl to the 6-ethyl was instrumental
in increasing the potency as well as the spectrum of tumor
inhibition in culture (Table 2). Thus, the in vitro tumor cell
inhibitory activity of2 was muchsuperior tothatof 1. Possible
explanation for this increased in vivo activity could be the
increased lipophilicity of 2 compared to 1, which could
facilitate passive diffusion and/or active transport of 2 into
tumor cells. This is currently under investigation. Compound
2 is also currently under further evaluation by the NCI as an
antitumor agent.
a The percent inhibition was determined at a minimum of four
inhibitor concentrations within 20% of the 50% point. The standard
deviations for determination of 50% points were within (10% of the
value given. Numbers in parentheses indicate the % inhibition at
the stated concentration. nd=not determined. b Kindly provided by
Dr. Frank Maley, New York State Department of Health. c Kindly
provided by Dr. Karen Anderson, Yale University, New Haven, CT.
d Kindly provided by Dr. J. H. Freisheim, Medical College of Ohio,
Toledo, OH. e Kindly provided by Dr. R. L. Blakley, St. Jude Children’s
Hospital, Memphis, TN. f rh/tg is selectivity ratio for T. gondii DHFR
and is the IC50 against rhDHFR/IC50 against T. gondii DHFR. g Data
derived from ref 18. h Kindly provided by Dr. Chuan Shih, Eli Lilly and
Co. i Kindly provided by Dr. M. G. Nair, University of South Alabama.
for human DHFR is independent of the electronic nature of
the substituent but mono-para-electron-withdrawing substi-
tutionismost favorableforhumanDHFR inhibition. Against
T. gondii DHFR, in general, the nonclassical analogues 2a-
2m were very potent inhibitors with IC50 values ranging from
0.27 to 0.0081 μM. The most potent single digit nanomolar
nonclassical inhibitors contained electron withdrawing groups
such as a 4-chlorophenyl 2b (IC50=0.009 μM), 4-nitrophe-
nyl 2c (IC50 = 0.0087 μM), 3,4-dichlorophenyl 2e (IC50
=
0.0081 μM), and 2-naphthyl 2g (IC50 = 0.0084 μM). The IC50
values of compounds 2b, 2c, 2e, and 2g against T. gondii
DHFR were a remarkable 4-fold more potent than MTX and
were about 840-fold more potent than the clinically used
trimethoprim (Table 1). To our knowledge these are some
of the most potent nonclassical T. gondii DHFR inhibitors
reported. Interestingly, a number of the nonclassical com-
pounds in this series also showed good selectivity for T. gondii
DHFR compared to human DHFR. Compound 2g with a
2-naphthyl substitution was 262-fold more selective for
T. gondii DHFR than human DHFR, which indicated a
distinct species difference in DHFR from different sources.
These results demonstrate that the nonclassical analogues
2a-2m in the 6-ethyl series follow similar trends of dual
inhibition against human TS and DHFR as the 6-methyl
analogues.
In summary, the 5-substituted 2-amino-4-oxo-6-ethylthie-
no[2,3-d]pyrimidine classical antifolate 2 and 13 nonclassical
analogues 2a-2m were designed and synthesized as potential
dual TS-DHFR inhibitors. Compound 2 (TS IC50=54 nM;
DHFR IC50=19 nM) maintained the potent human TS and
DHFR inhibitory activity of 1. More importantly compound
2 significantly increased both the spectrum and the potency of
the inhibition of the growthof tumor cellsin culturecompared
with 1. This increase was clearly not attributable to enzyme
inhibition difference because both 1 and 2 have about the
sameactivity inisolated enzyme assays. Compound2c was the

4898 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15
Gangjee et al.
Figure 6. Stereoview of active site for human DHFR-Q35S/N64S double mutant ternary complex with the inhibitor 2 and NADPH. The
figure was prepared with SYBY 8.0.
most potent compound in the nonclassical series, also demon-
strating potent dual inhibitory activities against human TS
(IC50 =0.22 μM) and human DHFR (IC50 =0.26 μM). In
addition, excellent potency and high selectivity for T. gondii
DHFR compared to human DHFR were observed for all
the analogues. This study indicated that the 5-substituted
2-amino-4-oxo-6-ethylthieno[2,3-d]pyrimidine scaffold is the
most conducive to dual human TS-DHFR inhibitory activity.
The most remarkable finding was that elongation of the
C6-methyl moiety of 2-amino-4-oxo-5-arylthio-substituted
thieno[2,3-d]pyrimidine 1 to the 6-ethyl in 2 increases the
inhibitory potency against the growth of several tumor cells in
culture by 2-3 orders of magnitude and also increases the
spectrum of tumor growth inhibition. These results are cur-
rently under investigation and may reflect transport and/or
other differences between 1 and 2.
Aldrich Chemical Co. or Fisher Scientific and were used as
received.
Ethyl 2-Amino-5-ethylthiophene-3-carboxylate (4). Et3N(4.7g,
0.05 mol) was added to a stirred suspension of ethyl cyanoace-
tate (9.74 g, 90 mmol) and sulfur (2.76 g, 90 mol) in 50 mL of
DMF under a N2 atmosphere. The resulting mixture was stirred
at 55 ꢀC (temperature of bath) for 1 h. Butyraldehyde 3 (6.5 g,
90 mmol) was then added into this suspension dropwise
while maintaining the temperature at 55 ꢀC. After addition,
the mixture was allowed to cool to room temperature and stirred
for 2 h. The mixture was transferred to a separating funnel
containing ethyl acetate (80 mL) and H2O (30 mL). The organic
layer was separated, washed with brine (4 ꢀ 20 mL), and
concentrated under reduced pressure to afford a yellow oil.
The residue was loaded on a column packed with silica gel and
eluted with 5% ethyl acetate in hexanes, and fractions contain-
ing the desired product (TLC) were pooled and evaporated to
afford 8.9 g (56%) of 4 as a yellow solid: mp 70-72 ꢀC; Rf=0.45
1
(ethyl acetate/n-hexane, 1:3); H NMR (DMSO-d6) δ 1.08 (t,
Experimental Section
3 H, J=7.2 Hz), 1.19 (t, 3 H, J=7.2 Hz), 2.48 (q, 2 H, J=7.2 Hz),
4.11 (q, 2 H, J=7.2 Hz), 6.45 (s, 1H), 7.07 (s, 2 H).
