Small molecule antagonist of leukocyte function associated antigen-1 (LFA-1): Structure-activity relationships leading to the identification of 6-((5 S,9 R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7- triazaspiro[4.4]nonan-7-yl)nico

Article abstract of DOI:10.1021/jm100348u

Leukocyte function-associated antigen-1 (LFA-1), also known as CD11a/CD18 or α_Lβ₂, belongs to the β₂ integrin subfamily and is constitutively expressed on all leukocytes. The major ligands of LFA-1 include three intercellu

Full text of DOI:10.1021/jm100348u

3814 J. Med. Chem. 2010, 53, 3814–3830
DOI: 10.1021/jm100348u
Small Molecule Antagonist of Leukocyte Function Associated Antigen-1 (LFA-1): Structure-Activity
Relationships Leading to the Identification of 6-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-
1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)nicotinic Acid (BMS-688521)†
Scott H. Watterson,*,‡ Zili Xiao,‡ Dharmpal S. Dodd,‡ David R. Tortolani,‡ Wayne Vaccaro,‡ Dominique Potin,§
Michele Launay,§ Dawn K. Stetsko,‡ Stacey Skala,‡ Patric M. Davis,‡ Deborah Lee,‡ Xiaoxia Yang,‡ Kim W. McIntyre,‡
Praveen Balimane,‡ Karishma Patel,‡ Zheng Yang,‡ Punit Marathe,‡ Pathanjali Kadiyala,‡ Andrew J. Tebben,‡
Steven Sheriff,‡ ChiehYing Y. Chang,‡ Theresa Ziemba,‡ Huiping Zhang,‡ Bang-Chi Chen,‡ Albert J. DelMonte,‡
Nelly Aranibar,‡ Murray McKinnon,‡ Joel C. Barrish,‡ Suzanne J. Suchard,‡ and T. G. Murali Dhar‡
‡Bristol-Myers Squibb Research and Development, P.O. Box 4000, Princeton, New Jersey 08543, and §Cerep, 19 Avenue du Quebec, 91951
Courtaboeuf cedex, France
Received March 16, 2010
Leukocyte function-associated antigen-1 (LFA-1), also known as CD11a/CD18 or RLβ2, belongs to the
β2 integrin subfamily and is constitutively expressed on all leukocytes. The major ligands of LFA-1
include three intercellular adhesion molecules 1, 2, and 3 (ICAM 1, 2, and 3). The interactions between
LFA-1 and the ICAMs are critical for cell adhesion, and preclinical animal studies and clinical data from
the humanized anti-LFA-1 antibody efalizumab have provided proof-of-concept for LFA-1 as an
immunological target. This article will detail the structure-activity relationships (SAR) leading to a
novel second generation series of highly potent spirocyclic hydantoin antagonists of LFA-1. With
significantly enhanced in vitro and ex vivo potency relative to our first clinical compound (1), as well as
demonstrated in vivo activity and an acceptable pharmacokinetic and safety profile, 6-((5S,9R)-9-(4-
cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro-[4.4]nonan-7-yl)nicotinic
acid (2e) was selected to advance into clinical trials.
Introduction
consists of a central β-sheet surrounded by R-helices and
two noninteracting binding sites. The MIDAS or metal-ion-
dependent adhesion site is the site that directly interacts with
ICAM. On the opposing end of the I-Domain is the IDAS or I-
Domain allosteric site that indirectly affects the conformation
of the MIDAS site to regulate the affinity of LFA-1. Specifi-
cally, a change in the IDAS site, from a closed to an open
conformation, results in high affinity LFA-1/ICAM-1 inter-
actions.2 The β2-subunit contains an I-like domain, which is
believed to serve a regulatory role and does not participate
directly with the binding of ICAM.2
In vivo studies with anti-LFA-1 antibodies or with LFA-1
deficient mice have demonstrated thatLFA-1playsacriticalrole
in leukocyte extravasation in recruitment models.3 Additionally,
preclinical and clinical data from the humanized anti-LFA-1
antibody efalizumab, which was approved by the FDA in 2003
for the treatment of moderate to severe psoriasis, has provided
proof-of-concept for this target.4 As a consequence, the LFA-1/
ICAM-1 interaction has emerged as an attractive target for
the treatment of immunological disorders such as psoriasis,
rheumatoid arthritis, and solid organ transplantation.3-5
As a result of the strong preclinical and clinical validation,
there has been an intense effort to identify orally active small
molecules that induce a targeted disruption of the LFA-1/
ICAM-1 interaction as potential therapeutic agents. In this
effort, our group6 and others5,7 have disclosed several diverse
chemical series of compounds. NMR and X-ray crystallo-
graphic studies have established that many of these series bind
to the IDAS site (I-Domain allosteric site) of the I-Domain
Integrins are a family of R/β heterodimeric receptors that
mediate cell-cell and cell-extracellular interactions.1 Leuko-
cyte function-associated antigen-1 (LFA-1a), also known as
CD11a/CD18 or RLβ2, belongs to the β2 integrin subfamily
and is constitutively expressed on all leukocyctes.1 The major
ligands of LFA-1 include three members of the immunoglo-
bulin super gene family, intercellular adhesion molecules 1, 2,
and 3 (ICAM 1, 2, and 3). In particular, the interaction between
LFA-1 and ICAM-1 promotes tight adhesion between many
cell types including endothelial cells as well as other leukocytes
and plays a critical role in immunological functions including
leukocyte recruitment and T-cell costimulation.1
LFA-1 is expressed in a low affinity state on unactivated
cells and switches to a high affinity state following cell activa-
tion.2 LFA-1 is composed of twosubunits, an RL-subunit and a
β2-subunit. The RL-subunit contains a seven-bladed propeller
regioninwhichthereisa200aminoacidinserteddomainatthe
N-terminus referred to as the I-Domain.2 The I-Domain
†PDB ID code 3M6F.
*To whom correspondence should be addressed. Phone: 609-252-
6778. Fax: 609-252-7410. E-mail: scott.watterson@bms.com.
aAbbreviations: LFA-1, leukocyte function associated antigen-1;
ICAM, intercellular adhesion molecules; IDAS, I-Domain allosteric
site; HUVEC, human umbilical vein endothelial cells; MLR, mixed
lymphocyte reaction; b.END3, mouse brain endothelial cell line; SFC,
super critical fluid chromatography; hERG, human ether-a-go-go-
related gene; BAL, bronchoalveolar lavage; OVA, ovalvumin; PBMC,
human peripheral blood mononuclear cells; APC, antigen presenting cell.
r
pubs.acs.org/jmc
Published on Web 04/20/2010
2010 American Chemical Society

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3815
Scheme 1a
a Reagents and conditions: (a) sarcosine ethyl ester, NaOH, THF/H2O,
96%; (b) 4-cyanobenzaldehyde, β-alanine, AcOH, reflux, 35% or 4-cyano-
benzaldehyde, pyrrolidine/EtOH, 78 °C 18 h, 85%; (c) N-(methoxymethyl)-
N-(trimethylsilylmethyl)benzylamine, THF, TFA, 0 °C to RT, 18 h, 70%;
(d) 1,2-dichloroethane, 1-chloroethyl chloroformate, 5 °C, to RT, 18 h,
MeOH, reflux, 3 h, 50-85%; (e) Chiralpak-AD column, CO2/MeOH,
∼100% desired enantiomer (>99% ee).
Figure 1
Table 1. In Vitro Potency of Spirocyclic Hydantoin Analoguesc
endothelial cell line (b.END3). It has been reported6b,9 that
small molecule LFA-1 antagonists exhibit a significant dis-
connect with regard to inhibition of human LFA-1 vs rodent
LFA-1, and to that end, 1 exhibited an approximately 8-fold
decrease in potency. Additionally, in support of the role of
LFA-1 in T-cell activation, 1 successfully blocked human
T-cell proliferation in a mixed lymphocyte reaction (MLR)
assay. Previously, we demonstrated that 1 was efficacious
in combination with CTLA-4Ig in a mouse heart-to-ear
transplant model.6b Recently, we reported that 1 was able
to robustly inhibit disease in two preclinical models of
rheumatoid arthritis, a mouse antibody-induced arthritis
(AIA) model and a mouse collagen-induced arthritis (CIA)
model, even though 1 is ∼8-fold less potent against mouse
LFA-1.10 On the basis of its in vitro potency, in vivo
activity, pharmacokinetic profile, and clean safety profile,
compound 1 was advanced into the clinic.
Having identified our first successful antagonist of LFA-1,
we turned our attention to developing a next generation of
spirocyclic hydantoins with enhanced potency. In this article,
we outline the SAR leading to the identification of compound
2e (BMS-688521;11 Figure 1), which demonstrated signifi-
cantly improved potency relative to compound 1.
Chemistry
a IC50 values are shown as mean values of three determinations. b IC50
values are shown as single determinations. c ND = not determined.
The synthetic pathways utilized in the preparation of the
spirocyclichydantoins discussed in Tables 1 and 4 are outlined
in Schemes 1-9. The spirocyclic hydantoin core, 4-((5S,9R)-
3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro-
[4.4]nonan-9-yl)benzonitrile (6), was prepared as outlined in
Scheme 1.6b,11 Knoevenagel condensation of 3 with 4-cyano-
benzaldehyde gave the thermodynamically more stable ben-
zylidene hydantoin 4, which crystallized out of the reaction
mixture as a single diastereomer having the desired E double
bond stereochemistry. A subsequent azomethine ylide cyclo-
addition step with commercially available N-(methoxymethyl)-
N-(trimethylsilylmethyl)benzylamine afforded compound 5 as
a single diasteromer. N-Debenzylation utilizing modified Von
Braun conditions afforded the des-benzyl analogue, which was
located on the RL subunit.6-8 It has been reported that small
molecule antagonists binding to the IDAS site prevent the
conformational changes necessary for the conversion of the
I-Domain from the low affinity, closed conformation to the high
affinity, open conformation, consequently precluding the bind-
ing of ICAM.2a
In an earlier report, we disclosed the structure-activity
relationships (SAR) leading to a novel spirocyclic hydantoin
antagonist (1, BMS-587101; Figure 1) of the LFA-1/ICAM-1
interaction.6b Compound 1 inhibited LFA-1-mediated adhe-
sion of human T-cells to human umbilical vein endothelial
cells (HUVEC) and mouse T-cell adhesion to a mouse brain

3816 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
Scheme 2a
Scheme 4a
a Reagents and conditions: (a) NaN3, Et3N, AcOH, 130 °C, 30%;
(b) Ph3CCl, NaOH, CHCl3, 39%; (c) 6, DIPEA, 118 °C, 12%; (d) TFA,
MeOH.
Scheme 5a
a Reagents and conditions: (a) K2CO3, DMF, 100 °C, 25%; (b) 6,
Pd2(dba)3, biphenyl-2-yldicyclohexylphosphine, t-BuOK, DMA, 85 °C,
41%; (c) 6, Cu(OAc)2, Et3N, CH2Cl2, 100 °C, 14%; (d) 6, Pd2(dba)3,
biphenyl-2-yldicyclohexylphosphine, t-BuOK, DMA, 85 °C, 8%; (e) 6,
Pd2(dba)3, BINAP, DIPEA, 90 °C, 33%.
Scheme 3a
a Reagents and conditions: (a) 6, DIPEA, DMF, 100 °C, 86%; (b) 1 M
aq KOH, 1,2-propanediol, THF, H2O, 28%.
Scheme 6a
a Reagents and conditions: (a) SOCl2; t-BuOH, CH2Cl2, Et3N,
DMAP, 70%; (b) 6, DIPEA, DMA, 112 °C, 77%; (c) TFA, DCM, 86%.
a Reagents and conditions: (a) 6, DIPEA, DMF, 100 °C, 81%; (b) LiI,
DMA, 140 °C, 42%.
separated into its individual enantiomers using a Chiralpak-AD
column under supercritical fluid chromatography (SFC)
conditions to give 6. The intermediate 6 was determined to
have >99% enatiomer excess, with the spirocyclic carbon
assigned as (S) and the carbon bearing the 4-cyanophenyl
residue assigned as (R), and was used as an intermediate for
the preparation of all compounds discussed in this article.
Analogues 2a-d and 2k were prepared as outlined in
Scheme 2. Spirocyclic hydantoin 6 and 2-bromopyidine were
heated at 100 °C in dimethylformamide in the presence of
potassium carbonatetogive2a. Analogues2b, 2d, and2kwere
prepared via a Buchwald coupling12 with either the appro-
priate bromo- or chloropyridine. A Chan-Lam coupling13
between 4-cyanoboronic acid and 6 afforded 2c. Analogue 2e
was prepared as depicted in Scheme 3.11 6-Nicotinic acid was
protected as a tert-butyl ester (7) in 70% yield. Heating of 7
with intermediate 6 at 112 °C in dimethylacetamide in the
presence of diisopropylethylamine afforded tert-butyl ester 8
in 77% yield. The ester was subsequently hydrolyzed with tri-
fluoroacetic acid to give 2e in 86% yield. The carboxylic acid
isostere, tetrazole 2f, was prepared as outlined in Scheme 4.
Analogues 2g-i and 2p-t were prepared as outlined in
Scheme 5 for the preparation of 2h. Spirocyclic hydantoin
intermediate 6 was heated in either dimethylformamide or
dimethylacetamide with the appropriate chloro-, bromo-, or
methylsulfone-substituted heteroaryl substrate, additionally
substituted with a methyl or ethyl ester, at 95-110 °C to
provide the intermediate esters in yields ranging from 28 to
97%. Subsequent hydrolysis of the ester with 1.0 M aqueous
potassium hydroxide and 1,2-propanediol in a mixture of
tetrahydrofuran and water afforded the desired analogues in
yields ranging from 8 to 70%. The chloro-, bromo-, and
methylsulfone-substituted heteroaryl substrates were com-
mercially available, prepared as described in the literature,
or synthesized as depicted in Scheme 9.

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3817
Scheme 9a
Scheme 7a
a Reagents and conditions: (a) 6, neat, 96 °C, 37%; (b) LiI, DMA,
140 °C, 86%.
Scheme 8a
a Reagents and conditions: (a) H2SO4, MeOH, reflux; (b) POCl3;
(c) urea, 100 °C, 40%; (d) t-BuONO, CuCl2, MeCN, 65 °C, 66%;
(e) SOCl2, MeOH, 65%; (f) NaNO2, H2SO4, H2O, 71%; (g) POCl3,
110 °C; (h) t-butyl nitrite, CuBr2, MeCN.
APC-dependent T-cell proliferation was evaluated in vitro
using a one-way mixed lymphocyte reaction (MLR) assay
(see Experimental Section for details). In contrast to the
adhesion assay, the MLR assay was conducted in the presence
of 10% serum.
Results and Discussion
The X-ray co-crystal structure of spirocyclic hydantoin 1
with the I-Domain of LFA-1 (Figure 2) revealed that the
compound binds to the I-Domain allosteric site (IDAS).6b
Additionally, the X-ray co-crystal structure revealed that
most of the interactions of the ligand with the protein are
hydrophobic in nature with the p-cyanophenyl aromatic ring
forming a favorable edge-to-edge face π-π interaction with
the N-3 3,5-dichlorophenyl ring in the pocket. The dichloro-
phenyl group itself occupies a hydrophobic pocket between
R-helices 1 and 7 and β-strands 1, 3, and 4. The urea carbonyl is
hydrogen-bonded to the amino acid residues Lys 287, Lys 305,
and Glu 284 via a water molecule. Unlike the urea, the amide
carbonyl does not appear to make any discernible contacts
with the protein. As is evident from the crystal structure,
the thiophene carboxylic acid moiety is projected into solvent
and does not appear to interact with any residues in the
I-Domain.
Since extensive SAR suggested that the 2,5-dichlorophenyl,
N-methyl, and 4-cyanophenyl moieties are optimal,6b we
decided to focus on modulating potency, physiochemical
properties, and liability profiling parameters with further
modifications to the substitution on the spirocyclic pyrro-
lidine nitrogen. In particular, we reasoned based on the
X-ray co-crystal structure that a heteroaryl group directly
appended to the pyrrolidine nitrogen would engage in a
hydrogen-bonding interaction with Tyr 257 (Figure 2) and
improve potency compared to compound 1. As seen in
Table 1, our initial investigation into this hypothesis led
to some promising results. The simple 1-pyridyl substituted
derivative (2a) showed similar potency in both the T-cell/
HUVEC adhesion assay (IC50 = 11 nM) and the MLR T-cell
proliferation assay (IC50 = 200 nM) relative to our first
a Reagents and conditions: (a) neat, 108 °C, 72%; (b) DMF, reflux,
55%; (c) POCl3, 128 °C; (d) NaOH (25% aq), 98%; (e) SOCl2; t-BuOH,
DMAP, Et3N, 10% (f) 6, DIPEA, DMA, 112 °C, 50%; (g) TFA,
CH2Cl2, 76%.
Analogues2o,2u,and2vwere prepared as showninScheme6
for the preparation of2o. Spirocyclic hydantoin intermediate 6
was heated in either dimethylformamide or dimethylacet-
amide with the appropriate chloro-substituted heteroaryl sub-
strate, additionally substituted with a methyl or ethyl ester, at
100-110 °C to provide the intermediate esters in yields rang-
ing from 31 to 81%. Subsequent hydrolysis of the ester with
either lithium iodide or lithium chloride in dimethylform-
amide, dimethylacetamide, or N-methyl-2-pyrrolidinone at
115-140 °C afforded the desired analogues in yields ranging
from 39 to 86%. The chloro- and bromo-heteroaryl substrates
were commercially available, prepared as described in the
literature, or synthesized as depicted in Scheme 9.
Analogues 2j was prepared as outlined in Scheme 7. Spiro-
cyclic hydantoin intermediate 6 was heated neat with com-
mercially available methyl 2-chloroisonicotinate at 96 °C to
give the intermediate ester (15) in 37% yield. Subsequent
hydrolysis of the ester with lithium iodide in dimethylacet-
amide at 140 °C afforded 2j in 86% yield. Compound 2n was
prepared as depicted in Scheme 8.
Compounds outlined in Tables 1 and 4 were evaluated
for LFA-1 mediated adhesion in a cell-cell based adhesion
assay employing primary human T-cells and human umbilical
vein endothelial cells (HUVEC) (see Experimental Section
for details). Additionally, the activity of compounds on

3818 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
Table 2. Partial in Vitro Profiling Data for Compound 2ea
parameter
result
protein binding
mutagenicity
95% in human serum
Ames negative
hERG (patch clamp)
Purkinje fiber
CYPa inhibition (IC50
Caco2 permeability
(apical to basolateral)
20% inhibition @ 30 μM
<5% @ 30 μM
>35 μM 1A2, 2C9, 2D6, 2C19, 3A4
148 nm/s
)
a CYP = cytochrome P450.
Table 3. Partial in Vitro Selectivity Data for Compound 2e
assay
selectivity
inhibition
THP-1 adhesion to i3Cb
Jurkat: CS-1 adhesion
platelet aggregation
adenosine diphosphate
collagen
Mac-1
VLA-4
R2β3
18% @ 10 μM
0% @ 10 μM
0% @ 30 μM
0% @ 30 μM
action but would also result in a more electron deficient
nitrogen atom relative to the 2-pyridyl derivative, resulting
in a less favorable hydrogen-bonding interaction.
Figure 2. X-ray crystal structure of compound 1 bound to the
I-Domain of LFA-1. Also shown is the initial electron density prior
to fitting the compound (magenta 2Fo - Fc contoured at 1σ and
cyan: Fo - Fc contoured at 6σ, which indicates the positions of the
chlorine atoms).
Although compound 2b was very promising, it was sub-
optimal with respect to liability profiling and physiochemical
properties. As we have found in our previous SAR around the
pyrrolidine based spirocyclic hydantoin class,6b incorporation
of a carboxylic acid or carboxylic acid isostere resulted in
zwitterionic compounds with optimal physiochemical proper-
ties and acceptable liability profiles (e.g., CYP inhibition,
hERG, metabolic stability). Interestingly, the 4-carboxylic
acid substituted 2-pyridine derivative (2e) was prepared and
was found to be a highly potent inhibitor of the LFA-1/ICAM
interaction with an IC50 of 2.5 nM in the adhesion assay and
an IC50 of 60 nM in the MLR assay. This represented a 4-8-
fold improvement in in vitro potency when compared to the
initial program lead, 1.
The X-ray co-crystal structure of 2e bound to the I-Domain
of LFA-1(Figure3) revealed thatthe carboxylic acid moiety is
involved in a hydrogen-bonding interaction with the Thr 231
residue in the active site. The X-ray co-crystal structure also
revealed that the pyridyl nitrogen is engaged in a hydrogen-
bonding interaction with a water molecule that is in proximity
to the Tyr 257 residue, although the distance between the
˚
Figure 3. X-ray crystal structure of compound 2e bound to the
I-Domain of LFA-1. Also shown is the initial electron density prior
to fitting the compound (magenta 2Fo - Fc contoured at 1σ and
cyan: Fo - Fc contoured at 6σ, which indicates the positions of the
chlorine atoms).
water molecule and the residue was measured to be 3.7 A in
this crystal form, which is somewhat long for a typical
˚
hydrogen-bond length of 3.3 A. All other interactions seen
in the X-ray co-crystal structure of 1 are conserved. The ∼5-
fold loss in potency observed with the 4-cyanophenyl (2c)
versus the 4-cyano-2-pyridyl (2b) would suggest that in a fully
functioning protein, in an in vitro setting, the pyridyl nitrogen
is potentially engaging in a hydrogen-bonding interaction with
Tyr 257. Further analysis of the co-crystal structure of 2e with
molecular modeling suggests that a very small movement of
either the water molecule or Tyr 257 does result in a hydrogen-
bonding interaction with the pyridyl nitrogen. In considering
the surprising activity seen with the 4-cyano-3-pyridyl analo-
gue 2d, a search of the Protein Data Bank (PDB) revealed that
there are a number of examples of a pyridyl C-H alpha to the
nitrogen interacting with a water molecule. It appears that the
acidity of that hydrogen is sufficient enough to allow for an
effective hydrogen-bond relative to the 4-cyanophenyl deriva-
tive (2c). Interestingly, by reducing the distance between the
amino and the acid portions of the zwitterion, we have been
able with 2e to uncover a significant binding opportunity with
clinical candidate (1). Addition of a 4-cyano substituent
onto the pyridyl derivative (2b) maintained potency in the
adhesion assay (IC50 = 11 nM) but resulted in a 3-fold
increase in potency in the MLR assay. To understand the
impact of the pyridyl nitrogen, the 4-cyanophenyl deriva-
tive was prepared (2c) and was found to be ∼5-fold less
potent than 2b in the adhesion assay with an IC50 of 60 vs
11 nM, respectively, thus suggesting that the pyridyl nitrogen
is likely involved in a hydrogen-bonding interaction with Tyr
257. To further explore the effects of the pyridyl nitrogen, the
4-cyano-3-pyridine derivative (2d) was prepared. As shown in
Table 1, 2d showed similar potency as 2b with an IC50 of
12 nM in the adhesion assay and an IC50 of 140 nM in the
MLR assay. This was surprising since one would expect that
moving the pyridyl nitrogen adjacent to cyano group would
not only affect the geometry of the hydrogen-bonding inter-

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3819
Table 4. In Vitro Potency of Spirocyclic Hytantoin Analoguesa
a IC50 values are shown as mean values of at least three determinations. ND = not determined.
the potential for a second, thus accounting for the observed
increase in in vitro potency.
adjacent carbon would betolerated and wouldstill engage Thr
231. Aspredicted, moving the carboxylicacidtothe5-position
of the pyridine ring (2j) demonstrated equipotent activity
relative to 2e. However, when the nitrogen was moved to
the 4-postion (2k), a loss in potency was observed. Com-
pounds 2n and 2o represent an effort to structurally constrain
the position of the pyridyl nitrogen and the carboxylic acid
and to explore regions of the binding pocket. We rationalized
that a small group adjacent to the carboxylic acid residue in 2e
might provide enhancements to the in vitro potency through
restricted rotation of the carbonyl of the carboxylic acid, thus
As expected, 2e had a clean liability profile, as outlined in
Table 2, as well as acceptable selectivity relative to other
related integrins (Table 3). On the basis of the new X-ray
crystallographic data, excellent in vitro potency, and a clean
partial profile for 2e, we turned our attention to further
exploring and optimizing these interactions, as outlined in
Table 4. As expected, the tetrazole carboxylic isostere (2f) was
equipotent. Structural modeling based on the X-ray co-crystal
structure suggested that moving the carboxylic acid to the

3820 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
Table 6. Pharmacokinetic Parameters for Compound 2ea
Table 5. aComparison of 2e and 1 (BMS-587101) in a Human IL-2
Whole Blood ex Vivo Assay
parameter
mouse
rata
doga
po dose (mg/kg)
iv dose (mg/kg)
5b
5b
1
5b
1
1
C
max (μM), PO
Tmax (μM), PO
AUC (μM h), PO
0.32
1.0
1.5
1.6
1.7
50
2.3 ( 1.4
1.7 ( 0.60
13 ( 8.1
3.3 ( 0.80
3.5 ( 0.90
11 ( 5.6
2.3 ( 1.1
82
22 ( 4.9
2.9 ( 2.0
102 ( 32
4.7 ( 0.70
6.9 ( 0.80
0.50 ( 0.10
0.20 ( 0.10
48
3
T1/2 (h), iv
MRT (h), iv
Cl (mL/min/kg), iv
V
ss (L/kg), iv
po (%)
5.1
50
F
a Average ofthree animals withassociated standard deviation. b Vehicle:
PEG400/0.1 M phosphate buffer (80/20 v/v).
a IC50 values are shown as mean values of at least three determinations.
optimizing the Thr 231 interaction. Interestingly, both deri-
vatives were ∼4 fold less potent than 2e.
Other carboxylic acid substituted six-membered hetero-
cycles were explored including pyrimidines (2g, 2l, 2m), a
pyrazine (2h), and a pyridazine (2i), as seen in Table 4. With
the exception of compound 2m, incorporation of a second
nitrogen into the six-membered heterocycle (2l, 2g-i) led to
a >4-fold decrease in activity in the adhesion assay. On the
basis of modeling studies, we had anticipated that the second
nitrogen in the pyrimidine analogue (2g) might engage in an
interaction with another Tyr residue (Tyr 166). Five-membered
heterocycles were also explored. Thiazole 2p was found to
be a highly potent antagonist in both the adhesion and MLR
assays (5.0 and 170 nM, respectfully), although less optimized
than 2e. The oxazole derivative 2q was substantially less potent
than 2p, with an IC50 of 58 nM in the cell adhesion assay.
In continuing to leverage the X-ray co-crystal data from 2e,
we began to reason that carboxylic acid substituted bicyclic
heterocycles would also be effective in engaging the Thr 231
interaction. With the support of molecular modeling, bicycles
2r-v were prepared and evaluated, as seen in Table 4. As pre-
dicted, the 7-carboxylic acid benzoxazole 2r and the 7-carboxy-
lic benzothiazole 2u demonstrated similar activity to that of lead
2e in the adhesion and the MLR assays. As exemplified by
compounds 2s, 2t, and 2v, relocating the acid residue to either
the 5- or 6-position of the bicycle maintained potency in the
adhesion assay, although a 4- to 7-fold decrease in activity in the
MLR assay was observed.
Figure 4. Efficacy of 2e (1, 3, and 10 mg/kg) vs vehicle in a mouse
allergic eosinophilic lung inflammation model. Mice (n = 8/group)
were immunized with OVA IP on day 0, boosted on day 14, and
challenged on day 28; 2e was administered PO/BID for 3 days
starting on day 28. Vehicle: PEG400/0.1 M phosphate buffer (80/20
v/v). M17 is an anti-LFA-1 monoclonal antibody. *p value <0.05
compared to vehicle treatment group.
inhibition of human LFA-1 vs rodent LFA-1. As a result of
this cross species disconnect, we evaluated 2e in a mouse-
specific adhesion assay that employed mouse splenocytes
and a mouse ICAM-1 expression cell line, b.END3. The
original clinical candidate, 1, was found to show activity in
this assay with an IC50 of 150 nM. This represents a 7- to
9-fold decrease in activity when compared to the results of
the human T-cell/HUVEC adhesion assay data (IC50
=
20 nM). As seen in Table 5, 2e was found to have an IC50
of 78 nM, representing an approximately 30-fold decrease
in activity relative to the human T-cell/HUVEC assay data
(IC50 = 2.5 nM).
Although we prepared several highly potent antagonists of the
LFA-1/ICAM-1 interaction, spirocyclic hydantoin 2e demon-
strated optimal in vitro potency with a desirable in vitro liability
profile and was selected as our lead candidate. Compound 2e was
compared with 1 in a human IL-2 whole blood ex vivo assay
where the level of IL-2 mRNA is assessed (Table 5). This assay
was conducted on heparinized human whole blood that had been
activated with SEB. This response can be blocked with anti-
LFA-1 antibody, demonstrating that IL-2 production is LFA-1
dependent. IL-2 mRNA levels were determined based on the
RNA isolated from activated cells at 6 h post stimulation. In this
ex vivo assay, 2e was found to be 4-fold more potent than 1 (IC50
of 65 vs 276 nM; Table 5), which is consistent with the MLR data.
As previously mentioned, small molecule LFA-1 antago-
nists exhibit a significant disconnect with regard to the
On the basis of its exceptional in vitro potency and clean
profile, spirocyclic hydantoin 2e was evaluated in vivo. In
pharmacokinetic (PK) studies in mice, rats, and dogs (Table 6),
bioavailabilities were around 50% or higher and half-lives
ranged from 1.6-4.7 h. On the basis of its excellent in vitro
potency, reasonable mouse LFA-1 antagonist activity, and its
acceptable mouse PK profile, sprirocyclic hytantoin 2e was
evaluated in a mouse allergic eosinophilic lung inflammation
model. The ability of 2e to block eosinophil accumulation in
the airways of the lung, as measured in bronchoalveolar lavage
(BAL) fluid, was evaluated in ovalvumin (OVA)-sensitized
and challenged BALB/c mice. Mice were given OVA intraper-
itoneally (IP) on day 0, boosted on day 14, and given an
intranasal challenge with OVA on day 28. Compound 2e was
given at doses of 1, 3, and 10 mg/kg, PO, BID for a three-day