Analytical samples were dried in vacuo (0.2 mmHg) in a
CHEM-DRY drying apparatus over P2O5 at 80 ꢀC. Melting
points were determined on a MEL-TEMP II melting point
apparatus with a FLUKE 51 K/J electronic thermometer and
are uncorrected. Nuclear magnetic resonance spectra for proton
(1H NMR) were recorded on a Bruker WH-400 (400 MHz)
spectrometer. The chemical shift values are expressed in ppm
(parts per million) relative to tetramethylsilane as an internal
standard: s, singlet; d, doublet; t, triplet; q, quartet; m, multiplet;
br, broad singlet. Mass spectra were recorded on a VG-7070
double-focusing mass spectrometer or in a LKB-9000 instrument
in the electron ionization (EI) mode. Chemical names follow
IUPAC nomenclature. Thin-layer chromatography (TLC) was
performed on Whatman Sil G/UV254 silica gel plates with a
fluorescent indicator, and the spots were visualized under 254 and
366 nm illumination. Proportions of solvents used for TLC are by
volume. Column chromatography was performed on a 230-400
mesh silica gel (Fisher, Somerville, NJ) column. Elemental ana-
lyses were performed by Atlantic Microlab, Inc., Norcross, GA.
Element compositions are within 0.4% of the calculated values.
Fractional moles of water or organic solvents frequently found
in some analytical samples of antifolates could not be prevented
in spite of 24-48 h of drying in vacuo and were confirmed
where possible by their presence in the 1H NMR spectra. Micro-
wave-assisted synthesis was performed utilizing an Emrys
Liberator microwave synthesizer (Biotage) utilizing capped reac-
tion vials. All microwave reactions were performed with tem-
perature control. All solvents and chemicals were purchased from
2-Amino-6-ethylthieno[2,3-d]pyrimidin-4-(3H)-one (5). Ethyl
2-amino-5-ethylthiophene-3-carboxylate 4 (9.5 g, 47.8 mmol),
carbamimidic chloride hydrochloride (5.5 g, 48.3 mmol), and
25 g of DMSO2 was placed in a 250 mL flask. The reaction
mixture was heated to 120-125 ꢀC under N2 for 2 h. Then H2O
(50 mL) was added to the reaction mixture right away to
quench the reaction. The resulting solution was cooled in an
ice bath, and the pH was adjusted to 8 with dropwise addition of
concentrated NH4OH with stirring. This suspension was left at
5 ꢀC for 3 h and filtered. The residue was washed well with small
amounts of acetone and water and purified by flash chroma-
tography on silica gel (gradient of 2% MeOH/CHCl3 to 5%
MeOH/CHCl3) to afford 8.1 g (86%) of 5 as a yellow solid: mp
126-128 ꢀC; Rf = 0.63 (MeOH/CHCl3, 1:10); 1H NMR
(DMSO-d6) δ 1.20 (t, 3 H, J = 7.6 Hz), 2.71 (q, 2 H, J =
7.6 Hz), 6.45 (s, 2 H), 6.79 (s, 1 H), 10.82 (s, 1 H). Anal.
(C8H9N3OS 0.09CH3COCH3) C, H, N, S.
3
2-Amino-6-ethyl-5-iodothieno[2,3-d]pyrimidin-4(3H)-one (6).
To a suspension of 5 (3.5 g, 17.9 mmol) in 50 mL of glacial
acetic acid at room temperature was added mercuric acetate
(8.5 g, 26.8 mmol). The resulting solution was stirred at 100 ꢀC
for 3 h, then poured into a saturated NaCl (50 mL), and stirred
for 20 min. The solid was collected by filtration, washed with
water (20 mL), hexane (20 mL), and dried to give a dark solid
(5-chloromercury derivative), which was directly used for iodi-
nation reaction without further purification. This dark material
was dissolved in CH2Cl2 (30 mL) containing I2 (6.8 g, 26.8 mmol)

Article
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15 4899
and stirred for 5 h at room temperature. The solvent was
evaporated, and the residue was washed with 2 N NaS2O3 (35 mL)
and dried in vacuo. The crude product was purified by column
chromatography on silica gel with 3% MeOH/CHCl3 as
the eluent to afford 2.4 g (42%) of 6 as a white solid: mp 185-
187 ꢀC; Rf=0.45 (MeOH/CHCl3, 1:5); 1H NMR (DMSO-d6) δ
1.13 (t, 3 H, J=7.6 Hz), 2.67 (q, 2 H, J=7.6 Hz), 6.57 (s, 2 H),
(s, 1 H), 7.20 (s, 1 H), 10.76 (s, 1 H). HRMS (EI) calcd for
C14H11N3OS2Cl2 m/z = 370.9708, found m/z = 370.9720.
2-Amino-6-ethyl-5-(2-naphthylthio)thieno[2,3-d ]pyrimidin-4
(3H)-one (2g). Compound 2g was synthesized as described for 7:
yield 87%; mp 154-156 ꢀC; TLC Rf = 0.51 (CHCl3/MeOH,
5:1); 1H NMR (DMSO-d6) δ 1.12 (t, 3 H, J = 7.2 Hz), 2.86 (q, 2
H, J = 7.2 Hz), 6.59 (s, 2 H), 7.15-7.82 (m, 7 H), 10.74 (s, 1 H).
HRMS (EI) calcd for C18H15N3OS2 m/z = 353.0656, found
m/z = 353.0653.
2-Amino-6-ethyl-5-(pyridin-4-ylsulfanyl)thieno[2,3-d ]pyrimi-
din-4(3H)-one (2h). Compound 2h was synthesized as described
for 7: yield 67%; mp 185-186 ꢀC; TLC Rf = 0.50 (CHCl3/
MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.11 (t, 3 H, J = 7.2 Hz),
2.80 (q, 2 H, J = 7.2 Hz), 6.63 (s, 2 H), 6.92 (d, 2 H, J = 4.8 Hz),
8.28 (d, 2 H, J = 4.8 Hz), 10.83 (s, 1 H). HRMS (EI) calcd for
C13H13N4OS2 m/z = 305.0531, found m/z = 305.0528.