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3821
duration following OVA challenge. Lungs were then lavaged
and the cells quantified. Significant inhibition (p < 0.05 versus
vehicle) of eosinophil accumulation was seen at a dose of
1 mg/kg BID (Figure 4), with dose-dependent inhibition at
3 mg/kg and 10 mg/kg. These results with 2e approxi-
mate those seen with 16b and the antimouse LFA-1 anti-
body, M17.
UV detection was set to 220/254 nm. The LC column was
maintained at ambient temperature.
Method B. A linear gradient using 5% acetonitrile, 95%
water, and 0.05% TFA (solvent A) and 95% acetonitrile, 5%
water, and0.05%TFA (solventB);t=0 min, 10%B;t =15min,
100% B (20 min.) was employed on a XBridge Ph 3.5 μ 4.6 mm ꢀ
150 mm column. Flow rate was 1.0 mL/min and UV detection
was set to 220/254 nm. The LC column was maintained at
ambient temperature.
Method C. A linear gradient using water/TFA (100/0.05)
(solvent A) and acetonitrile/TFA (100/0/05) (solvent B); t =
0 min, 10% B; t = 35 min, 95% B (40 min.) was employed on
a Luna C18(2) 0.46 cm ꢀ 15 cm, 3 μ column. Flow rate was
1.0 mL/min and UV detection was set to 220 nm. The LC
column was maintained at ambient temperature.
Method D. A linear gradient using 10% methanol, 90%
water, and 0.2% H3PO4 (solvent A) and 90% methanol, 10%
water, and 0.2% H3PO4 (solvent B); t = 0 min, 0% B; t = 4 min,
100% B (5 min.) was employed on a Chromolith SpeedROD
4.6 mm ꢀ 50 mm column. Flow rate was 4.0 mL/min and UV
detection was set to 220 nm. The LC column was maintained at
ambient temperature.
Method E. A linear gradient using 10% methanol, 90% water,
and 0.2% H3PO4 (solvent A) and 90% methanol, 10% water,
and 0.2% H3PO4 (solvent B); t = 0 min, 0% B; t = 4 min, 100%
B (5 min) was employed on a YMC ODS 4.6 mm ꢀ 50 mm
column. Flow rate was 4.0 mL/min and UV detection was set to
220 or 254 nm. The LC column was maintained at ambient
temperature.
Method F. A linear gradient using 10% methanol, 90% water,
and 0.2% H3PO4 (solvent A) and 90% methanol, 10% water,
and 0.2% H3PO4 (solvent B); t = 0 min, 0% B; t = 8 min, 100%
B (11 min) was employed on a Zorbax Rapid Res 3.5 μ 4.6 mm ꢀ
50 mm column. Flow rate was 2.5 mL/min and UV detection
was set to 220 nm. The LC column was maintained at ambient
temperature.
Method G. A linear gradient using 10% methanol, 90%
water, and 0.1% TFA (solvent A) and 90% methanol, 10%
water, and 0.1% TFA (solvent B); t = 0 min, 0% B; t = 4 min,
100% B (5 min) was employed on a Phenomenex Phenom-Prime
4.6 mm ꢀ 50 mm column. Flow rate was 4.0 mL/min and UV
detection was set to 220 or 254 nm. The LC column was
maintained at ambient temperature.
Conclusion
In summary, a novel second generation series of spirocyclic
hydantoin antagonists of LFA-1 have been identified. Through
exploring carboxylic acid substituted heterocycles appended to
the pyrrolidine ring of the spirocyclic hydantoin core, we have
been able to uncover a new structural interaction with Thr 231
and a potential second interaction with Tyr 257, as determined
by the X-ray co-crystal of 2e with the I-Domain of LFA-1. SAR
studies led to multiple highly potent antagonists of LFA-1. On
the basis of in vitro and ex vivo potency, in vivo activity, and
pharmacokinetic and safety profiles, 6-((5S,9R)-9-(4-cyano-
phenyl)-3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-tri-
azaspiro[4.4]nonan-7-yl)nicotinic acid (2e) was selected as a
lead compound. With the additional binding interactions,
compound 2e was found to have an approximately 4- to
8-fold improvement in human in vitro potency, a 4-fold
improvement in a human IL-2 whole blood ex vivo assay,
and a 2-fold higher free fraction relative to 1. Compound 2e
was efficacious at a dose of 1 mg/kg BID in a mouse allergic
eosinophilic lung inflammation model. On the basis of its
preclinical profile and potential for improved efficacy in
humans over 1, spirocyclic hydantoin 2e was advanced into
clinical trials.
Experimental Section
Proton magnetic resonance (1H) spectra were recorded on
either a Bruker Avance 400 or a JEOL Eclipse 500 spectrometer
and are reported in ppm relative to the reference solvent of the
sample in which they were run. HPLC and LCMS analyses were
conducted using a Shimadzu SCL-10A liquid chromatograph
and a SPD UV-vis detector at 220 or 254 nm with the MS
detection performed with either a Micromass Platform LC
spectrometer or a Waters Micromass ZQ spectrometer. Prepara-
tive reverse-phase HPLC purifications were performed using the
following conditions: YMC S5 ODS 20 mm ꢀ 100 mm column
with a binary solvent system where solvent A = 10% methanol,
90% water, 0.1% trifluoroacetic acid and solvent B = 90%
methanol, 10% water, and 0.1% trifluoroacetic acid, flow rate =
20 mL/min, linear gradient time = 10 min, start %B = 20, final
%B = 100. Fractions containing the product were concentrated
in vacuo to remove the methanol and neutralized with aqueous
sodium bicarbonate. The pH was adjusted to ∼4.5-5.0, and the
aqueous layer was extracted with organic solvents. The organic
layer was collected, dried over anhydrous sodium sulfate or
magnesium sulfate, and concentrated under reduced pressure.
All flash column chromatography was performed on EM Science
silica gel 60 (particle size of 40-60 μm). All reagents were
purchased from commercial sources and used without further
purification unless otherwise noted. All reactions were performed
under an inert atmosphere.
4-((5S,9R)-3-(3,5-Dichlorophenyl)-1-methyl-2,4-dioxo-7-(pyridin-
2-yl)-1,3,7-triazaspiro[4.4]nonan-9-yl)benzonitrile (2a). A mixture of
6 (0.100 g, 0.240 mmol), potassium carbonate (0.037 mg, 0.270
mmol), and 2-bromopyridine (0.025 mL, 0.260 mmol) was heated
at 100 °C in dimethylformamide (1.0 mL) for 20 h. After cooling
to room temperature, the insoluble salts were removed and the
filtrate was partitioned between water and ethyl acetate. The
aqueous layer was extracted with ethyl acetate, and the combined
organic layers were washed with brine, concentrated under
reduced pressure, and purified by flash silica gel chromatography
to yield 2a (30 mg, 25%) as a white solid. HPLC purity 97.1%;
tr = 10.86 min (method A); 95.9%; tr = 12.30 min (method B).
LCMS (EI) m/z Calcd for C25H19Cl2N5O2 [M þ H]þ 492.10.
1
Found: 492.10. H NMR (500 MHz, CDCl3) δ 3.24 (s, 3H),
3.95-4.30 (m, 5H), 6.50 (m, 1H), 6.70 (m, 1H), 6.79 (m, 2H), 7.10
(m, 1H), 7.39 (m, 2H), 7.70 (m, 3H), and 8.22 (m, 1H).
6-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-meth-
yl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)nicotinonitrile (2b).
A mixture of 6 (0.083 g, 0.200 mmol), 6-chloro-nicotinonitrile
(0.040 g, 0.290 mmol), tris(dibenzylideneacetone)dipalladium-
(0) (0.046 g, 0.050 mmol), biphenyl-2-yldicyclohexylphosphine
(17.5 mg, 0.050 mmol), potassium t-butoxide (0.042 g, 0.380
mmol), and dimethylformamide (3.0 mL) was flushed well with
nitrogen. The mixture was stirred at 85 °C overnight and then
purified by preparative HPLC to provide 2b (0.042 g, 41%) as a
yellow solid. HPLC purity 99.1%; tr = 15.97 min (method A);
99.1%; tr = 15.28 min (method B). LCMS (EI) m/z Calcd for
HPLC analyses were performed using the following condi-
tions. All final compounds had an HPLC purity of g95% unless
specifically mentioned.
Method A. A linear gradient using 5% acetonitrile, 95%
water, and 0.05% TFA (solvent A) and 95% acetonitrile,
5% water, and 0.05% TFA (solvent B); t = 0 min, 10% B;
t = 15 min, 100% B (20 min.) was employed on a SunFire C18
3.5 μ 4.6 mm ꢀ 150 mm column. Flow rate was 1.0 mL/min and

3822 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
1
C26H18Cl2N6O2 [M þ H]þ 517.09. Found: 517.12. H NMR
crude product was dried and purified by flash silica gel chromato-
graphy using a mixture of ethyl acetate and dichloromethane
(5-10%) to give tert-butyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)nicotinate (8) as yellow solid (15.8 g, 77%). HPLC tr = 3.91
min (method E). LCMS (EI) m/z Calcd for C30H27Cl2N5O4
(500 MHz, CDCl3) δ 3.24 (s, 3H), 3.94-4.04 (m, 2H), 4.09-4.22
(m, 2H), 4.34 (t, J = 11.0 Hz, 1H), 6.51 (d, J = 8.80 Hz, 1H),
6.80 (s, 2H), 7.29 (s, 1H), 7.38 (2H, d, J = 8.25 Hz), 7.66-7.75
(m, 3H), and 8.48 (s, 1H).
4,40-((5S,9R)-3-(3,5-Dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-
triazaspiro[4.4]nonane-7,9-diyl)dibenzonitrile (2c). To a solution
of 6 (0.100 g, 0.240 mmol) in dichloromethane (5.0 mL) were
sequentially added 4-cyanophenylboronic acid (0.071 g, 0.480
mmol), copper(II) acetate (0.066 g, 0.360 mmol), triethylamine
1
[M þ H]þ 591.14. Found: 592þ. H NMR (500 MHz, CDCl3)
δ= 1.59 (s, 9H), 3.26 (s, 3H), 3.95-4.25 (m, 5H), 6.47 (d, J=9.0Hz,
1H), 6.81-6.82 (m, 2H), 7.29-7.30 (m, 1H), 7.40 (d, J = 8.0 Hz,
2H), 7.70 (d, J= 8.0 Hz, 2H), 8.08 (dd, J=9.0 and2.4Hz, 1H), and
8.82 (d, J = 2.4 Hz, 1H).
˚
(0.067 mL, 0.480 mmol), and 4 A molecular sieves (0.200 g) at
To the solution of tert-butyl 6-((5S,9R)-9-(4-cyanophenyl)-
3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]-
nonan-7-yl)nicotinate (8, 15.5 g, 26.2 mmol) in dichloromethane
(50.0 mL) was added trifluoroacetic acid (50.0 mL) dropwise with
stirring between 0 and 5 °C. After the addition was complete, the
ice water bath was removed and the mixture was stirred at room
temperature for 3.5 h. The solvent was then removed under
reduced pressure, and the residue was diluted with dichloro-
methane (400 mL) and water (100 mL). After stirring for 10 min,
the pH of the aqueous layer was adjusted to ∼9 with a saturated
aqueous solution of sodium bicarbonate. The mixture was stirred
for 15 min, and the pH was rechecked to ensure basicity. The pH
was then adjusted to ∼4.5 with a 1N aqueous solution of hydro-
chloric acid. After stirring for 15 min, the organic layer was
collected and the aqueous layer was extracted with dichloro-
methane (50 mL). The organic phases were combined, washed
with brine (100 mL), and dried over anhydrous sodium sulfate.
Concentration under reduced pressure gave the crude product as a
solid, which was dissolved in chloroform (55 mL) and stirred gently
overnight at room temperature. The mixture was stirred for 30 min
in an ice bath, and the resulting precipitate was collected by
vacuum filtration. The white crystals were washed with cold
chloroform (2 ꢀ 5 mL) and dried under reduced pressure to give
the product (11.5 g). A second crop (0.600 g) was obtained through
partial concentration of the mother liquor to give a total of 12.1 g
(86%) of 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-
methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]-nonan-7-yl)nicotinic acid
(2e) as a white solid.
HPLC purity 99.8%; tr = 13.03 min (method B); 99.8%; tr =
19.63 min (method C). LCMS (EI) m/z Calcd for C26H19Cl2-
N5O4 [M þ H]þ 536.09. Found: 536.23 and 538.22. Anal. Calcd
for C26H19Cl2N5O4; 0.48% H2O: C 57.92, H 3.61, N 12.99,
Cl 13.19. Found C 57.77, H 3.54, N 12.79, Cl 13.07. 1H NMR
(500 MHz, DMSO-d6) δ 3.20 (s, 3 H), 4.01 (d, J = 12.10 Hz, 1H),
4.13-4.21 (m, J = 10.17, 10.17 Hz, 3H), 4.37 (t, J = 9.62 Hz,
1H), 6.69 (d, J = 8.25 Hz, 1H), 6.81 (s, 2H), 7.48 (d, J = 8.80 Hz,
2H), 7.64 (s, 1H), 7.89 (d, J = 8.80 Hz, 2H), 8.02 (dd, J = 8.80,
2.20 Hz, 1H), 8.69 (s, 1H), and 12.57 (s, 1H). Enatiomeric excess =
100% [Chiralcel OD-H, 0.46 cm ꢀ 25 cm, 5 μm particle size;
EtOH/TFA (100:0.1)].
room temperature. The reaction mixture was stirred for 20 h
exposed to the atmosphere and then quenched by the addition of
aqueous ammonia (2.0 mL). After stirring at room temperature
for 10 min, the reaction mixture was concentrated. To the
resulting residue was added 20 mL of dichloromethane, and the
contents were filtered over a pad of celite. The filtrate was
concentrated under reduced pressure and purified by flash silica
gel chromatography to yield 2c (0.018 g, 14%) as a solid. HPLC
purity 99.2%; tr = 16.48 min (method A); 97.7%; tr = 15.81 min
(method B). LCMS (EI) m/z Calcd for C27H19Cl2N5O2 [M þ H]þ
516.10. Found: 516þ. 1H NMR (500 MHz, CDCl3) δ 3.27 (s, 3H),
3.80-3.85 (m, 1H), 3.89-3.94 (m, 1H), 3.98-4.05 (m, 2H),
4.21-4.29 (m, 1H), 6.66 (d, J = 9.06 Hz, 2H), 6.80 (d, J =
1.76 Hz, 2H), 7.30 (t, J = 1.76 Hz, 1H), 7.40 (d, J= 8.31 Hz, 2H,),
7.57 (d, J = 8.81 Hz, 2H,), and 7.71 (d, J = 8.56 Hz, 2H).
5-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-meth-
yl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)picolinonitrile (2d).
A mixture of 6 (0.021 g, 0.050 mmol), 5-bromopicolinonitrile
(13.7 mg, 0.075 mmol), tris(dibenzylideneacetone)dipalladium-
(0) (11.4 mg, 0.013 mmol), biphenyl-2-yldicyclohexylphosphine
(4.4 mg, 0.013 mmol), and potassium t-butoxide (10.6 mg, 0.095
mmol) was flushed well with nitrogen. Dimethylformamide
(4.0 mL) was added, and the reaction mixture was stirred at
96 °C overnight. The mixture was diluted with dichloromethane,
filtered through a pad of celite, and the filtrate was washed with
water (2ꢀ), concentrated under reduced pressure, and purified
by flash silica gel chromatography to provide 2d (2.0 mg, 7.7%)
as white solid. HPLC purity 99%; tr = 6.61 min (method F);
99%; tr = 3.23 min (method E). LCMS (EI) m/z Calcd for
1
C26H18Cl2N6O2 [M þ H]þ 517.09. Found: 517.10. H NMR
(500 MHz, CDCl3) δ 3.27 (s, 3H), 3.49-4.32 (m, 5H), 6.79 (d,
J = 1.65 Hz, 2H), 6.93 (m, 1H), 7.31 (s, 1H), 7.39 (d, J = 8.5 Hz,
2H), 7.59 (d, J = 8.25 Hz, 1H), 7.71 (d, J = 8.25 Hz, 2H), and
8.14 (d, J = 2.75 Hz, 1H).
6-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-meth-
yl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)nicotinic Acid (2e).
A mixture of 6-chloronicotinic acid (12.0 g, 76.0 mmol) and
thionyl chloride (65.0 mL) was heated at reflux for 3.0 h. The
excess thionyl chloride was removed under reduced pressure, and
the residual liquid was diluted with dichloromethane (20.0 mL)
and then added to a solution of tert-butyl alcohol (71.0 mL, 760
mmol) in dichloromethane (40.0 mL). To the mixture was added
triethylamine (31.7 mL, 760 mmol) and N,N-dimethylpyridine
(0.500 g, 4.00 mmol), and the reaction mixture was stirred over-
night (14 h) at reflux under nitrogen. The solution was diluted
with dichloromethane (200 mL), washed with a saturated aqueous
solution of sodium bicarbonate (3 ꢀ 100 mL), washed with water
(3 ꢀ 100 mL), and dried over anhydrous sodium sulfate. Con-
centration under reduced pressure provided tert-butyl 6-chloro-
nicotinate (7, 11.4 g, 70%) as a yellow solid. HPLC purity 96%;
tr = 3.18 min(methodE). LCMS (EI) m/z Calcd for C10H12ClNO2
[M þ H]þ 213.06. Found: 214þ.
4-((5S,9R)-7-(5-(1H-Tetrazol-5-yl)pyridin-2-yl)-3-(3,5-dichloro-
phenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-9-yl)-
benzonitrile (2f). To a solution of 6-chloronicotinonitrile (2.76 g,
20.0 mmol) in anisole (30 mL) at 60 °C was added sequentially
triethylamine (5.00 g, 50.0 mmol), acetic acid (3.00 g, 50.0 mmol),
and sodium azide (3.30 g, 36.0 mmol). The reaction mixture was
heatedat130°C for 1.2hand then cooled to90°C.Water (30mL)
followed by anisole (10 mL) was added, and the mixture was
stirred for 10 min. The mixture was extracted with ethyl acetate
(3ꢀ), and the aqueous layer was acidified to a pH of 5 with 2N
aqueous hydrochloric acid and extracted with dichloromethane
(3ꢀ). The organic layer was collected, dried over anhydrous
sodium sulfate, and concentrated under reduced pressure to give
2-chloro-5-(1H-tetrazol-5-yl)pyridine (9, 1.10 g, 30%). HPLC
To a mixture of 6 (14.5 g, 34.9 mmol) and tert-butyl 6-chloro-
nicotinate (7, 8.0 g, 35.6 mmol) in dimethylacetamide (50.0 mL)
was added diisopropylethylamine (11.3 g, 87.3 mmol). The
reaction mixture was stirred at 112 °C for 18 h under nitrogen.
After cooling, the mixture was added slowly to ice water (200 mL)
with stirring. After 10 min, the resulting precipitate was collected
by vacuum filtration and washed with water (3 ꢀ 20 mL). The
1
purity 74%; tr = 1.77 min (method D). H NMR (500 MHz,
CDCl3) δ 7.39 (d, J = 8.25 Hz, 1H), 8.44 (dd, J = 8.25, 2.20 Hz,
1H), and 9.17 (d, J = 2.20 Hz, 1H).
To the solution of 2-chloro-5-(1H-tetrazol-5-yl)pyridine (9,
0.360 g, 2.00 mmol) in chloroform (20 mL) was added a 10%

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3823
aqueous solution of sodium hydroxide (10 mL) and TBAB
(0.064 g, 0.200 mmol). After stirring for 5 min, a solution of
trityl chloride (0.668 g, 2.40 mmol) in chloroform (5.0 mL) was
added dropwise. The mixture was stirred at room temperature
for 3 h. The organic phase was separated, washed with a 10%
aqueous solution of sodium hydroxide, washed with water,
dried over anhydrous sodium sulfate, and concentrated under
reduced pressure. The crude product was recrystallized from
ethyl acetate/hexane (1:10) to give 2-chloro-5-(1-trityl-1H-tetra-
zol-5-yl)pyridine (10, 330 mg, 39%). HPLC purity 78%; tr =
4.29 min (method D). 1H NMR (500 MHz, CDCl3) δ 7.11-7.46
(m, 16H), 8.35 (dd, J = 8.52, 2.47 Hz, 1H), and 9.12 (d, J =
2.20 Hz, 1H).
The mixture of 6 (0.021 g, 0.050 mmol), 2-chloro-5-(1-trityl-
1H-tetrazol-5-yl)pyridine (10, 0.021 g, 0.050 mmol), and diiso-
propylethylamine (100 μL) was stirred at 120 °C overnight. After
cooling, the diisopropylamine was removed under reduced pres-
sure, and the crude product mixture (11) was dissolved in methanol
(3.0 mL). Trifluoroacetic acid (1.0 mL) was added, and the mixture
was stirred for 1 h at room temperature. Concentration under
reduced pressure followed by purification by preparative HPLC
provided 2f as a white solid (3.3 mg, 12%). HPLC purity 97.7%;
tr = 13.21 min (method A); 96.9%; tr = 13.01 min (method B).
LCMS (EI) m/z Calcd for C26H19Cl2N9O2 [M þ H]þ 560.11.
Found: 560.11. 1H NMR (500 MHz, methanol-d4) δ 3.28 (s, 3H),
4.09-4.19 (m, 2H), 4.24 (s, 1H), 4.31-4.40 (m, 2H), 6.83 (d, J =
2.20 Hz, 2H), 6.89 (d, J = 9.35 Hz, 1H,), 7.42 (s, 1H), 7.55 (d, J =
8.25 Hz, 2H), 7.79 (d, J= 8.25 Hz, 2H), 8.21 (dd, J= 9.35, 2.20 Hz,
1H), and 8.79 (d, J = 2.20 Hz, 1H).
6.80 (s, 2H), 7.30 (s, 1H), 7.39 (d, J = 7.5 Hz, 2H), 7.70 (d, J =
7.5 Hz, 2H), and 8.98-8.99 (m, 2H).
5-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrazine-2-carboxylic
Acid (2h). A mixture of 6 (0100 g, 0.241 mmol), methyl 5-chloro-
pyrazine-2-carboxylate (0.046 g, 0.265 mmol), and diisopropyl-
ethylamine (0.084 mL, 0.482 mmol) in anhydrous dimethylform-
amide (3.0 mL) was heated at 100 °C overnight. The solvent was
removed under reduced pressure, and the residue was dis-
solved in dichloromethane, washed with water, and dried over
anhydrous sodium sulfate. Concentration under reduced pres-
sure followed by purification by preparative HPLC afforded
methyl 5-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-
methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrazine-2-
carboxylate (0.114 g, 86%) (12) as a white solid. HPLC purity
>99%; tr = 3.27 min (method D). LCMS (EI) m/z Calcd for
C26H20Cl2N6O4 [M þ H]þ 551.10. Found: 551.17 and 553.16.
1H NMR (500 MHz, CDCl3) δ 3.26 (s, 3H), 3.98 (s, 3H),
4.00-4.06 (m, 2H), 4.17 (d, J = 12.65 Hz, 1H,) 4.30 (t, 1H),
4.43 (t, J = 11.00 Hz, 1H), 6.80 (s, 2H), 7.30 (s, 1H), 7.40 (d,
J = 8.25 Hz, 2H), 7.70 (d, J = 8.25 Hz, 2H), 8.05 (s, 1H), and
8.89 (s, 1H).
A mixture of methyl 5-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)pyrazine-2-carboxylate (12, 0.099 g, 0.180 mmol) and 1,2-
propanediol (0.026 mL, 0.360 mmol) in tetrahydrofuran (1.0 mL)
and water (0.5 mL) was stirred for 15 min at room temperature.
A 1.0 M aqueous solution of potassium hydroxide (0.45 mL,
0.450 mmol) was added, and the reaction mixture was stirred for
20 h. The tetrahydrofuran was removed under reduced pressure,
andthe aqueousresiduewas extractedwith dichloromethane. The
organic layer was collected, dried over anhydrous sodium sulfate,
and concentrated under reduced pressure. The residue was puri-
fied by preparative HPLC to give 2h (0.027 g) as a white solid.
HPLC purity 97.8%; tr = 13.63 min (method A); 94.5%; tr =
13.25 min (method B). LCMS (EI) m/z Calcd for C25H18Cl2N6O4
[M þ H]þ 537.08. Found: 537.45 and 539.40. 1H NMR (500 MHz,
DMSO-d6) δ 3.20 (s, 3H), 4.02-4.12 (m, J = 10.45 Hz, 1H),
4.15-4.32 (m, 3H), 4.34-4.45 (m, J = 9.90 Hz, 1H), 6.82 (s, 2H),
7.49 (d, J = 8.25 Hz, 2H), 7.64 (s, 1H), 7.90 (d, J = 8.25 Hz, 2H),
8.13 (s, 1H), and 8.72 (s, 1H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrimidine-5-carboxylic
Acid (2g). A mixture of 6 (0.100 g, 0.241 mmol), ethyl 2-chloro-
pyrimidine-5-carboxylate14 (0.068 g, 0.362 mmol), and diisopro-
pyl ethylamine (0.084 mL, 0.482 mmol) in anhydrous dimethyl-
formamide (3 mL) was heated at 100 °C for 2 h. Water was added,
the solvent was removed under reduced pressure, and the residue
was diluted with dichloromethane, washed with water, and dried
over anhydrous sodium sulfate. Concentration under reduced
pressure followed by purification by flash silica gel chromatogra-
phy using a 1:1 mixture of ethyl acetate and dichloromethane
afforded ethyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-
1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrimidine-5-
carboxylate (0.054 g, 40%) as a white solid. HPLC purity 99%;
tr = 3.84 min (method D). LCMS (EI) m/z Calcd for C27H22Cl2-
6-((5S,9R)-3-(3,5-Dichlorophenyl)-1-methyl-2,4-dioxo-9-phenyl-
1,3,7-triazaspiro[4.4]nonan-7-yl)pyridazine-3-carboxylic Acid (2i).
To a suspension of 6-hydroxypyridazine-3-carboxylic acid
(2.00 g, 14.3 mmol) in methanol (50 mL) was added concen-
trated sulfuric acid (1.5 mL). The mixture was heated at reflux
for 4 h, cooled to room temperature, and concentrated under
reduced pressure to give a solid. The solid was suspended in ice
water (50 mL), filtered under reduced pressure, and washed
with additional ice water (50 mL). The precipitate was air-dried
to give methyl 6-hydroxypyridazine-3-carboxylate (2.00 g,).
LCMS (EI) m/z Calcd for C6H6N2O3 [M þ H]þ 155.05. Found:
155þ. The compound was used in the next step without any
further purification.
1
N6O4 [M þ H]þ 565.12. Found: 565.16 and 567.16. H NMR
(500 MHz, CDCl3) δ 1.38 (t, J = 6.87 Hz, 3H), 3.24 (s, 3H), 3.97
(t, J = 9.62 Hz, 1H), 4.06 (d, J = 12.65 Hz, 1H), 4.24 (d, J =
13.20 Hz, 1H), 4.37 (q, J = 7.15 Hz, 2H), 4.45 (d, J = 9.90 Hz,
2H), 6.79 (s, 2H), 7.29 (s, 1H), 7.38 (d, J = 7.70 Hz, 2H), 7.69 (d,
J = 8.25 Hz, 2H), and 8.94 (s, 2H).
A mixture of ethyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)pyrimidine-5-carboxylate (0.017 g, 0.031 mmol) and 1,2-
propanediol (0.005 mL, 0.061 mmol) in tetrahydrofuran (1.0 mL)
and water (0.5 mL) was stirred for 15 min at room temperature. A
1.0 M aqueous solution of potassium hydroxide (0.076 mL, 0.077
mmol) was added, and the reaction mixture was stirred for 7 h. To
the mixture was added water (0.5 mL) followed by acetic acid
(0.042 mL), and the tetrahydrofuran was removed under reduced
pressure. The aqueous residue was diluted with water and dichloro-
methane, and the aqueous pH was adjusted to ∼6.0 with 1N
aqueous hydrochloric acid. The organic layer was collected,
dried over anhydrous sodium sulfate, and concentrated under
reduced pressure. The residue was purified by preparative
HPLC to give 2g (0.006 g) as a white solid. HPLC purity
97.2%; tr = 14.31 min (method A); 97.0%; tr = 13.72 min
(method B). LCMS (EI) m/z Calcd for C25H18Cl2N6O4 [M þ
Methyl 6-hydroxypyridazine-3-carboxylate (0.200 g) was
suspended in phosphorus oxychloride (2.0 mL) and heated at
110 °C for 4 h. The reaction mixture was cooled to room
temperature, the excess phosphorus oxychloride was removed
under reduced pressure, and the resulting slurry was treated with
ice water (5 mL). The resulting precipitate was filtered, rinsed
with ice water (10 mL), and air-dried to give methyl 6-chloro-
pyridazine-3-carboxylate (21, 110 mg). LCMS (EI) m/z Calcd
1
for C6H5ClN2O2 [M þ H]þ 173.01. Found: 172.90. H NMR
(400 MHz, CDCl3) δ 4.07 (s, 3H), 7.67 (d, J = 8.81 Hz, 1H), and
8.15 (d, J = 8.81 Hz, 1H).
To a solution of 6 (0.082 g, 0.200 mmol) and methyl 6-chloro-
pyridazine-3-carboxylate (21, 0.040 g) in dimethylformamide
(1.5 mL) was added diisopropylethylamine (0.090 mL, 0.500
mmol). The reaction mixture was heated at 95 °C for 4 h, cooled
to room temperature, and purified by preparative HPLC to give
1
H]þ 537.08. Found: 537.19 and 537.16. H NMR (500 MHz,
CDCl3) δ 3.26 (s, 3H), 3.98 (t, J = 8.8 Hz, 1H), 4.09 (d, J =
13.0 Hz, 1H), 4.28 (d, J = 13.0 Hz, 1H), 4.47-4.49 (m, 2H),