2-Amino-6-ethyl-5-[(4-fluorophenyl)sulfanyl]thieno[2,3-d]pyr-
imidin-4(3H)-one (2i). Compound 2i was synthesized as de-
scribed for 7: yield 75%; mp 194-196 ꢀC; TLC Rf = 0.50
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.12 (t, 3 H, J =
7.2 Hz), 2.84 (q, 2 H, J = 7.2 Hz), 6.59 (s, 2 H), 7.07-7.09 (m, 4
H), 10.77 (s, 1 H). HRMS (EI) calcd for C14H12N3OFS2 m/z =
321.0405, found m/z = 321.0404.
10.93 (s, 1 H). Anal. (C8H8IN3OS 0.34CH2Cl2) C, H, N, I, S.
3
Methyl 4-[(2-Amino-6-ethyl-4-oxo-3,4-dihydrothieno[2,3-d]-
pyrimidin-5-yl)thio]benzoate (7). The microwave reaction vial
was charged with 6 (1.05 g, 3.3 mmol), i-Pr2NEt (1.2 mL, 6.6 mmol),
and 15 mL dry DMF. The mixture was evacuated and backfilled
with nitrogen (three cycles). Catalyst Pd2dba3 (76 mg, 0.08 mmol),
Xantphos (94 mg, 0.16 mmol), and methyl 4-mercaptobenzoate
(1.1 g, 6.6 mmol) were added, and then the reaction mixture
was degassed twice. The reaction mixture was irradiated in a
microwave apparatus at 190 ꢀC, 1 h. After the reaction mixture
was cooled to ambient temperature, the product was filtered, the
filtrate was concentrated, and the crude mixture was purified
by silica gel column chromatography using 2% MeOH in CHCl3
as the eluent. Fractions containing the product (TLC) were
combined and evaporated to afford 0.9 g (76%) of 7 as a white
solid: Rf = 0.47 (MeOH/CHCl3, 1:5); mp 156-158 ꢀC; 1H NMR
(DMSO-d6) δ 1.10 (t, 3 H, J=7.2 Hz), 2.81 (q, 2 H, J=7.2 Hz), 6.61
(s, 2 H), 7.05 (d, 2 H, J=8.4 Hz), 7.77 (d, 2 H, J=8.4 Hz), 10.79 (s,
1 H). HRMS (EI) calcd for C16H15N3O3S2 m/z = 361.0554, found
m/z = 361.0556.
2-Amino-5-[(4-bromophenyl)sulfanyl]-6-ethylthieno[2,3-d]pyr-
imidin-4(3H)-one (2j). Compound 2j was synthesized as de-
scribed for 7: yield 74%; mp 186-187 ꢀC; TLC Rf = 0.51
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.11 (t, 3 H, J =
7.2 Hz), 2.82 (q, 2 H, J = 7.2 Hz), 6.60 (s, 2 H), 6.92 (d, 2 H, J =
6.8 Hz), 7.39 (d, 2 H, J = 6.8 Hz), 10.76 (s, 1 H). HRMS (EI)
calcd for C14H12N3OBrS2 m/z = 380.9611, found m/z =
380.9605.
2-Amino-5-[(3-chlorophenyl)sulfanyl]-6-ethylthieno[2,3-d]pyr-
imidin-4(3H)-one (2k). Compound 2k was synthesized as de-
scribed for 7: yield 72%; mp 186-187 ꢀC; TLC Rf = 0.53
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.14 (t, 3 H, J =
7.2 Hz), 2.87 (q, 2 H, J = 7.2 Hz), 6.62 (s, 2 H), 6.90 (m, 3 H),
2-Amino-6-ethyl-5-(phenylsulfanyl)thieno[2,3-d]pyrimidin-4(3H)-
one (2a). Compound 2a was synthesized as described for 7: yield
87%; mp 215-220 ꢀC; TLC Rf=0.48 (CHCl3/MeOH, 5:1); 1H
NMR (DMSO-d6) δ 1.10 (t, 3 H, J=7.6 Hz), 2.82 (q, 2 H, J=
7.6 Hz), 6.57 (s, 2 H), 6.97-7.24 (m, 5 H), 10.76 (s, 1 H). HRMS
(EI) calcd for C14H13N3OS2 m/z = 303.0500, found m/z =
303.0503.
2-Amino-5-[(4-chlorophenyl)sulfanyl]-6-ethylthieno[2,3-d]pyr-
imidin-4(3H)-one (2b). Compound 2b was synthesized as de-
scribed for 7: yield 81%; mp 174-175 ꢀC; TLC Rf = 0.47
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.11 (t, 3 H,
J=7.6 Hz), 2.82 (q, 2 H, J=7.6 Hz), 6.59 (s, 2 H), 6.98 (d,
2 H, J=8.4 Hz), 7.27 (d, 2 H, J=8.4 Hz), 10.76 (s, 1 H). HRMS
(EI) calcd for C14H12N3OClS2 m/z = 337.0110, found m/z =
337.0093.
7.24 (s, 1H), 10.80 (s,
1 H). HRMS (EI) calcd for
C14H12ClN3OS2 m/z = 337.0119, found m/z = 337.0110.
2-Amino-5-[(3,5-dimethoxyphenyl)sulfanyl]-6-ethylthieno[2,3-
d]pyrimidin-4(3H)-one (2l). Compound 2l was synthesized as
described for 7: yield 83%; mp 151-154 ꢀC; TLC Rf = 0.45
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.14 (t, 3 H, J =
7.6 Hz), 2.89 (q, 2 H, J = 7.6 Hz), 3.67 (s, 3 H), 6.55 (s, 2 H), 6.56
(dd, 1 H, J = 2.4 Hz, J = 8.4 Hz), 6.83 (d, 2 H, J = 2.4 Hz), 6.87
(d, 1 H, J = 8.4 Hz), 10.78 (s, 1 H). HRMS (EI) calcd for
C16H17N3O3S2 m/z = 363.0721, found m/z = 363.0711.
2-Amino-5-[(2-chlorophenyl)sulfanyl]-6-ethylthieno[2,3-d]pyr-
imidin-4(3H)-one (2m). Compound 2m was synthesized as de-
scribed for 7: yield 72%; mp 221-224 ꢀC; TLC Rf = 0.53
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.14 (t, 3 H, J =
7.2 Hz), 2.85 (q, 2 H, J = 7.2 Hz), 6.63 (s, 2 H), 6.90 (m, 4 H),
10.80 (s, 1 H). HRMS (EI) calcd for C14H12ClN3OS2 m/z =
337.0113, found m/z = 337.0110.