3824 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
methyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-
methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyridazine-3-
carboxylate as a trifluoroacetic acid salt (95 mg, 71%). LCMS
(EI) m/z Calcd for C26H20Cl2N6O4 [M þ H]þ 551.10. Found:
553þ. 1H NMR (400 MHz, CDCl3) δ 3.25 (s, 3H), 4.00 (s, 3H),
4.08 (m, 1H), 4.16-4.26 (m, 2H), 4.31 (m, 1H), 4.45 (t, J = 10.83
Hz, 1H), 6.80 (d, J = 2.01 Hz, 2H), 6.97 (d, J = 9.57 Hz, 1H),
7.30 (t, J = 2.01 Hz, 1H), 7.39 (d, J = 8.06 Hz, 2H), 7.70 (d, J =
8.06 Hz, 2H), and 8.10 (d, J = 9.57 Hz, 1H).
To a solution the methyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)pyridazine-3-carboxylate, trifluoroacetic acid salt (0.055 g,
0.100 mmol) in tetrahydrofuran (2.5 mL) and methanol (0.5 mL)
was added 1,2-propanediol (0.020 mL) followed by 1N aqueous
solution of potassium hydroxide (0.250 mL, 0.250 mmol). The
mixture was stirred at room temperature for 4 h, acidified with a
10%aqueous solutionofacetic acidtoa pHof5-6, and extracted
with dichloromethane. The combined organic layers were filtered
through a plug of a 1:1 MgSO4/celite mixture, concentrated under
reduced pressure, and purified by preparative HPLC to give 2i as
a trifluoroacetic acid salt, (12 mg, 37%). HPLC purity 98%; tr =
6.04 min (method F); 98%; tr = 3.00 min (method E). LCMS (EI)
m/z Calcd for C25H18Cl2N6O4 [M þ H]þ 537.08. Found: 537þ
and 539þ. 1H NMR (400 MHz, CD3OD) δ 3.28 (s, 3H), 4.15-
4.48 (m, 5H), 6.84 (s, 2H), 7.32 (d, J = 9.06 Hz, 1H), 7.43 (s, 1H),
7.56 (d, J = 8.06 Hz, 2H), 7.78 (d, J = 8.06 Hz, 2H), and 8.13 (d,
J = 9.32 Hz, 1H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)isonicotinic Acid (2j). A
mixture of 6 (5.00 g, 0.012 mol) and 2-chloroisonicotinic acid,
methyl ester (16.5 g, 0.096 mol), in a sealed tube was heated at
96 °C for 4.5 days. By HPLC, the reaction was complete. After
cooling, the reaction mixture was diluted with dichloro-
methane, washed with a saturated aqueous solution of sodium
bicarbonate, and dried over anhydrous sodium sulfate. Con-
centration under reduced pressure followed by purification by
flash silica gel chromatography afforded methyl 2-((5S,9R)-
9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-
1,3,7-triazaspiro[4.4]nonan-7-yl)-isonicotinate (15, 2.45 g, 37%)
asan off-whitesolid. HPLC purity>98%;tr = 3.24 min(method
D). LCMS (EI) m/z Calcd for C27H21Cl2N5O4 [M þ H]þ 550.10.
Found: 550.29 and 552.28. 1H NMR (500 MHz, CDCl3) δ 3.24 (s,
3H), 3.93 (s, 3H), 3.97-4.05 (m, 2H), 4.08-4.12 (m, 1H), 4.19 (t,
J = 8.80 Hz, 1H), 4.30-4.35 (m, 1H), 6.79 (s, 2H), 7.09 (s, 1H),
7.22 (d, J = 5.50 Hz, 1H), 7.27 (s, 1H), 7.39 (d, J = 8.25 Hz, 2H),
7.68 (d, J = 8.25 Hz, 2H), and 8.32 (d, J = 4.95 Hz, 1H).
A mixture of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)-isonicotinate (15, 1.55 g, 2.82 mmol) and lithium iodide
(11.6 g) in anhydrous dimethylacetamide (15 mL) was heated at
140 °C overnight. HPLC analysis indicated that there was ∼20%
starting material remaining. An additional 5.0 g of lithium iodide
was added, and the mixture was heated overnight. The reaction
was cooled to room temperature, and acetic acid (∼4.0 mL) was
added followed by water (20 mL). The pH was adjusted to 5.0
with a 1.0 M aqueous solution of sodium hydroxide. The solid
was collected by vacuum filtration, washed with water, and dried
well under reduced pressure to give the product (1.40 g) as a light-
brownsolid. The compoundwas further purifiedbyflashsilica gel
chromatography to give 2j (1.30 g) as a yellow solid. HPLC purity
99.0%; tr = 11.89 min (method A); 99.4%; tr = 12.36 min (method
B). LCMS (EI) m/z Calcd for C26H19Cl2N5O4 [M þ H]þ 536.09.
Found: 536.23 and 538.22. 1H NMR (500 MHz, DMSO-d6) δ 3.20
(s, 3H) 3.98 (d, J = 12.10 Hz, 1H), 4.05-4.16 (m, 3H), 4.35 (t, J =
9.62 Hz, 1H), 6.80 (s, 2 H), 7.05 (s, 1H), 7.08 (d, J = 4.95 Hz, 1H),
7.48 (d, J = 8.25 Hz, 2H), 7.63 (s, 1H), 7.88 (d, J = 8.25 Hz, 2H),
and 8.21 (d, J = 4.95 Hz, 1H).
(11.8 mg, 0.075 mmol), tris(dibenzylideneacetone)dipalladium(0)
(0.014 g, 0.016 mmol), BINAP (0.010 g, 0.016 mmol), and diiso-
propylamine (0.020 mL) was flushed well with nitrogen. Dimethyl-
acetamide (2.0 mL) was added, and the mixture was stirred at
90 °C overnight. The mixture was diluted with dichloromethane
(50 mL), filtered through a pad of celite, and the filtrate was
washed with water (2ꢀ), concentrated under reduced pressure,
and purified by preparative HPLC to provide 2k (9.0 mg, 33%) as
a white solid. HPLC purity 99%; tr = 5.62 min (method F); 99%;
tr = 2.81 min (method E). LCMS (EI) m/z Calcd for C26H19-
Cl2N5O4 [M þ H]þ 536.09. Found: 536.18. 1H NMR (500 MHz,
CD3OD) δ 3.21 (s, 3H), 4.10-4.30 (m, 5H), and 6.75-8.05
(m, 10H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrimidine-4-carboxylic
Acid (2l). To a solution of 6 (100 mg, 0.240 mmol) in dimethyl-
formamide (1.0 mL) was added methyl 2-(methylsulfonyl)-
pyrimidine-4-carboxylate15 (0.052 g, 0.240 mmol). The reaction
mixture was allowed to heat for 4 h at 100 °C. The reaction
mixture was diluted with water, extracted with diethyl ether,
and concentrated under reduced pressure. The resulting residue
was purified by flash silica gel chromatography to give methyl
2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrimidine-4-carboxy-
late (0.037 g, 28%). HPLC tr = 3.59 min (method G). LCMS (EI)
m/z Calcd for C26H20Cl2N6O4 [M þ H]þ 551.10. Found: 551þ. 1H
NMR (500 MHz, CDCl3) δ3.19 (s, 3H), 3.91(s, 3H), 3.91(m, 1H),
4.03 (m, 1H), 4.21 (m, 1H), 4.39 (m, 2H), 6.72 (d, J = 1.65 Hz,
2H,), 7.23 (m, 1H), 7.24 (d, J = 4.95 Hz, 1H), 7.33 (d, J = 8.25 Hz,
2H), 7.62 (d, J = 8.25 Hz, 2H), and 8.54 (m, 1H).
To a solution of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)pyrimidine-4-carboxylate (0.033 g, 0.060 mmol) in tetrahy-
drofuran (2.8 mL) and water (1.4 mL) was added 1,2-propanediol
(0.083 mL). The mixture was stirred at room temperature for
5 min, at which point a 1.0 M aqueous solution of potassium
hydroxide (0.147 mL) was added. After stirring for 2 h, the
reaction mixture was concentrated under reduced pressure, and
the resultingresiduewasneutralized withan ion-exchange resin to
give 2l as a white soid (22.5 mg, 70%). HPLC purity 98.1%; tr =
14.11 min (method A); 97.3%; tr = 13.52 min (method B). LCMS
(EI) m/z Calcd for C25H18Cl2N6O4 [M þ H]þ 537.08. Found:
537þ. 1H NMR (500 MHz, DMSO-d6) δ 3.19 (s, 3H), 3.96 (d, J =
12.1 Hz, 1H), 4.19 (m, 3H), 4.34 (m, 1H), 6.78 (m, 2H), 7.05 (d,
J = 5.0 Hz, 1H), 7.46 (d, J = 8.25 Hz, 2H), 7.62 (m, 1H), 7.86 (d,
J = 8.25 Hz, 2H), and 8.50 (d, J = 5.0 Hz, 1H).
6-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)pyrimidine-4-carboxylic
Acid (2m). To a mixture of 6 (0.096 g, 0.231 mmol) and methyl
6-chloropyrimidine-4-carboxylate16 (0.042 g, 0.231 mmol) in di-
methylformamide (1.5 mL) was added diisopropylamine (0.121 mL,
0.691 mmol). The reaction mixture was heated for 2 h at 100 °C.
The mixture was diluted with water, extracted with diethyl ether,
and the organic layer was collected and dried over anhydrous
sodium sulfate to give methyl 6-((5S,9R)-9-(4-Cyanophenyl)-
3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]-
nonan-7-yl)pyrimidine-4-carboxylate (96 mg, 76%). HPLC tr =
3.12 min (method G). LCMS (EI) m/z Calcd for C26H20Cl2N6O4
[M þ H]þ 551.10. Found: 551þ. 1H NMR (500 MHz, CDCl3) δ
3.26 (s, 3H), 3.60 (m, 1H), 3.83 (m, 1H), 4.01 (s, 3H), 4.09 (m, 2H),
4.40 (m, 1H), 6.79 (m, 2H), 7.24 (s, 1H), 7.29 (s, 1H), 7.38 (d, J =
8.25 Hz, 2H), 7.69 (d, J = 8.25 Hz, 2H), 8.77 (m, 1H).
To a solution of methyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)pyrimidine-4-carboxylate (0.096 g, 0.174 mmol) in tetra-
hydrofuran (8.4 mL) and water (4.2 mL) was added 1,2-propane-
diol (0.25 mL). The reaction mixture was stirred at room tem-
perature for 15 min, and then a 1.0 M aqueous solution of
potassium hydroxide (0.440 mL) was added. After stirring at
room temperature for 16 h, the reaction mixture was concentrated
4-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)picolinic Acid (2k).
A mixture of 6 (0.021 mg, 0.050 mmol), 4-chloropicolinic acid

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3825
11H14ClNO2 [M þ H]þ 228.08. Found: 228.42. 1H NMR
under reduced pressure, and the resulting residue was purified by
preparative HPLC to give 2m as a white solid (34.6 mg, 37%).
HPLC purity 95.0%; tr = 11.35 min (method A); 94.8%; tr =
11.52 min (method B). LCMS (EI) m/z Calcd for C25H18Cl2N6O4
[M þ H]þ 537.08. Found: 537þ. 1H NMR (500 MHz, DMSO-d6)
δ 3.19 (s, 3H), 4.00-4.40 (m, 5H), 6.79 (d, J = 1.65 Hz, 2H), 7.00
(brs, 1H), 7.48 (d, J = 8.0 Hz, 2H), 7.63 (dd, J = 1.65, 1.65 Hz,
1H), 7.87 (d, J = 8.0 Hz, 2H), 8.52 (s, 1H).
6-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)-2-methylnicotinic Acid
(2n). A mixture of ethyl-3-amino crotonate (5.20 g, 40.0 mmol)
andmethylpropiolate(3.40 g, 40.0 mmol)wasstirredat108°Cfor
3 h under nitrogen. After cooling, the resulting solid was recrys-
tallized from methanol to give (2E,4Z)-5-ethyl 1-methyl 4-(1-
aminoethylidene)pent-2-enedioate as yellow solid (16, 6.10 g,
72%). HPLC purity >95%; tr = 2.58 min (method D). LCMS
(EI) m/z Calcd for C10H15NO4 [M þ H]þ 214.11. Found: 214.45.
1H NMR (500 MHz, CDCl3) δ 1.35 (t, J = 7.12 Hz, 3H), 2.26 (s,
3H), 3.72 (s, 3H), 4.25 (q, J = 7.12 Hz, 2H), 6.17 (d, J = 15.26 Hz,
1H), and 7.64 (d, J = 15.77 Hz, 1H).
C
(500 MHz, CDCl3) δ 1.58 (s, 9H), 2.77 (s, 3H), 7.20 (s, 1H), and
8.05 (d, J = 8.14 Hz, 1H).
A mixture of 6 (0.042 g, 0.100 mmol), tert-butyl 6-chloro-2-
methylnicotinate (19, 0.022 g, 0.100 mmol), diisopropylethyl-
amine (0.1 mL), and demethylacetamide (2.0 mL) was stirred at
112 °C for 18 h. After cooling, the mixture was added slowly
to ice water (10 mL) and extracted with dichloromethane (3ꢀ).
The organic layer was collected, dried over anhydrous sodium
sulfate, and concentrated under reduced pressure. The residue
was purified by flash silica gel chromatography to provide tert-
butyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-
methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)-2-methylni-
cotinate (20, 30 mg, 50%). HPLC purity 74%; tr = 3.98 min
(method D). LCMS (EI) m/z Calcd for C31H29Cl2N5O4 [M þ
H]þ 606.17. Found: 606.14. 1H NMR (500 MHz, CDCl3) δ
1.56-1.60 (m, 9H) 2.70 (s, 3H), 3.23 (s, 3H), 3.94-4.04 (m, 2H),
4.16 (d, J = 11.70 Hz, 2H), 4.23-4.32 (m, 1H), 6.29-6.35 (m, 1H),
6.80 (d, J = 2.03 Hz, 2H), 7.26 (t, J = 5.34 Hz, 1H), 7.38 (d, J =
8.14 Hz, 2H), 7.61-7.70 (m, 2H), and 8.04 (d, J = 8.65 Hz, 1H).
To tert-butyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichloro-
phenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)-
2-methylnicotinate (20, 0.030 g, 0.050 mmol) in dichloromethane
(2.0 mL) was added trifluoromethane (2.0 mL) at 0 °C. The
mixture was stirred at room temperature for 2.5 h. The solvent
and excesstrifluoromethane was removed under reduced pressure,
and the residue was purified with preparative HPLC to give 2n
(0.021 g, 76%) as a white solid. HPLC purity 99%; tr = 6.42 min
(method F); 99%; tr = 2.58 min (method D). LCMS (EI) m/z
Calcd for C27H21Cl2N5O4 [M þ H]þ 550.10. Found: 550.08. 1H
NMR (500 MHz, CDCl3) δ 2.77 (s, 3H), 3.25 (s, 3H), 3.99-4.14
(m, 3H), 4.21 (d, J = 10.45 Hz, 1H), 4.34 (d, J = 11.00 Hz, 1H),
6.39 (d, J = 9.35 Hz, 1H), 6.80 (s, 2H), 7.28 (s, 1H), 7.38 (d,
J = 8.25 Hz, 2H), 7.67 (d, J = 8.25 Hz, 2H), and 8.18 (d, J =
8.80 Hz, 1H).
A mixture of (2E,4Z)-5-ethyl 1-methyl 4-(1-aminoethylidene)-
pent-2-enedioate (16, 6.00 g, 28.2 mmol) in dimethylformamide
(30 mL) was heated at reflux for 14 h. After cooling, the resulting
solid was collected by vacuum filtration, washed with dimethy-
formamide (3ꢀ), washed with diethyl ether (3ꢀ), and dried to
give ethyl 2-methyl-6-oxo-1,6-dihydropyridine-3-carboxylate (17)
as an off-white solid (2.8 g, 55%). HPLC purity >95%; tr = 1.95
min (method D). LCMS (EI) m/z Calcd for C9H11NO3 [M þ H]þ
1
182.08. Found: 182.42. H NMR (500 MHz, CDCl3) δ 1.35 (t,
J = 7.38 Hz, 3H), 2.72 (s, 3H), 4.30 (q, J = 7.12 Hz, 2H), 6.41 (d,
J = 9.66 Hz, 1H), 8.03 (d, J = 9.66 Hz, 1H), and 12.66 (s, 1H).
A mixture of ethyl 2-methyl-6-oxo-1,6-dihydropyridine-3-
carboxylate (17, 0.610 g, 3.40 mmol) and phosphorus oxychlor-
ide (15 mL) was heated at 128 °C for 4 h. After cooling, the
mixture was added to 100 mL of ice water, and the pH was then
adjusted to 9 with a saturated aqueous solution of sodium
bicarbonate. The aqueous mixture was extracted with ethyl
acetate (3ꢀ), washed with a saturated aqueous solution of
sodium chloride (2ꢀ), and dried over anhydrous sodium sulfate.
Concentration under reduced pressure provided ethyl 6-chloro-
2-methylnicotinate (2.3 g, 77%) as white solid. HPLC purity
98%; tr = 2.84 min (method D). LCMS (EI) m/z Calcd for
C9H10ClNO2 [M þ H]þ 200.05. Found: 200.39. 1H NMR (500
MHz, CDCl3) δ 1.39 (t, J = 7.15 Hz, 3H), 2.81 (s, 3H), 4.37 (q,
J = 7.15 Hz, 2H), 7.23 (d, J = 8.25 Hz, 1H), and 8.15 (d, J =
8.25 Hz, 1H).
To a solution of ethyl 6-chloro-2-methylnicotinate (2.30 g,
11.5 mmol) and methanol (5.0 mL) was added a 25% aqueous
solution of sodium hydroxide (1.0 mL) dropwise. The mixture
was stirred at room temperature for 2.5 h. The pH was adjusted
to 5-6 with acetic acid, and the solution was concentrated under
reduced pressure to give the crude 6-chloro-2-methylnicotinic
acid (18, 2.50 g, 98%), which was used to next step without
further purification. HPLC purity 99%; tr = 1.62 min (method
D). LCMS (EI) m/z Calcd for C7H6ClNO2 [M þ H]þ 172.02.
Found: 172.36. 1H NMR (500 MHz, CD3OD) δ 2.63 (s, 3 H),
7.23 (d, J = 8.14 Hz, 1H), and 7.84 (d, J = 8.14 Hz, 1H).
A mixture of 6-chloro-2-methylnicotinic acid (18, 0.172 g,
1.00 mmol) and thionyl chloride (5.0 mL) was stirred at reflux
for 3 h. The excess of thionyl chloride was removed under
reduced pressure. To the residue was added t-butanol (5.0 mL),
dimethylaminopyridine (200 mg, 1.63 mmol), and triethylamine
(1.0 mL), and the reaction mixture was stirred at 70 °C overnight
under nitrogen. After cooling, the mixture was diluted with
dichloromethane (100 mL), washed with a saturated aqueous
solution of sodium bicarbonate, and dried over magnesium
sulfate. Concentration under reduced pressure followed by puri-
fication by flash silica gel chromatography afforded tert-butyl
6-chloro-2-methylnicotinate (19, 0.022 g, 10%). HPLC purity
57%; tr = 3.40 min (method D). LCMS (EI) m/z Calcd for
6-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)-4-methylnicotinic Acid
(2o). To a heterogeneous mixture of 6-amino-4-methylnicotinic
acid (1.00 g, 6.50 mmol) in methanol (20 mL) was added dropwise
thionyl chloride (0.90 mL, 8.20 mmol). The mixture was refluxed
for 20 h, cooled to room temperature, and the solvent was
removed under reduced pressure. The resulting solid was dis-
solved in water (25 mL), and the pH was adjusted to 13 with a 1N
aqueous solution of sodium hydroxide to give a white solid.
The solid was collected by vacuum filtration, rinsed with water
(25 mL), and air-dried to give methyl 6-amino-4-methylnicotinate
(700 mg, 65%). LCMS (EI) m/z Calcd for C8H10N2O2 [M þ H]þ
1
167.08. Found: 167þ. H NMR (500 MHz, DMSO-d6) δ 2.37
(s, 3H), 3.72 (s, 3H), 6.25 (s, 2H), 6.62 (s, 2H), and 8.45 (s, 1 H).
To an ice cold 15% aqueous solution of sulfuric acid (30 mL)
was added methyl 6-amino-4-methylnicotinate (1.40 g, 8.4 mmol)
followed by portionwise addition of sodium nitrite (1.20 g, 16.8
mmol). The reaction mixture was stirred at 0 °C for 2 h and at
room temperature for an additional 2 h. The resulting solid was
collected by vacuum filtration, rinsed sequentially with water
(35 mL) and diethyl ether (35 mL), and air-dried to give methyl
6-hydroxy-4-methylnicotinate (24, 1.00 g, 71%). LCMS (EI) m/z
Calcd for C8H9NO3 [M þ H]þ 168.07. Found: 168þ. 1H NMR
(400 MHz, DMSO-d6) δ 2.37 (s, 3H), 3.72 (s, 3H), 6.25 (s, 1H),
6.62 (s, 2 H), and 8.46 (s, 1H).
To a suspension of methyl 6-hydroxy-4-methylnicotinate (24,
0.250 g, 1.50 mmol) in toluene (5.0 mL) was added phosphorus
oxychloride (1.0 mL). The mixture was heated at 110 °C for 4 h,
cooled to room temperature, and the excess phosphorus oxy-
chloride was removed under reduced pressure. The resulting
slurry was diluted with dichloromethane (25 mL) and washed
sequentially with a saturated aqueous solution of sodium bicar-
bonate and water. The organic layer was collected and dried
over anhydrous sodium sulfate. The solvent was removed under
reduced pressure to give methyl 6-chloro-4-methylnicotinate