4-[(2-Amino-6-ethyl-4-oxo-3,4-dihydrothieno[2,3-d]pyrimidin-
5-yl)thio]benzoic Acid (8). To a solution of 7 (0.72 g, 1.6 mmol) in
MeOH (10 mL) was added 1 N NaOH (32 mL) and the reaction
mixture stirred at room temperature for 18 h until TLC showed
that the reaction was complete. The reaction mixture was
evaporated to dryness under reduced pressure. The residue
was diluted with H2O (5 mL). The resulting solution was
adjusted to pH 4 with 3 N aqueous HCl and then stored at
0 ꢀC for 24 h. The precipitated solid was collected and dried in
vacuo using P2O5 to afford 0.53 g (96%) of 8 as a white powder:
mp 216-218 ꢀC; Rf = 0.34 (MeOH/CHCl3, 1:4); 1H NMR
(DMSO-d6) δ 1.13 (t, 3 H, J = 7.6 Hz), 2.83 (q, 2 H, J = 7.6 Hz),
6.62 (s, 2 H), 7.03 (d, 2 H, J = 8.4 Hz), 7.76 (d, 2 H, J = 8.4 Hz),
2-Amino-6-ethyl-5-[(4-nitrophenyl)sulfanyl]thieno[2,3-d]pyr-
imidin-4(3H)-one (2c). Compound 2c was synthesized as de-
scribed for 7: yield 74%; mp 162-163 ꢀC; TLC Rf = 0.48
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.12 (t, 3 H,
J=7.6 Hz), 2.82 (q, 2 H, J=7.6 Hz), 6.64 (s, 2 H), 7.16 (d,
2 H, J=9.2 Hz), 8.07 (d, 2 H, J=9.2 Hz), 10.83 (s, 1 H). HRMS
(EI) calcd for C14H13N4O3S2 m/z = 349.0429, found m/z =
349.0403.
2-Amino-5-[(2,5-dimethoxyphenyl)sulfanyl]-6-ethylthieno[2,3-
d]pyrimidin-4(3H)-one (2d). Compound 2d was synthesized as
described for 7: yield 82%; mp 178-180 ꢀC; TLC Rf = 0.50
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.08 (t, 3 H, J =
7.2 Hz), 2.77 (q, 2 H, J = 7.2 Hz), 3.52 (s, 3 H), 3.79 (s, 3 H), 5.92
(s, 2 H), 6.58-6.88 (m, 3 H), 10.78 (s, 1 H). HRMS (EI) calcd for
C16H17N3O3S2 m/z = 363.0711, found m/z = 363.0706.
2-Amino-5-[(3,4-dichlorophenyl)thio]-6-ethylthieno[2,3-d]pyr-
imidin-4(3H)-one (2e). Compound 2e was synthesized as de-
scribed for 7: yield 72%; mp 154-116 ꢀC; TLC Rf = 0.48
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.12 (t, 3 H, J =
7.6 Hz), 2.86 (q, 2 H, J = 7.6 Hz), 6.62 (s, 2 H), 6.90 (dd, 1 H, J =
2.4 Hz, J = 8.4 Hz), 7.3 (d, 2 H, J = 2.4 Hz), 7.46 (d, 1 H, J = 8.4
Hz), 10.80 (s, 1 H). HRMS (EI) calcd for C14H11N3OS2Cl2
m/z = 370.9715, found m/z = 370.9720.
2-Amino-5-[(3,5-dichlorophenyl)sulfanyl]-6-ethylthieno[2,3-d]-
pyrimidin-4(3H)-one (2f). Compound 2f was synthesized as
described for 7: yield 74%; mp 176-178 ꢀC; TLC Rf = 0.45
(CHCl3/MeOH, 5:1); 1H NMR (DMSO-d6) δ 1.12 (t, 3 H, J =
7.6 Hz), 2.84 (q, 2 H, J = 7.6 Hz), 6.58 (s, 2 H), 6.98 (s, 1 H), 7.05
10.79 (s, 1 H). Anal. (C15H13N3O3S2 1.94CH3COCH3) C, H,
N, S.
3
Diethyl N-{4-[(2-Amino-6-ethyl-4-oxo-3,4-dihydrothieno[2,3-
d]pyrimidin-5-yl)thio]benzoyl}-L-glutamate (9). To a suspension

4900 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15
Gangjee et al.
Table 3. Data Collection and Refinement Statistics for Human DHFR-NADPH Ternary Complexes for 1 and 2
parameter
Q35S/N64S NADPH-2
Q35K/N64F NADPH-2
wild type NADPH-1
Q35K NADPH-1
data collection
PDB accession no.
space group
3ghc
H3
3ghv
H3
3ghw
H3
3gi2
H3
˚
cell dimensions (A)
84.36, 77.77
SSRL 11-1
1.01
84.21, 78.03
SSRL 11-1
1.20
84.56, 78.05
SSRL 9-2
1.20
84.57, 77.94
SSRL 9-2
1.50
beamline
resolution (A)
˚
˚
wavelength (A)
1.00
1.00
1.00
1.00
Rsym (%)a,b
0.050 (0.162)
0.045 (0.14)
99.8 (95.3)
269 146
50 745
0.058 (0.121)
0.044 (0.10)
100.0 (99.8)
388 944
0.036(2.3)
0.114(4.2)
100.0 (94.0)
839 426
85 159
0.046 (0.29)
0.037 (0.25)
98.9 (98.9)
64 773
Rmerge
completeness (%)a
observed reflections
unique reflections
I/σ(I)
50 446
26.3 (11.2)
5.3 (4.3)
32 939
11.6 (2.5)
2.0 (1.9)
23.0 (10.3)
5.3 (4.3)
15.1 (0.3)
9.9 (4.1)
multiplicitya
refinement and model quality
˚
resolution range (A)
26.0-1.30
48 155
17.0
53.3-1.30
48 184
15.9
22.59-1.24
56 537
18.0
42.30-1.53
29 450
15.7
no. of reflections
R-factorc
Rfree-factord
19.8
1942
18.3
2030
20.0
1933
20.1
1939
total protein atoms
total water atoms
354
13.8
384
14.0
347
18.2
358
18.3
2
average B-factor (A )
˚
rms deviation from ideal
˚
bond lengths (A)
0.009
1.858
0.131
0.029
1.943
0.127
0.009
1.76
0.144
0.010
1.73
0.143
bond angles (deg)
Luzzati
Ramachandran plot
most favored regions (%)
additional allowed regions (%)
generously allowed regions (%)
disallowed regions (%)
97.8
2.2
0.0
0.0
98.9
1.1
98.9
1.1
0.0
0.0
97.8
2.2
0.0
0.0
0.0
0.0
P P
P P
a The values in parentheses refer to data in the highest resolution shell. b Rsym
=
i|Ih,i - ÆIhæ|/
i|Ih,i|, where ÆIhæ is the mean intensity of a set of
h
h
P
P
equivalent reflections. c R-factor = |Fobs - Fcalc|/ Fobs, where Fobs and Fcalc are observed and calculated structure factor amplitudes. d Rfree-factor
was calculated for R-factor for a random 5% subset of all reflections.