3826 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
(13, 0.200 g, 72%) as a solid. (EI) m/z Calcd for C8H8ClNO2
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)oxazole-4-carboxylic Acid
(2q). A mixture of ethyl bromopyruvate (6.00 g, 0.030 mol) and
urea (3.00 g, 0.050 mol) was heated at 100 °C for 1 h under
nitrogen. To the brown solid was added water (50 mL), and the
pH was adjusted to ∼9-10 with a 1N aqueous solution of
potassium hydroxide. The mixture was extracted with diethyl
ether (3ꢀ), and the organic layer was washed with water (2ꢀ),
dried over anhydrous sodium sulfate, and concentrated under
reduced pressure to provide ethyl 2-aminooxazole-4-carboxylate
(22, 1.87 g, 40%) as a yellow solid. HPLC purity 78%; tr = 0.830
min (method D). LCMS (EI) m/z Calcd for C6H8N2O3 [M þ H]þ
1
[M þ H]þ 186.03. Found: 186þ and 188þ. H NMR (400 MHz,
DMSO-d6) δ2.53 (s, 3H), 3.85 (s, 3H), 7.58 (s, 1H), and 8.74 (s, 1H).
To a solution of 6 (0.165 g, 0.400 mmol) in N-methylpyrro-
lidine (1.5 mL) was added methyl 6-chloro-4-methylnicotinate
(13, 0.075 g, 0.400 mmol) and diisopropylethylamine (0.175 mL,
1.00 mmol). The reaction mixture was heated at 100 °C for 18 h,
cooled to room temperature, and diluted with water (20 mL).
The resulting solid was collected by vacuum filtration, rinsed
with additional water (25 mL), rinsed with heptane (25 mL), and
air-dried to give methyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)-4-methylnicotinate (14, 0.185 g). LCMS (EI) m/z Calcd
1
157.06. Found: 157.35. H NMR (500 MHz, CDCl3) δ 1.34 (t,
1
for C28H23Cl2N5O4 [M þ H]þ 564.12. Found: 566þ. H NMR
J = 7.12 Hz, 3H), 4.32 (q, J = 7.12 Hz, 2H), 5.13 (s, 2H), and
7.72 (s, 1H).
(400 MHz, CDCl3) δ 2.72 (s, 3H), 3.24 (s, 3H), 3.91 (s, 3H),
4.04-4.15 (m, 2H), 4.21 (m, 1H), 4.35 (m, 1H), 4.48 (t, J= 11.0 Hz,
1H), 6.58 (s, 1H), 6.79 (d, J = 1.5 Hz, 2H), 7.30 (t, J = 1.5 Hz, 1H),
7.37 (d, J = 8.0 Hz, 2H), 7.72 (t, J = 8.0 Hz, 2H), and 8.77 (s, 1H).
Methyl 6-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-
1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)-4-methyl-
nicotinate (14, 0.050 g, 0.089 mmol) and lithium iodide (0.025 g,
0.140 mmol) were suspended in N-methylpyrrolidine (1.0 mL)
and heated at 140 °C for 20 h. The mixture was cooled to room
temperature, diluted with methanol (3.0 mL), and purified by
preparative HPLC to give the product as a trifluoroacetic acid
salt. The trifluoroacetic acid salt was dissolved in methanol (1.0 mL)
and neutralized on a CUBCX1-HL (benzenesulfonic acid) ion
exchange cartridge (UCT part number CUBX1HL5R3, 500 mg)
to afford 2o as a solid (0.020 g, 42%). HPLC purity 96.5%; tr =
12.22 min (method A);97.4%; tr = 12.84 min (method B). LCMS
(EI) m/z Calcd for C27H21Cl2N5O4 [M þ H]þ 550.10. Found:
To a mixture of tert-butyl nitrite (0.990 g, 9.60 mmol) and
copper(II) chloride (1.29 g, 9.60 mmol) in anhydrous acetoni-
trile (5.0 mL) was added ethyl 2-aminooxazole-4-carboxylate
(22, 1.00 g, 6.40 mmol) dissolved in acetonitrile (2.0 mL) at
65 °C. Once nitrogen evolution subsided (∼20 min), the solution
was cooled to room temperature and poured into 150 mL of a
20% aqueous solution of hydrochloric acid. The mixture was
extracted with diethyl ether (3ꢀ), washed with a 20% aqueous
solution of hydrochloric acid, dried over anhydrous sodium
sulfate, and concentrated under reduced pressure to provide
ethyl 2-chlorooxazole-4-carboxylate (23, 0.740 g, 66%) as yellow
oil. HPLC purity 84%; tr = 1.93 min (method D). LCMS (EI)
m/z Calcd for C6H6ClNO3 [M þ H]þ 176.01. Found: 176.36.
1H NMR (500 MHz, CDCl3) δ 1.37 (t, J = 7.12 Hz, 3H,), 4.38
(q, J = 7.12 Hz, 2H), and 8.18 (s, 1H).
The mixture of 6 (0.200 g, 0.480 mmol), ethyl 2-chloroox-
azole-4-carboxylate (23, 0.120 g, 0.680 mmol), diisopropyl-
amine (0.40 mL), and dimethylacetamide (2.0 mL) was stirred
at 112 °C for 14 h. After cooling, the mixture was poured into ice
water (50 mL). The resulting solid was collected by vacuum
filtration and purified by flash silica gel column chromatography
to give ethyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-
1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)oxazole-4-
carboxylate as yellow solid (0.108 g, 41%). HPLC purity 99%; tr =
3.55 min (method D). LCMS (EI) m/z Calcd for C26H21Cl2N5O5
[M þ H]þ 554.10. Found: 554.14. 1H NMR (500 MHz, CDCl3) δ
1.36 (3H, t, J= 7.12 Hz), 3.21 (s, 3H), 3.93 (dd, J= 11.70, 7.63 Hz,
1H), 3.99-4.12 (m, 2H), 4.18-4.26 (m, 1H), 4.32-4.46 (m, 3H),
6.74 (d, J = 2.03 Hz, 2H), 7.27-7.29 (m, 1H), 7.33 (d, J=8.14Hz,
2H), 7.68 (d, J = 8.65 Hz, 2H), and 7.87 (s, 1H).
To a solution of ethyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)oxazole-4-carboxylate (0.060 g, 0.108 mmol) in tetrahydro-
furan (2.0 mL) and water (1.0 mL) was added 1,2-propanediol
(0.016 mg, 0.216 mmol) followed by a 1N aqueous solution of
potassium hydroxide (0.270 mL, 0.270 mmol). The mixture was
stirred at room temperature for 2.5 h. The mixture was concen-
trated under reduced pressure, and the pH of the aqueous residue
was adjusted to ∼5 with acetic acid. The mixture was purified by
preparative HPLC to provide 2q as off-white solid (0.016 g, 28%).
HPLC purity 98.5%; tr = 13.69 min (method A); 98.5%; tr =
13.33 min (method B). LCMS (EI) m/z Calcd for C24H17Cl2N5O
[M þ H]þ 526.07. Found: 526.16. 1H NMR (500 MHz, CDCl3) δ
3.23 (s, 3H), 3.91-4.15 (m, 3H), 4.23 (d, J = 2.75 Hz, 1H), 4.43 (s,
1H), 6.76 (s, 3H), 7.29 (s, 1H), 7.34 (d, J = 7.70 Hz, 2H), 7.69 (d,
J = 7.15 Hz, 2H), and 7.96 (s, 1H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]oxazole-7-
carboxylic Acid (2r). To a solution of 6 (0.102 g, 0.246 mmol)
and methyl 2-chlorobenzo[d]oxazole-7-carboxylate17 (0.055 g,
0.246 mmol) in anhydrous dimethylformamide (1.5 mL) was
added diisopropylethylamine (0.128 mL, 0.738 mmol). The
reaction mixture was stirred at 100 °C for 1 h, diluted with
water, and extracted with diethyl ether. The organic layer was
collected and dried under reduced pressure to give methyl
1
550þ and 552þ. H NMR (400 MHz, CDCl3/CD3OD) δ 2.49
(s, 3H). 3.15 (s, 3H), 3.89-4.01 (m, 3H), 4.07 (t, J = 7.73 Hz, 1H),
4.22 (t, J = 10.7 Hz, 1H), 6.24 (s, 1H), 6.69 (d, J = 1.53 Hz, 2H),
7.20 (t, J = 1.53 Hz, 1H), 7.32 (d, J = 8.14 Hz, 2H), 7.60 (d, J =
8.14 Hz, 2H), and 8.68 (s, 1H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)thiazole-5-carboxylicAcid
(2p). A mixture of 6 (0.187 g, 0.450 mmol), methyl 2-bromothia-
zole-5-carboxylate (0.111 g, 0.500 mmol), and diisopropylamine
(0.10 mL) in dimethylacetamide was stirred at 105 °C for 4.5 h.
After cooling, the mixture was added dropwise to ice water (50 mL).
The resulting precipitate was collected by vacuum filtration, washed
with water (3ꢀ), and dried to give methyl 2-((5S,9R)-9-(4-cyano-
phenyl)-3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-tri-
azaspiro[4.4]nonan-7-yl)thiazole-5-carboxylate (0.215 g, 86%).
HPLC purity >95%; tr = 3.60 min (method D). LCMS (EI) m/z
Calcd for C25H19Cl2N5O4S [M þ H]þ 556.06. Found: 556.08. 1H
NMR (500 MHz, CDCl3) δ 3.25 s, 3H), 3.83 (s, 3H), 4.06-4.15
(m, 3H), 4.33-4.41 (m, 2H), 6.82 (d, J = 2.03 Hz, 2H), 7.43 (s,
1H), 7.52 (d, J = 8.65 Hz, 2H), 7.78 (d, J = 8.14 Hz, 2H), and
7.93 (s, 1H).
To a mixture of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-
(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]-
nonan-7-yl)thiazole-5-carboxylate (0.040 mg, 0.072 mmol) in
tetrahydrofuran (2.0 mL) and water (1.0 mL) was added 1,2- pro-
panediol (0.011 g, 0.144 mmol) followed by a 1N aqueous solution
of potassium hydroxide (0.180 mL, 0.180 mmol). The mixture was
stirred at room temperature overnight. After adjusting the pH to
4-5, the mixture was concentrated under reduced pressure. The
residue was diluted with water (20 mL) and extracted with
dichloromethane (3ꢀ). The organic layer was washed with water,
dried over anhydrous sodium sulfate, and concentrated under
reduced pressure. The residue was purified by preparative HPLC
to give (2p, 16.0 mg, 41%) as white solid (41%). HPLC purity
98.9%; tr = 14.57 min (method A); 97.8%; tr = 13.96 min (method
B). LCMS (EI) m/z Calcd for C24H17Cl2N5O4S [M þ H]þ 542.05.
Found: 542.18. 1H NMR (500 MHz, CD3OD) δ 3.25 (s, 3H), 4.08
(m, 3H), 4.37 (m, 2H), 6.82 (d, J = 1.65 Hz, 2H), 7.42 (s, 1H), 7.52
(d, J = 8.25 Hz, 2H), 7.78 (d, J = 8.25 Hz, 2H), and 7.88 (s, 1H).