of benzoic acid 8 (0.4 g, 1.1 mmol) in DMF (10 mL) at 25 ꢀC was
added N-methylmorpholine (0.12 mL, 1.21 mmol) followed
by 2-chloro-4,6-dimethoxy-1,3,5-triazine (0.21 g, 1.1 mmol),
and the resulting solution was stirred at 25 ꢀC for 2 h. At this
point, N-methylmorpholine (0.12 mL, 1.21 mmol) was added to
this solution followed by L-glutamic acid diethyl ester hydro-
chloride (0.31 g, 1.32 mmol), and the resulting mixture was
stirred at 25 ꢀC for another 4 h until the starting material
8 disappeared (TLC). The reaction solution was evaporated
in vacuo to dryness, and the residue was purified by column
chromatography on silica gel with 5% MeOH in CHCl3 as
the eluent. Fractions containing the product (TLC) were com-
bined and evaporated to afford 0.41 g (70%) of 9 as a white solid:
mp 150-152 ꢀC; Rf = 0.57 (MeOH/CHCl3, 1:5); 1H NMR
(DMSO-d6) δ 1.12-1.17 (m, 6 H), 1.14 (t, 3 H, J = 7.6 Hz),
1.93-2.10 (m, 2 H), 2.39 (m, 2 H), 2.86 (q, 2 H, J = 7.6 Hz), 4.05
(m, 4 H), 4.37 (m, 1 H), 6.61 (s, 1 H), 7.02 (d, 2 H, J = 8.4 Hz),
7.69 (d, 2 H, J = 8.4 Hz), 8.61 (d, 1 H, J = 7.6 Hz), 10.79 (br s,
94%) of as an off-white solid: mp 202-204 ꢀC; Rf = 0.35
(MeOH/CHCl3, 1:4); 6.61 (s, 1 H), 7.02 (d, 2 H, J = 8.0 Hz),
7.69 (d, 2 H, J = 8.0 Hz), 8.61 (d, 1 H, J = 7.6 Hz), 10.79 (br s,
1 H). Anal. (C20H20N4O6S2 0.31CH3COCH3 0.79HCl) C, H,
3
3
N, S.
Construction and Expression of Mutant Human DHFR. Mu-
tations were introduced into the cDNA of human DHFR and
verified by sequencing (Roswell Park Cancer Center, Buffalo,
NY). DNA oligonucleotides were obtained from Integrated
DNA Technologies (Coralville, IA) and used without further
purification.
Mutants in pDS5. Plasmid DNA was purified using the
plasmid mini kit (Qiagen). Mutagenesis was performed using
the QuikChange site-directed mutagenesis kit (Stratagene). All
primers were PAGE purified and were synthesized by Alpha
DNA (Montreal, Quebec) or IDT (Coralville, IA). Primers were
designed according to manufacturer’s recommendations. PCR
reactions were performed according to manufacturer’s recom-
mendations with adjustments made for Tm of corresponding
primers. Primers (50 to 30) are as follows:
1 H). Anal. (C24H28N4O6S2 0.59CH3COCH3) C, H, N, S.
HRMS (EI) calcd for C24H28N4O6S2 m/z = 532.1450, found
m/z = 532.1444.
3
N65F for: GGTTCTCCATTCCTGAGAAGTTTCGACC-
TTTAAAGGGTAG
N65F rev: CTACCCTTTAAAGGTCGAAACTTCTCAG-
GAATGGAGAACC
N65S for: GGTTCTCCATTCCTGAGAAGAGTCGACC-
TTTAAAGGGTAG
N65S rev: CTACCCTTTAAAGGTCGACTCTTCTCAG-
GAATGGAGAACC
Q36K for: CAGATATTTCAAGAGAATGACCACAACC
Q36K rev: GGTTGTGGTCATTCTCTTGAAATATCTG
Q36S for: CAGATATTTCTCGAGAATGACCACAACC
Q36S rev: GGTTGTGGTCATTCTCGAGAAATATCTG
N-{4-[(2-Amino-6-ethyl-4-oxo-3,4-dihydrothieno[2,3-d ]pyr-
imidin-5-yl)thio]benzoyl }-L-glutamic Acid (2). To a solution of 9
(0.35 g, 0.65 mmol) in ethanol (10 mL) was added 1 N NaOH (10
mL), and the mixture was stirred at room temperature for 24 h
until the starting material 9 disappeared (TLC). The reaction
mixture was evaporated to dryness under reduced pressure. The
residue was dissolved in water (3 mL), the resulting solution was
cooled in an ice bath, and the pH was adjusted to 3-4 with
dropwise addition of 3 N HCl. This suspension was left at 5 ꢀC
for 24 h. The precipitated solid was collected by filtration,
washed with brine, and dried in vacuo to afford 2 (0.31 g,

Article
The original wild type human DHFR (pDS5 vector) was used
for PCR and all subsequent mutagenesis experiments. Four
single mutants were created (N65F, N65S, Q36K, Q36S) with
the QuikChange site directed mutagenesis kit following the
manufacturer’s recommended conditions: PCR, 50 ng of
dsDNA template, 100 ng of each primer, 5 mM dNTPs,
2.5U/μL Taq); one cycle of 95 ꢀC for 30 s; 16 cycles of 95 ꢀC
for 30 s, 55 ꢀC for 1 min, 68 ꢀC for 3 min.