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3827
2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]oxazole-7-
carboxylate (0.078 g, 54%). HPLC tr = 3.83 min (method G).
LCMS (EI) m/z Calcd for C29H21Cl2N5O5 [M þ H]þ 590.10.
Found: 590þ. 1H NMR (500 MHz, CDCl3) δ 3.21 (s, 3H), 3.92
(s, 3H), 4.02 (m, 1H), 4.27 (m, 2H), 4.45 (m, 1H), 4.55 (m, 1H),
6.72 (d, J = 1.65 Hz, 2H), 7.24 (m, 2H), 7.32 (d, J = 8.25 Hz,
2H), 7.58 (d, J = 8.25 Hz, 1H), 7.64 (d, J = 8.25 Hz, 2H), and
7.67 (d, J = 8.25 Hz, 1H).
To a solution of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)benzo[d]oxazole-7-carboxylate (0.075 g, 0.127 mmol) in
anhydrous tetrahydrofuran (4.0 mL) and water (2.0 mL) was
added 1,2-propanediol (0.171 mL) and 1.0 M aqueous potassium
hydroxide (0.302 mL). After stirring at room temperature for
16 h, the reaction mixture was concentrated under reduced
pressure, and the resulting residue was purified by preparative
HPLC followed by neutralization with an ion-exchange resin
to give 2r (22.4 mg, 31%) as a white solid. HPLC purity 98.8%;
tr = 14.37 min (method A); 98.7%; tr = 13.81 min (method B).
LCMS (EI) m/z Calcd for C28H19Cl2N5O5 [M þ H]þ 576.08.
Found: 576þ. 1H NMR (500 MHz, DMSO-d6) δ 3.19 (s, 3H),
4.10-4.34 (m, 5H), 6.81 (m, 2H), 7.22 (m, 1H), 7.48 (m, 4H),
7.64 (s, 1H), and 7.88 (d, J = 8.0 Hz, 2H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]oxazole-6-
carboxylic Acid (2s).To a solution 6(0.102 g, 0.246 mmol) and methyl
2-chlorobenzo[d]oxazole-6-carboxylate17 (0.055 g, 0.246 mmol) in
anhydrous dimethylformamide (1.5 mL) was added diisopropylethyl-
amine (0.128 mL, 0.738 mmol). The reaction mixture was stirred at
100 °C for 1 h, diluted with water, and extracted with diethyl ether.
The organic layer was collected and dried under reduced pressure to
give methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-
methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]oxazole-
6-carboxylate (0.140 g, 97%). HPLC tr = 3.86 min (method G).
LCMS (EI) m/z Calcd for C29H21Cl2N5O5 [M þ H]þ 590.10.
Found: 590þ. 1H NMR (500 MHz, CDCl3) δ 3.26 (s, 3H), 3.90 (s,
3H), 4.33 (m, 2H), 4.60 (m, 3H), 6.73 (s, 2H), 7.19 (s, 1H), 7.28 (d,
J = 8.0 Hz, 2H), 7.40 (d, J = 8.0 Hz, 1H), 7.62 (d, J = 8.0 Hz, 2H),
7.90 (d, J = 8.0 Hz, 1H), and 8.00 (s, 1H).
To a solution of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)benzo[d]oxazole-6-carboxylate (0.140 g, 0.237 mmol) in
anhydrous tetrahydrofuran (11.5 mL) and water (5.75 mL) was
added 1,2-propanediol (0.684 mL) and 1.0 M aqueous potassium
hydroxide (0.603 mL). After stirring at room temperature for
16 h, the reaction mixture was concentrated under reduced pres-
sure, and the resulting residue was purified by preparative HPLC
followed by neutralization with ion-exchange resin to provide 2s
(11.6 mg, 8.5%) as a white solid. HPLC purity 94.5%; tr = 11.50
min (method A; column: SunFire C18 3.5 μ 3.0 mm ꢀ 150 mm);
94.5%; tr = 11.06 min (method B; column: Xbridge Ph 3.5 μ 3.0
mm ꢀ 150 mm); LCMS (EI) m/z Calcd for C28H19Cl2N5O5 [M þ
H]þ 576.08. Found: 576þ. 1H NMR (500 MHz, DMSO-d6) δ 3.19
(s, 3H), 4.17 (m, 1H), 4.28 (m, 2H), 4.38 (m, 2H), 6.80 (m, 2H), 7.40
(d, J = 8.25 Hz, 1H), 7.48 (d, J = 8.25 Hz, 2H), 7.65 (m, 1H), 7.86
(m, 1H), 7.89 (d, J = 8.25 Hz, 2H), and 7.93 (s, 1H).
LCMS (EI) m/z Calcd for C29H21Cl2N5O5 [M þ H]þ 590.10.
Found: 590þ. 1H NMR (500 MHz, CDCl3) δ 3.26 (s, 3H), 3.92
(s, 3H), 4.13-4.60 (m, 5H), 6.76 (m, 2H), 7.29 (s, 1H), 7.34
(m, 3H), 7.68 (d, J = 7.2 Hz, 2H), 7.80 (d, J = 8.0 Hz, 1H), and
8.07 (s, 1H).
To a solution of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)benzo[d]oxazole-5-carboxylate (0.080 g, 0.135 mmol) in
anhydrous tetrahydrofuran (4.0 mL) and water (2.0 mL) was
added 1,2-propanediol (0.182 mL) and 1.0 M aqueous potassium
hydroxide (0.322 mL). After stirring at room temperature for
16 h, the reaction mixture was concentrated under reduce pres-
sure, and the resulting residue was purified by preparative HPLC
followed by neutralization with ion-exchange resin to afford 2t
(8.0 mg, 10%) as a white solid. HPLC purity94.7%; tr = 7.04 min
(method F); 97%; tr = 3.53 min (method E). LCMS (EI) m/z
1
Calcd for C28H19Cl2N5O5 [M þ H]þ 576.08. Found: 576þ. H
NMR (500 MHz, DMSO-d6) δ3.12 (s, 3H), 4.08 (m, 1H), 4.19 (m,
2H), 4.31 (m, 2H), 6.73 (m,2H), 7.41 (d, J =8.25 Hz, 2H), 7.46 (d,
J = 8.25 Hz, 1H), 7.58 (m, 1H), 7.64 (d, J = 8.25 Hz, 1H), 7.77
(m, 1H), and 7.82 (d, J = 7.7 Hz, 2H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]thiazole-7-
carboxylic Acid (2u). To copper(II) bromide (0.200 g, 0.860 mmol)
in anhydrous acetonitrile (2.0 mL) was added tert-butyl nitrite
(0.12 mL, 1.08 mmol) atroom temperatureovera periodof3 min.
After stirring for 5 min at room temperature, methyl 2-amino-
benzothiazole-7-carboxylate (0.150 g, 0.720 mmol) was added,
and the reaction mixture was heated at 70 °C for 2 h. The reaction
mixture was cooled, concentratedunder reduced pressure, diluted
with ethyl acetate (10 mL), and filtered over a pad of celite. The
filtrate was washed with brine (2 ꢀ 25 mL), dried over sodium
sulfate, and concentrated to give methyl 2-bromobenzo[d]thiazole-
7-carboxylate as a yellow solid (25, 0.036 g). The compound was
used without further purification
Methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-
1-methyl-2,4-dioxo-1,3,7-triazaspiro-[4.4]nonan-7-yl)benzo-
[d]thiazole-7-carboxylate was prepared as described in the prepara-
tion of 2o starting from the spirocyclic pyrrolidine (6, 0.045 g, 0.108
mmol) and methyl 2-bromobenzo[d]thiazole-7-carboxylate (25) to
give the desired product (0.025 g; 31%). HPLC purity 93%; tr =
4.09 min (method E). LCMS (EI) m/z Calcd for C29H21Cl2N5O4S
[M þ H]þ 606.08. Found: 606þ. 1H NMR (400 MHz, CDCl3) δ
3.27 (s, 3H), 4.01 (s, 3H), 4.03-4.16 (m, 2H), 4.18-4.30 (m, 2H),
4.46-4.56 (m, 1H), 6.79 (d, J = 1.51 Hz, 2H), 7.29-7.32 (m, 1H),
7.39 (m, 3H), 7.44 (2H, t, J = 7.81 Hz, 2H), and 7.84 (dd, J =
14.10, 8.06 Hz, 2H).
To methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-
1-methyl-2,4-dioxo-1,3,7-triaza-spiro[4.4]nonan-7-yl)benzo-
[d]thiazole-7-carboxylate (0.013 g, 0.020 mmol) in dimethylform-
amide (1.0 mL) was added lithium chloride (0.100 g), and the
contents were heated at 115 °C for 3 h. The reaction mixture was
cooled to room temperature, and acetic acid (3.0 mL) and water
(3.0 mL) were added. The resulting precipitate was collected by
vacuum filtration and dried in a vacuum oven at 50 °C for 50 h
to give 2u as a white solid (0.011 g; 86%). HPLC purity 97.4%;
tr = 11.51 min (method A; column: SunFire C18 3.5 μ 3.0 mm ꢀ
150 mm); 96.5%; tr = 11.22 min (method B; column: Xbridge Ph
3.5 μ 3.0 mm ꢀ 150 mm). LCMS (EI) m/z Calcd for C28H19Cl2-
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]oxazole-5-
carboxylic Acid (2t). Toa solutionof 6 (0.106g, 0.256 mmol)and
methyl 2-chlorobenzo[d]oxazole-5-carboxylate17 (0.055 g, 0.256
mmol) in anhydrous dimethylformamide (1.5 mL) was added
diisopropylethylamine (0.134 mL, 0.768 mmol). The reaction
mixture was stirred at 100 °C for 1 h, diluted with water, extracted
with diethyl ether, and dried under reduced pressure. The result-
ing residuewaspurified by flashsilica gel chromatography usinga
97:3 mixture of dichloromethane and methanol to give methyl
2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]oxazole-5-
carboxylate (0.083 g, 55%). HPLC tr = 3.76 min (method G).
1
N5O4S [M þ H]þ 592.06. Found: 592þ. H NMR (400 MHz,
DMSO-d6) δ 3.23 (s, 3H), 4.11-4.40 (m, 4H), 4.41-4.55 (m, 1H),
6.75-6.88 (m, J = 1.51 Hz, 2H), 7.41-7.55 (m, 3H), 7.64-7.69
(m, 1H), 7.75 (dd, J = 12.34, 7.30 Hz, 2H), and 7.91 (d, J =
8.06 Hz, 2H).
2-((5S,9R)-9-(4-Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]thiazole-6-
carboxylic Acid (2v). A mixture of 6 (0.100 g, 0.241 mol), methyl
2-bromobenzo[d]thiazole-6-carboxylate (0.072 g, 0.265 mmol),
and diisopropylamine (0.084 mL, 0.482 mmol) in anhydrous
dimethylformamide (3.0 mL) was heated at 100 °C overnight.

3828 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
The reaction mixture was cooled to room temperature, and water
was added until a precipitate formed. The solid was collected by
vacuum filtration, washed withwater, and dried to give a tan solid.
Purification by flash silica gel chromatography afforded methyl
2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-
2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-7-yl)benzo[d]thiazole-6-
carboxylate (0.064 g) as an off-white solid. HPLC purity 98%;
tr = 3.64 min (method D). LCMS (EI) m/z Calcd for C29H21-
Cl2N5O4S [M þ H]þ 606.08. Found: 606.39 and 608.30. 1H
NMR (500 MHz, CDCl3) δ 2.06 (s, 3H), 2.97 (s, 3H), 4.18 (d,
J = 11.6 Hz, 1H), 4.28 (t, J = 13.8 Hz, 1H), 4.35-4.37 (m, 3H),
7.20 (s, 2H), 7.34-7.36 (m, 3H), 7.63 (d, J = 8.25 Hz, 1H), 7.69
(d, J = 8.25 Hz, 2H), 8.10 (d, J = 9.35 Hz, 1H), and 8.43 (s, 1H).
A mixture of methyl 2-((5S,9R)-9-(4-cyanophenyl)-3-(3,5-
dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-triazaspiro[4.4]nonan-
7-yl)benzo[d]thiazole-6-carboxylate (0.037 g, 0.061 mmol) and
lithium iodide (0.250 g) inanhydrous dimethylacetamide (1.0 mL)
was heated at 140 °C overnight. The reaction was cooled to room
temperature, and acetic acid (∼12 drops from a pipet) was added
followed by water (3.0 mL). The dimethylformamide was
removed under reduced pressure, and the resulting residue
was purified by preparative HPLC to give 2v (14 mg) as a
white solid. HPLC purity 96.6%; tr = 14.69 min (method A);
96.7%; tr = 14.17 min (method B). LCMS (EI) m/z Calcd for
C28H19Cl2N5O4S [M þ H]þ 592.06. Found: 592.09 and 594.07.
1H NMR (500 MHz, DMSO-d6) δ 3.26 (s, 3H), 4.03-4.25 (m,
4H), 4.50 (t, J = 10.72 Hz, 1H), 6.79 (s, 2H), 7.29 (s, 1H), 7.37 (d,
J = 8.25 Hz, 2H), 7.65 (d, J = 8.25 Hz, 1H), 7.69 (d, J = 7.70 Hz,
2H), 8.09 (d, J = 8.80 Hz, 1H), and 8.40 (s, 1H).
TNFR-activated b.END3 cells in the presence or absence of
BMS-688521 or antimouse LFA-1 Ab. The monolayers were
washed, and adhesion of calcein-labeled T-cells was determined
by reading plates on a Cytofluor. Adhesion in the presence of
vehicle alone was considered equivalent to 0% inhibition. Adhe-
sion in the presence of an excess (10 μg/mL) of antimouse LFA-1
Ab (M17) was considered equivalent to 100% inhibition.
Human Mixed Lymphocyte Reaction (MLR) Assay. Periph-
eral blood mononuclear cells (PBMC) were obtained by density-
gradient separation (Lymphocyte Separation Media; Mediatech
Inc., Herndon, VA) of EDTA-treated whole blood from normal
healthy donors. T-cells were prepared from Eþ fractions of
PBMC rosetted with sheep red blood cells (SRBC, Colorado
Serum Company; Denver, CO). T-cells were cultured at 1 ꢀ 105
cells/well in quadruplicate wells together with 1 ꢀ 105 of irradiated
allogeneic PBMCs as antigen-presenting cells (APCs) in 96-well
round-bottom plates in a total volume of 200 μL of 10% FCS-
RPMI. Compounds were added to the cell mixture at the initiation
of the response. On day 4 after initiation of the MLR, cultures were
3
pulsed with one μCi of [H]-thymidine (PerkinElmer, Boston,
MA) for 6 h, harvested on a Packard cell harvester (PerkinElmer),
and counted by liquid scintillation on a Packard TopCount NXT
(PerkinElmer). Proliferation was determined by incorporation of
the 3H label into DNA.
Human Whole-Blood IL-2 mRNA Determination. A whole
blood IL-2 mRNA assay was used to further characterize
compound 2e. The IL-2 assay was conducted on heparinized
whole blood that had been activated with SEB. This response
can be blocked with anti-LFA-1 antibody, demonstrating that
SEB-induced IL-2 mRNA production is LFA-1-dependent. For
this assay, total RNA was isolated from whole blood leukocytes
at 6 h post SEB-induced activation by using the QIAamp RNA
Blood Mini Kit (Qiagen, Valencia, CA) according to the manu-
facturer’s instructions. The IL-2 mRNA was quantified by real-
time polymerase chain reaction (RT-PCR) using SYBR Green I
reagent (Applied Biosystems, Foster City, CA) (30), and GAPDH
mRNA as an internal standard. Specifically, 500 ng of RNA was
used to make cDNA using SuperScript II RNase H (Invitrogen,
Carlsbad CA) reverse transcriptase with oligo (dT)12-18 primer
(Invitrogen, Carlsbad CA). IL-2 message was detected with the
forward primer CTGCTGGATTTACAGATGATTTTGA and
the reverse primer TTGGGCATGTAAAACTTAAATGTGA.
The primers used to detect GAPDH message were AATTC-
CATGGCACCGTCAAG (forward primer) and GAAGACGC-
CAGT-GGACTCCA (reverse primer). IC50 values were calculated
using the ΔΔCT method to determine relative IL-2 mRNA levels.
OVA Lung Inflammation in Mice. BALB/c female mice, 6-8
week of age, (Harlan, Indianapolis, IN) were immunized in-
traperitoneally with 100 μg of ovalbumin (OVA; Sigma) in alum
adjuvant (Pierce) and similarly boosted 14 days later. Fourteen
days after the booster, the mice were challenged intranasally
with 100 μg OVA in 50 μL of pyrogen-free saline. Seventy-two
hours after challenge, mice were killed by barbiturate overdose,
and the lungs were lavaged via a tracheostomy with 1 mL of ice-
cold Hank’s balanced salt solution (Caþþ- and Mgþþ-free)
containing 10% fetal bovine serum. Total recovered leukocytes
were enumerated by electronic cell counter (Scharfe System,
Reutingen, Germany). Cytocentrifuge smears (Shandon, Pittsburgh)
were stained with Wright’s Giemsa stain, and 200 cells per sample
were classified by microscopic differential
4-((5S,9R)-3-(3,5-Dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-
triazaspiro[4.4]nonan-9-yl)benzonitrile (6). The detailed proce-
dure for the preparation of 6 is outlined in refs 6b and 11.
The retention times on the Chiralpak-AD column and specific
rotations for these compounds are as follows: enatiomeric
excess >99%.; tR = 5.74 min [Chiralpak-AD column (7.5 cm ꢀ
30 cm) under SFC conditions (70% CO2/30% MeOH)]; specific
rotation: [ R ]D = þ95.2 (c = 1, MeOH).
HUVEC:Human T-Cell Adhesion Assay. PBMCs were iso-
lated from human peripheral blood and T cells expanded with
phytohemoagglutinin (PHA). HUVEC were obtained from
Clonetics (San Diego, CA), grown to confluence in 96-well
plates and stimulated overnight with PMA to increase ICAM-
1 expression. PHA blasts were labeled with calcein-AM accord-
ing to the manufacturer’s instructions (Invitrogen, Carlsbad,
CA) and treated with PMA to increase LFA-1 avidity. PHA
blasts were then added to the activated HUVEC monolayer in
the presence or absence of compound or an excess of anti-LFA-1
antibody. The monolayers were washed and adhesion of calcein-
labeled cells was determined by reading plates on a Cytofluor
(fluorescence plate reader; excitation 485/emission 530 nm).
Adhesion in the presence of vehicle control was considered
equivalent to 0% inhibition. Adhesion in the presence of an
excess of antihuman LFA-1 antibody was considered equivalent
to 100% inhibition.
b.END3 Mouse T-Cell Adhesion Assay. Given the observa-
tion that mouse LFA-1 fails to recognize human ICAM-118
combined with the observations of others that some LFA-1
antagonists demonstrate a preference for human LFA-1 versus
mouse LFA-1,9a a mouse adhesion assay was established to
identify compounds appropriate for in vivo evaluation. Adhe-
sion of the murine T-cells to mTNFR -activated monolayers of
the mouse b.END3 cell line was used for the mouse cell-cell
adhesion assay. Splenocytes were isolated from C57BL/6 mice
and grown for 4 d on anti-CD3 (145-2C11)/anti-CD28 (3N7)-
coated plates. The T-cells were then transferred to uncoated
plates and grown overnight in IL-2-containing media. Prior to
adhesion assays, the expanded mouse T-cells were harvested,
resuspended in HBSS, labeled with calcein-AM, and then trea-
ted with PMA to increase the avidity of LFA-1. These activated,
calcein-labeled T-cells were then added to a monolayer of
X-ray Crystallography. The I-Domain of LFA-1 was incu-
bated overnight at 4 °C with a 2.1 molar excess of ligand. Crystals
were grown by hanging drop vapor diffusion with a drop con-
sisting of 1 μL of protein/ligand solution and 1 μL of reservoir
solution, whichcontained0.1Msodiumcitrate, pH 5.6, 80%(v/v)
saturated sodium citrate, which was not titrated, and 3%(v/v)
ethylene glycol. The crystal was prepared for flash cooling by
placing the crystal in a solution consisting 80% reservoir solution
and 20% ethylene glycol and then plunging the looped crystal
into liquid nitrogen. Data were collected using a Rigaku FR-E