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15 4901
multiplicity. The overall completeness of the data was 94.8
ꢀ
˚
and 92.8 for data in the shell between 2.05 and 2.15 A. The data
for the ternary complex were refined to 17.9% for all data and
25.9% for the test data (5%) (Table 3).
The structures were solved by molecular replacement methods
using the coordinates for human DHFR (u072) in the program
Molref.41 Inspection of the resulting difference electron density
maps made using the program COOT42 running on a Mac G5
workstation revealed density for a ternary complex. The final
cycles of refinement were carried out using the program Refmac5
in the CCP4 suite of programs. The Ramachandran conforma-
tional parameters from the last cycle of refinement generated by
PROCHECK43 showed that more than 97% of the residues have
the most favored conformation and none are in the disallowed
regions. Coordinates for these structures have been deposited
with the Protein Data Bank.
The two double mutants (Q35K/N64F and Q35S/N64S) were
created by using parental template DNA having one confirmed
single residue mutation and using primers for the second desired
mutation during PCR.
Expression and Purification of Human DHFR pDS5/Mutant
pDS5. Expression of mutant human DHFR in pDS5 vector in
E. coli BL21 (DE3) was carried out with 200 mL of LB medium
containing 100 μg/mL ampicillin and inoculated with glycerol
stock of human DHFR at 37 ꢀC with shaking at 300 rpm
overnight. Then 1 L of fresh LB/AMP was inoculated with the
200 mL overnight culture. The culture was grown at 37 ꢀC at
300 rpm until the OD600 was 0.8-0.9. Cells were then induced
with 2 mM IPTG overnight at 16 ꢀC (16-18 h) and harvested by
centrifugation at 13000g. Cells were resuspended in 100 mL of
Acknowledgment. This work was supported in part by a
grant from the National Institutes of Health and National
Institute of Allergy and Infectious Diseases (Grant AI069966
to A.G.) and the National Institute of General Medical
Sciences (Grant GM51670 to V.C).
ice-cold M9 salt solution (12.8 g of Na2HPO4 7H20, 3 g of
3
KH2PO4, 0.5 g of NaCl, 1 g of NH4Cl in a volume of 1 L).
Cells were lysed in 100 mL of ice-cold buffer containing 6.8 g
of KH2PO4, 3.7 g of KCl, dissolved in 900 mL of H20. Then
1.0 mL of 1.0 M EDTA was added and the pH adjusted to 7.0
with KOH before bringing the volume to 1 L. Cells were
disrupted by passing through a microfluidizer at 18 000 psi
(Microfluidics, Inc.). The resulting lysate was subjected to
centrifugation for 30 min at 7000g. Ammonium sulfate was
added to supernatant over a period of 60 min to a final
saturation of 85% at 0 ꢀC. Precipitated protein was centrifuged
for 30 min at 7000g and the pellet resuspended in 50 mL of
methotrexate column binding buffer (100 mM KCl, 50 mM
KPO4, pH 7.0). The resulting sample was passed over a 25 mL
methotrexate affinity column. The column was extensively
washed (>5 column volumes of buffer) to remove unbound
protein. DHFR was subsequently eluted in 5 mL fractions by
passing a solution of 4 mM folic acid, 50 mM KPO4, pH 8.0,
over the column. SDS-PAGE was performed on fractions to
determine which contained DHFR. The corresponding frac-
tions were then pooled and dialyzed extensively against DEAE
column buffer (50 mM KPO4, pH 7.5) to remove folic acid from
solution. On the following day the sample was applied to a
120 mL DEAE ion exchange column (GE Healthcare). The
unbound protein fractions (containing DHFR) were collected.
Remaining bound proteins and residual folic acid were eluted
from the column by a linear gradient of DEAE affinity buffer
supplemented with 500 mM NaCl. The column was stripped and
regenerated with 1 column volume of 3 M NaCl. All fractions
were analyzed by SDS-PAGE. Fractions containing highly
pure (>95%) DHFR were pooled, concentrated to 1 mg/mL,
flash-frozen in liquid nitrogen, and stored at -80 ꢀC.
Supporting Information Available: Results from elemental
analysis and high resolution mass spectrometry. This material is
available free of charge via the Internet at http://pubs.acs.org.
References
(1) Chan, D. C. M; Anderson, A. C. Towards Species-Specific Anti-
folates. Curr. Med. Chem. 2006, 13, 377–398.
(2) Hawser, S.; Lociuro, S.; Islam, K. Dihydrofolate Reductase In-
hibitors as Antibacterial Agents. Biochem. Pharmacol. 2006, 71,
941–948.
(3) Gmeiner, H. W. Novel Chemical Strategies for Thymidylate
Synthase Inhibition. Curr. Med. Chem. 2005, 12, 191–202.
(4) Gangjee, A.; Kurup, S.; Namjoshi, O. Dihydrofolate Reductase as
a Target for Chemotherapy in Parasites. Curr. Pharm. Des. 2007,
13, 609–639.
(5) Berman, E. M.; Werbel, L. M. The Renewed Potential for Folate
Antagonists in Contemporary Cancer Chemotherapy. J. Med.
Chem. 1991, 34, 479–485.
(6) Blakley, R. L. Dihydrofolate Reductase. In Folate and Pterins;
Blakley, R. L., Benkovic, S. J., Eds.; Wiley-Interscience: New York,
1984; Vol. I, pp 191-253.
(7) MacKenzie, R. E. Biogenesis and Interconversion of Substituted
Tetrahydrofolates. In Folates and Pterins Chemistry and Biochem-
istry; Blakley, R. L., Benkovic, S. J., Eds.; Wiley: New York, 1984;
Vol. I, pp 255-306.
(8) Petero, G. J.; Kohne, C. H. Fluoropyrimidines as Antifolate
Drugs. Antifolate Drugs Cancer Ther. 1999, 101–145.
(9) Rosowsky, A. Chemistry and Biological Activity of Antifolates. In
Progress in Medicinal Chemistry; Ellis, G. P., West, G. B., Eds.;
Elsevier Science Publishers: Amsterdam, 1989; pp 1-252.
(10) Gangjee, A.; Elzein, E.; Kothare, M.; Vasudevan, A. Classical and
Nonclassical Antifolates as Potential Antitumor, Antipneumocys-
tis and Antitoxoplasma Agents. Curr. Pharm. Des. 1996, 2, 263–
280.
(11) Taylor, E. C.; Kuhnt, D.; Shih, C.; Rinzel, S. M.; Grindey, G. B.;
Barredo, J.; Jannatipour, M.; Moran, R. A Dideazatetrahydrofolate
Analogue Lacking a Chiral Center at C-6, N-[4-[2-(2-Amino-3,4-
dihydro-4-oxo-7H-pyrrolo[2,3-d]pyrimidin-5-y1)ethylbenzoyl]-L-glu-
tamic Acid, Is an Inhibitor of Thymidylate Synthase. J. Med. Chem.
1992, 35, 4450–4454.
Structure Determination and Refinement. The recombinant
proteins were washed in a Centricon-10 with 10 mM HEPES
buffer, pH 7.4, and concentrated to 33.2 mg/mL. The protein
was incubated with NADPH and an excess of the inhibitor for
1 h over ice prior to crystallization using the hanging drop vapor
diffusion method. The reservoir solution contained 100 mM
KPO4, pH 6.9, 60% saturated NH4SO4, 3% v/v ethanol. Protein
droplets contained 100 mM KPO4, pH 6.9, and 30% saturated
NH4SO4. Crystals of both mutant and wild type DHFR com-
plexes grew over several days at 14 ꢀC and are trigonal, space
(12) Jackman, A. L.; Taylor, G. A.; Gibson, W.; Kimbell, R.; Brown,
M.; Calvert, A. H.; Judson, I. R.; Hughes, L. R. ICI D1694, a
Quinazoline Antifolate Thymidylate Synthase Inhibitor That Is a
Potent Inhibitor of L1210 Tumour Cell Growth in Vitro and in
Vivo: A New Agent for Clinical Study. Cancer Res. 1991, 51, 5579–
5586.
(13) Bertino, J. R.; Kamen, B.; Romanini, A. Folate Antagonists. In
Cancer Medicine; Holland, J. F., Frei, E., Bast, R. C., Kufe, D. W.,
Morton, D. L., Weichselbaum, R. R., Eds.; Williams and Wilkins:
Baltimore, MD, 1997; Vol. 1, pp 907-921.
(14) Gibson, W.; Bisset, G. M. F.; Marsham, P. R.; Kelland, L. R.;
Judson, I. R.; Jackman, A. L. The Measurement of Polyglutamate
Metabolites of the Thymidylate Synthase Inhibitor, ICI D1694, in
ꢀ
˚
group H3, and diffracted to 1.3 A resolution. Data were
collected at liquid N2 temperatures on an Rigaku RaxisIV
imaging plate system and then later on beamlines 11-1 and 9-2
at the Stanford Synchrotron Research Laboratory (SSRL)
imaging plate system. The data were processed with using
Mosflm.41 The Rmerge for all data was 0.063 with a 3-fold

4902 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 15
Gangjee et al.
Mouse and Human Cultured Cells. Biochem. Pharmacol. 1993, 45,
863–869.
(15) Sikora, E.; Jackman, A. L.; Newell, D. F.; Calvert, A. H. Forma-
tion and Retention and Biological Activity of N10-Propargyl-5,8-
dideazafolic Acid (CB3717) Polyglutamates in L1210 Cells in
Vitro. Biochem. Pharmacol. 1988, 37, 4047–4054.
(16) Jackman, A. L.; Newell, D. R.; Gibson, W.; Jodrell, D. I.; Taylor,
G. A.; Bishop, J. A.; Hughes, L. R.; Calvert, A. H. The Biochemical
Pharmacology of the Thymidylate Synthase Inhibitor 2-Desami-
no-2-methyl-N10-propargyl-5,8-dideazafolic Acid (IC1 198583).
Biochem. Pharmacol. 1991, 41, 1885–1895.
Therapy; Jackman, A. L., Ed.; Humana Press: Totowa, NJ, 1999; pp
229-241.
(29) Gangjee, A.; Guo, X.; Queener, S. F.; Cody, V.; Galitsky, N.; Luft,
J. R.; Pangborn, W. Selective Pneumocystis carinii Dihydrofolate
Reductase Inhibitors: Design, Synthesis, and Biological Evalua-
tion of New 2,4-Diamino-5-substituted-furo[2,3-d ]pyrimidines. J.
Med. Chem. 1998, 41, 1263–1271.
(30) Gangjee, A.; Jain, H. D.; Kurup, S. Recent Advances in Classical
and Non-classical Antifolates as Antitumor and Antiopportunistic
Infection Agents: Part II. Anticancer Agents Med. Chem. 2008, 8,
205–231.
(17) Nair, M. G.; Abraham, A.; McGuire, J. J.; Kisliuk, R. L.; Galivan,
J. Polyglutamylation as a Determinant of Cytotoxicity of Classical
Folate Analogue Inhibitors of Thymidylate Synthase and Glyci-
namide Ribonucleotide Formyltransferase. Cell. Pharmacol. 1994,
1, 245–249.
(18) Gangjee, A.; Qiu, Y.; Li, W.; Kisliuk, R. L. Potent Dual Thy-
midylate Synthase and Dihydrofolate Reductase Inhibitors: Clas-
sical and Nonclassical 2-Amino-4-oxo-5-arylthio-substituted-6-
methylthieno[2,3-d ]pyrimidine Antifolates. J. Med. Chem. 2008,
51, 5789–5797.
(19) We thank the Developmental Therapeutics Program of the Na-
tional Cancer Institute for performing the in vitro anticancer
evaluation.
(20) Tripos Inc., 1699 South Hanley Road, Suite 303, St. Louis, MO
63144.
(21) Assaraf, Y. G. Molecular Basis of Antifolate Resistance. Cancer
(31) Kovacs, J. A.; Hiemenz, J. W.; Macher, A. M.; Stover, D.; Murray,
H. W.; Shelhamer, J.; Lane, H. C.; Urmacher, U.; Honig, C.;
Longo, D. L.; Parker, M. M.; Nataneon, J. E.; Parrillo, J. E.; Fauci,
A. S.; Pizzo, P. A.; Maeur, H. Pneumocystis carinii pneumonia: A
Comparison between Patients with the Acquired Immunodefi-
ciency Syndrome and Patients with Other Immunodeficiencies.