Article
Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9 3829
Table 7. X-ray Crystallography Data Collection and Refinement
Statistics
of psoriasis: a focus on Efalizumab. Expert Opin. Biol. Ther. 2003, 3,
361–370. (d) Dedrick, R. L.; Walicke, P.; Garovoy, M. Anti-adhesion
antibodies Efalizumab, a humanized anti-CD11a monoclonal antibody.
Transplant Immunol. 2002, 9, 181–186.
space group
˚
P212121
40.6
a, A
(5) Liu, G. Inhibitors of LFA-1/ICAM-1 interaction: From mono-
clonal antibodies to small molecules. Drugs Future 2001, 26,
767-778 and references cited therein.
˚
b, A
˚
c, A
63.6
63.1
(6) Dodd, D. S.; Sheriff, S.; Chang, C.-Y. J.; Stetsko, D. K.; Phillips,
L. M.; Zhang, Y.; Launay, M.; Potin, D.; Varcarro, W.; Poss,
M. A.; McKinnon, M.; Barrish, J. C.; Suchard, S. J.; Dhar, T. G. M.
Design of LFA-1 agonists based on a 2,3-dihydro-1H-pyrrolizin-
5(7aH)-one scaffold. Bioorg. Med. Chem. Lett. 2007, 17, 1908–1911.
(b) Potin, D.; Launay, M.; Monatlik, F.; Malabre, P.; Fabreguette, M;
Fouquet, A.; Maillet, M.; Nicolai, E.; Dorgeret, L.; Chevallier, F.; Besse,
D.; Dufort, M.; Caussade, F.; Ahmad, S. Z.; Stetsko, D. K.; Skala, S.;
Davis, P. M.; Balimane, P.;Patel, K.; Yang, Z.; Marathe, P.;Postelneck, J.;
Townsend, R. M.; Goldfarb, V.; Sherriff, S.; Einspahr, H.; Kish, K.;
Malley, M. F.; DiMarco, J. D.; Gougoutas, J. Z.; Kadiyala, P.; Cheney,
D. L.; Tejwani, R. W.; Murphy, D. K.; McIntyre, K. W.; Yang, X.; Chao,
S.; Leith, L.; Xiao, Z.; Mathur, A.;Chen, B.-C.; Wu, D.-R.; Traeger, S. C.;
McKinnon, M.; Barrish, J. C.; Robl, J. A.; Iwanowicz, E. J.; Suchard,
S. J.; Dhar, T. G. M. Discovery and Development of 5-[(5S,9R)-9-(4-
Cyanophenyl)-3-(3,5-dichlorophenyl)-1-methyl-2,4-dioxo-1,3,7-tria-
zaspiro [4.4]non-7-yl]methyl]-3-thiophenecarboxylic acid (BMS-
587101);A small molecule antagonist of leukocyte function
associated antigen-1. J. Med. Chem. 2006, 49, 6946–6949. (c) Potin,
D.; Launay, M.; Nicolai, E.; Fabreguette, M.; Malabre, P.; Caussade,
F.; Besse, D.; Skala, S.; Stetsko, D. K.; Todderud, G.; Beno, B. R.;
Cheney, D. L.; Chang, C. J.; Sheriff, S.; Hollenbaugh, D. L.; Barrish,
J. C.; Iwanowicz, E. J.; Suchard, S. J.; Dhar, T. G. M. De novo design,
synthesis and in vitro activity of LFA-1 antagonists based on a
bicyclic[5.5]hydantoin scaffold. Biorg. Med. Chem. Lett. 2005, 15,
1161–1164.
(7) (a) Wattanasin, S.; Kallen, J.; Myers, S.; Guo, Q.; Sabio, M.;
Ehrhardt,C.;Albert,R.;Hommel, U.;Weckbecker, G.;Welzenbach,
K.; Weitz-Schmidt, G. 1,4-Diazepane-2,5-diones as novel inhibitors
of LFA-1. Bioorg. Med. Chem. Lett. 2005, 15, 1217–1220. (b) Wu,
J.-P.; Emeigh, J.; Gao, A. A.; Goldberg, D. R.; Kuzmich, D.; Miao, C.;
Potocki, I.; Qian, K. C.; Sorcek, R. J.; Jeanfavre, D. D.; Kishimoto, K.;
Mainolfi, E. A.; Nabozny, G.; Peng, C.; Reilly, P.; Rothlein, R.; Sellati,
R. H.; Woska, J. R.; Chen, S.; Gunn, J. A.; O'Brien, D.; Norris, S. H.;
Kelly, T. A. Second-generation lymphocyte function-associated antigen-1
inhibitors: 1H-Imidazo[1,2-a]imidazol-2-one derivatives. J. Med. Chem.
2004, 47, 5356–5366. (c) Gadek, T. R.; Burdick, D. J.; McDowell, R. S.;
Stanley, M. S.; Marsters, J. C., Jr.; Paris, K. J.; Oare, D. A.; Reynolds,
M. E.; Ladner, C.; Zioncheck, K. A.; Lee, W. P.; Gribling, P.; Dennis,
M. S.; Skelton, N. J.; Tumas, D. B.; Claark, K. R.; Keating, S. M.;
Beresini, M. H.; Tilley, J. W.; Presta, L. G.; Bodary, S. C. Generation of an
LFA-1 antagonist by the transfer of ICAM-1 immunoregulatory epitope to
a small molecule. Science 2002, 295, 1086–1089. (d) Sircar I.; Furth, P.;
Teegarden, B. R.; Morningstar, M.; Smith, N.; Griffith, R. Patent WO
0130781 (Tanabe Seiyaku) 2001. (e) Weitz-Schmidt, G.; Welzenbach, K.;
Brinkmann, V.; Kamata, T.; Kallen, J.; Bruns, C.; Cottens, S.; Takada, Y.;
Hommel, U. Statins selectively inhibit leukocyte function antigen-1 by
binding to a novel regulatory integrin site. Nat. Med. 2001, 7, 687–692.
(f) Kelly, T. A.; Jeanfavre, D. D.; McNeil, D. W.; Woska, R. J.; Reilly, L. P.;
Mainolfi, E. A.; Kishimoto, K. M.; Nabozny, G. H.; Zinter, R.; Bormann,
B.; Rothlein, R. Cutting edge: A small molecule antagonist of LFA-1
mediated cell adhesion. J. Immunol. 1999, 163, 5173–5177.
overall
last
˚
resolution, A
50-1.85
91910
13552
6.8
1.92-1.85
g6398
1089
measured
unique
redundancy
% complete
R value
6.6
76.8
93.3
0.86
0.310
5.8
I/σI
23.0
Rwork
Rfree
0.192
0.227
0.006
1.1
˚
rmsd bond distances, A
rmsd bond angles, deg
equipped with MicroMax optics and a Rigaku Saturn92 detector.
The data was processed with HKL200019 and had symmetry
consistent with space group P212121 and unit cell parameters of
˚
˚
˚
a = 40.6 A, b = 63.6 A, and c = 63.1 A (the inverted distance
order of the b and c axes kept the same indexing as a canonical
data set where the c axis was longer than the b axis). A cycle of
rigid body fitting was carried out with the CCP4 version of
AMoRe.20 Refinement was performed with CNX21 starting with
a cycle of rigid body refinement and followed by an annealing
protocol and individual B-factor refinement. QUANTA22 was
used for examining the model and the electron density maps. The
ligand was placed by the X-ligand module of QUANTA,22 and
water molecules were placed by examination. Electron density
map fitting was alternated with refinement of the model with
CNX using only minimization and individual B factor refinement
until no significant electron density was uninterpreted. The final
R
work was 0.219 and Rfree was 0.255. The rmsd for bond distances
˚
was 0.007 A and the rmsd for bond angles was 1.4° (Table 7).
References
(1) (a) Hogg, N.; Henderson, R.; Leitinger, B.; McDowall, A.; Porter,
J.; Stanley, P. Mechanisms contributing to the activity of integrins
on leukocytes. Immunol. Rev. 2002, 186, 164–171. (b) Smith, A.;
Stanley, P.; Jones, K.; Svensson, L.; McDowall, A.; Hogg, N. The role
of the integrin LFA-1 in T-lymphocyte migration. Immunol. Rev. 2007,
218, 135–146. (c) Welzenbach, K.; Hommel, U.; Weitz-Schmidt, G.
Small molecule inhibitors induce conformational changes in the
I Domain and the I-like domain of lymphocyte function-associated
antigen-1. J. Biol. Chem. 2002, 277, 10590–10598.
(2) (a) Shimaoka, M.; Springer, T. A. Therapeutic antagonists and the
conformational regulation of the β2 intergrins. Curr. Top. Med.
Chem. 2004, 4, 1485–1495. (b) Shimaoka, M.; Xiao, T.; Liu, J.-H.;
Yang, Y.; Dong, Y.; Jun, C.-D.; McCormiack, A.; Zhang, R.; Joachimak,
A.; Takagi, J.; Wang, J.-H.; Springer, T. A. Structures of the aL I Domain
and its complex with ICAM-1 reveal a shape-shifting pathway for
integrin regulation. Cell 2003, 112, 99–111. (c) Ma, Q.; Shimaoka, M.;
Lu, C.; Jing, H; Carman, C. V.; Springer, T. A. Activation-induced
conformational changes in the I Domain region of lymphocyte function-
associated antigen-1. J. Biol. Chem. 2002, 277, 10638–10641. (d) Salas,
A.; Shimaoka, M.; Chen, S.; Carman, C. V.; Springer, T. Transition from
rolling to firm adhesion is regulated by the conformation of the I Domain
of the integrin lymphocyte function-associated antigen-1. J. Biol. Chem.
2002, 277, 50255–50262. (e) Takagi, J.; Springer, T. A. Integrin activa-
tion and structural rearrangement. Immunol. Rev. 2002, 186, 141–163.
(3) Berlin-Rufenach, C.; Otto, F.; Mathies, M.; Westermann, J.;
Owen, M. J.; Hamann, A.; Hogg, N. Lymphocyte Migration in
Lymphocyte Function-Associated Antigen (LFA)-1-deficient
Mice. J. Exp. Med. 1999, 189, 1467–1478.
(8) Last-Barney, K.; Davidson, W.; Cardozo, M.; Frye, L. L.; Grygon,
C. A.; Hopkins, J. L.; Jeanfavre, D. D.; Pav, S.; Qian, C.; Stevenson,
J. M.; Tong, L.; Zindell, R.; Kelly, T. A. Binding site elucidation of
hydantoin-based antagonists of LFA-1 using multidisciplinary tech-
niques: Evidence for the allosteric inhibition of a protein-protein
interaction. J. Am. Chem. Soc. 2001, 125, 5643–5650.
(9) Similar results were seen with a Boehringer-Igelheim series of LFA-
1 antagonists. (a)Winquist, R. J.; Desai, S.; Fogal, S.; Haynes, N. A.;
Nabozny, G. H.; Reilly, P. L.; Souza, D.; Panzenbeck, M. The role
of leukocyte function-associated antigen-1 in animal models of
inflammation. Eur. J. Pharmacol. 2001, 429, 297–302. (b) Panzenbeck,
M. J.; Jeanfavre, D. D.; Kelly, T. A.; Lemieux, R.; Nabozny, G.; Reilly,
P. L.; Desai, S. An orally active, primate selective antagonist of LFA-1
inhibits delayed-type hypersensitivity in a humanized-mouse model. Eur.
J. Pharmacol. 2006, 534, 233–240.
(10) Sushard, S. J.; Stetsko, D. K.; Davis, P. M.; Skala, S.; Potin, D.;
Launay, M.; Dhar, T. G. M.; Barrish, J. C.; Susulic, V.; Shuster,
D. J.; McIntyre, K. W.; McKinnon, M.; Salter-Cid, L. An LFA-1
(aL,b2) small-modecule antagonist reduces inflammation and joint
destruction in murine models of arthritis. J. Immunol. 2010, 184,
3917–3926.
(4) (a) Selenko-Gebauer, N.; Karlhofer, F.; Stingl, G. Efalizumab in
routine use: a clinical experience. Br. J. Dermatol. 2007, 156, 1–6.
(b) Lebwohl, M.; Tyring, S. K.; Hamilton, T. K.; Toth, D.; Glazer, S.;
Tawfik, N. H.; Walicke, P.; Dummer, W.; Wang, X.; Garovoy, M. R.;
Pariser, D. A novel targeted T-cell modulator, Efalizumab, for plaque
psoriasis. N. Engl. J. Med. 2003, 349, 2004–2013. (c) Cather, J. C.;
Cather, J. C.; Menter, A. Modulating T cell responses for the treatment
(11) Dhar, T. G. M.; Launay, M.; Potin, D; Watterson, S. H., Xiao, Z.
Pyridyl-substituted spiro-hydantoin compounds and their preparation,

3830 Journal of Medicinal Chemistry, 2010, Vol. 53, No. 9
Watterson et al.
pharmaceutical compositions and use for treatment of immune and
inflammatory diseases. US 7186727 2007; Chem. Abstr. 2006,145, 83333.
(12) Jiang, L.; Buchwald, S. L. Palladium catalyzed aromatic carbon-
nitrogen bond formation. In Metal-Catalyzed Cross-Coupling
Reactions, 2nd ed.: De Meijere, A., Diederich, F., Eds.; Wiley-VCH:
Weinheim, Germany, 2004; pp 699-760.
(13) Chan, D. M. T.; Monaco, K. L.; Li, R.; Bonne, D.; Clark, C. G.;
Lam, P. Y. S. Copper promoted C-N and C-O bond cross-
coupling with phenyl and pryidylboronates. Tetrahedron Lett.
2003, 44, 3863–3865.
(14) (a) Ohta, K.; Kawachi, E.; Inoue, N.; Fukasawa, H.; Hashimoto,
Y.; Itai, A.; Kagechika, H. Retinoidal pyrimidinecarboxylic acids.
Unexpected diaza-substituent effects in retinobenzoic acids. Chem.
Pharm. Bull. 2000, 48, 1504–1513. (b) Takamizawa, A.; Hirai, K.
Pyrimidine derivatives, XXX1. Reactions of ethyl 2-methoxy-methy-
lene-3-ethoxypropionate with ureas. Chem. Pharm. Bull. 1964, 12,
804–808.
(15) (a) McOmie, J. F. W; White, I. M. Pyrimidines. Part VI.
5-Bromopyrimidine. J. Chem. Soc. 1953, 3129–3131. (b) Kim,
C.-H.; Marquez, V. E.; Mao, D. T.; Haines, D. R.; McCormack, J. J.
Synthesis of pyrimidine-2-one nuclorsides as acid-stable inhibitors of
cytidine deaminase. J. Med. Chem. 1986, 29, 1374–1380. (c) Clark,
M. P.; Laufersweiler, M. J.; Djung, J. F.; Natchus, M. G.; De, B. Preparation
of 3-(pyrimidin-4-yl)-6,7-dihydro-5H-pyrazolo[1,2-a]pyrazol-1-ones for
control of inflammatory cytokines. Patent WO 2003024971 A1
20030327, 2003; Chem Abst. 2003, 138, 271694.
(16) (a) Daves, G. D.; Baiocchi, F.; Robins, R. K.; Cheng, C. C.
Pyrimidines. II. Orotic acid analogs. J. Org. Chem. 1961, 26,
2755–2763. (b) Daves, G. D.; O'Brien, D. E.; Lewis, L. R.; Cheng,
C. C. Pyrimidines. X111. 2- and 6-substituted 4-pyrimidinecarboxylic
acids (1a). J. Heterocycl. Chem. 1964, 1, 130–133.
(17) Lok, R.; Leone, R. E.; Williams, A. J. Facile rearrangements of
alkynylamino heterocyles with noble metal cations. J. Org. Chem.
1996, 61, 3289–3297.
(18) Edwards, C. P.; Champe, M.; Gonzalez, T.; Wessinger, M. E.;
Spencer, S. A.; Presta, L. G.; Berman, P. W.; Bodary, S. C.
Identification of amino acids in the CD11a I-domain important
for binding of the leukocyte function-associated antigen-1 (LFA-1)
to intercellular adhesion molecule-1 (ICAM-1). J. Biol. Chem.
1995, 270, 12635–12640.
(19) Otwinowski, Z.; Minor, W. In Methods in Enzymology, Vol. 276:
Macromolecular Crystallography Part A; Abelson, J. N., Simon,
M. I., Carter, C. W., Jr., Sweet, R. M., Eds.; Academic Press:
New York1997; pp 307-326.
(20) (a) Collaborative Computational Project, Number 4. The CCP4
Suite: programs for protein crystallography. Acta Crystallogr.,
Sect. D: Biol. Crystallogr. 1994, 50, 760-763. (b) Navaza, J. AMoRe:
an automated package for molecular replacement. Acta Crystallogr.,
Sect. A: Found. Crystallogr. 1994, 50, 157-163.
(21) CNX release 2002;, Accelrys, Inc.: San Diego, CA, 2002.
(22) QUANTA Modeling Environment release 2000; Accelrys Inc.:
San Diego, CA, 2000.