Ann. Intern. Med. 1984, 100, 68–71.
(32) Klepser, M. E.; Klepser, T. B. Drug Treatment of HIV-Related
Opportunistic Infections. Drugs 1997, 53, 40–73.
(33) Gewald, K. Heterocyclen aus CH-Aciden Nitrilen. VII. 2-Ami-
nothiophene aus R-Oxo-mercaptanen und Methylenaktiven Nitri-
len. Chem. Ber. 1966, 98, 3571–3577.
(34) Gangjee, A.; Qiu, Y.; Kisliuk, R. L. Synthesis of Classical and
Nonclassical 2-Amino-4-oxo-6-benzyl-thieno[2,3-d ]pyrimidines
as Potential Thymidylate Synthase Inhibitors. J. Heterocycl. Chem.
2004, 41, 941–946.
Metastasis Rev. 2007, 26, 153–181.
(35) Taylor, E. C.; Young, W. B.; Chaudhari, R.; Patel, M. Synthesis of
a Regioisomer of N-{4-[2-(2-amino-4(3H)-oxo-7H-pyrrolo[2,3-d ]
pyrimidin-5-yl)ethyl]benzoyl}-L-glutamic Acid (LY231514), an
Active Thymidylate Synthase Inhibitor and Antitumor Agent.
Heterocycles 1993, 36, 1897–1908.
(22) Matherly, L. H.; Hou, Z. Structure and Function of the Reduced
Folate Carrier a Paradigm of a Major Facilitator Superfamily
Mammalian Nutrient Transporter. Vitam. Horm. 2008, 79, 145–
184.
(23) Cao, W.; Matherly, L. H. Structural Determinants of Folate and
Antifolate Membrane Transport by the Reduced Folate Carrier. In
Drug Metabolism and Transport; Lash, L. H., Ed.; Humana Press:
Totowa, NJ, 2005; pp 291-318.
(36) Itoh, T.; Mase, T. A General Palladium-Catalyzed Coupling of
Aryl Bromides/Triflates and Thiols. Org. Lett. 2004, 24, 4587–
4590.
(37) Gangjee, A.; Yu, J.; McGuire, J. J.; Cody, V.; Galitsky, N.; Kisliuk,
R. L.; Queener, S. F. Design, Synthesis, and X-ray Crystal Struc-
ture of a Potent Dual Inhibitor of Thymidylate Synthase and
Dihyhdrofolate Reductase as an Antitumor Agent. J. Med. Chem.
2000, 43, 3837–3851.
(38) Cody, V.; Galitsky, N.; Luft, J. R.; Pangborn, W.; Gangjee, A.;
Devraj, R.; Queener, S. F.; Blakely, R. L. Comparison of Ternary
Complexes of Pneumocystis carinii and Wild Type Human Dihy-
drofolate Reductase with a Novel Classical Antitumor Furo[2,3-d ]
pyrimidine Antifolate. Acta Crystallogr. 1997, D53, 638–649.
(39) Kisliuk, R. L.; Strumpf, D.; Gaumont, Y.; Leary, R. P.; Plante, L.
Diastereoisomers of 5,10-Methylene-5,6,7,8-tetrahydropteroyl-D-
glutamic Acid. J. Med. Chem. 1977, 20, 1531–1533.
(40) Wahba, A. J.; Friedkin, M. The Enzymatic Synthesis of Thymidy-
late. Early Steps in the Purification of Thymidylate Synthetase of
Escherichia coli. J. Biol. Chem. 1962, 237, 3794–3801.
(41) Collaborative Computational Project, Number 4. The CCP4 suite:
programs for protein crystallography. Acta Crystallogr. 1994, D50,
760-763.
(42) Emsley, P.; Cowtan, K. Coot: Model-Building Tools for Molecular
Graphics. Acta Crystallogr. 2004, D60, 2126–2132.
(43) Laskowski, R. A.; MacArthur, M. W.; Moss, D. S.; Thornton, J.
M. PROCHECK: A Program To Check the Stereochemical
Quality of Protein Structures. J. Appl. Crystallogr. 1993, 26,
283–291.
(24) Fry, D. W.; Jackson, R. C. Membrane Transport Alterations as a
Mechanism of Resistance to Anticancer Agents. Cancer Surv. 1986,
5, 47–49.
(25) Schornagel, J. H.; Pinard, M. F.; Westerhof, G. R.; Kathmann, I.;
Molthoff, C. F. M.; Jolivet, J.; Jansen, G. Functional Aspects of
Membrane Folate Receptors Expressed in Human Breast Cancer
Lines with Inherent and Acquired Transport-Related Resistance to
Methotrexate. Proc. Am. Assoc. Cancer Res. 1994, 35, 302.
(26) Wong, S. C.; Zhang, L.; Witt, T. L.; Proefke, S. A.; Bhushan, A.;
Matherly, L. H. Impaired Membrane Transport in Methotrexate-
Resistant CCRF-CEM Cells Involves Early Translation Termina-
tion and Increased Turnover of a Mutant Reduced Folate Carrier.
J. Biol. Chem. 1999, 274, 10388–10394.
(27) Webber, S. E.; Bleckman, T. M.; Attard, J.; Deal, J. G.; Katherde-
kar, V.; Welsh, K. M.; Webber, S.; Janson, C. A.; Matthews, D. A.;
Smith, W. W.; Freer, S. T.; Jordan, S. R.; Bacquet, R. J.; Howland,
E. F.; Booth, C. J. L.; Ward, R. W.; Hermann, S. M.; White, J.;
Morse, C. A.; Hilliard, J. A.; Bartlett, C. A. Design of Thymidylate
Synthase Inhibitors Using Protein Crystal Structures: The Synth-
esis and Biological Evaluation of a Novel Class of 5-Substituted
Quinazolines. J. Med. Chem. 1993, 36, 733–746.
(28) Hughes, A.; Calvert, A. H. Preclinical and Clinical Studies with
the Novel Thymidylate Synthase Inhibitor Nolatrexed Dihy-
drochloride (Thymitaq, AG337). In Antifolate Drugs in Cancer