Genetic expression of an amyloid peptide fragment and analysis of formylated products

Article abstract of DOI:10.1021/ol1028145

The model amyloid peptide AAKLVFF was expressed as a His-tagged fusion protein with the immunoglobulin-binding domain B1 of streptococcal protein G (GB1), a small (56 residues), stable, single-domain protein. It is shown that expression of this model amyloid peptide is possible and is not hindered by aggregation. Formylation side reactions during the CNBr cleavage are investigated via synthesis of selectively formylated peptides.

Full text of DOI:10.1021/ol1028145

ORGANIC
LETTERS
2011
Vol. 13, No. 10
2572–2575
Genetic Expression of an Amyloid Peptide
Fragment and Analysis of Formylated
Products
G. Cheng, C. Krasel,† H. G. Zhou,§ D. Chappell, and I. W. Hamley*,‡
School of Chemistry, Food Science and Pharmacy, University of Reading, Whiteknights,
Reading RG6 6AD, U.K.
I.W.Hamley@reading.ac.uk
Received March 15, 2011
ABSTRACT
The model amyloid peptide AAKLVFF was expressed as a His-tagged fusion protein with the immunoglobulin-binding domain B1 of streptococcal
protein G (GB1), a small (56 residues), stable, single-domain protein. It is shown that expression of this model amyloid peptide is possible and is
not hindered by aggregation. Formylation side reactions during the CNBr cleavage are investigated via synthesis of selectively formylated
peptides.
Expression of proteins using recombinant DNA meth-
ods is now ubiquitous; however expression of amyloid-
forming proteins is potentially complicated by aggregation
of the peptide during or after expression. Indeed, short
amyloid forming segments can drive a nonfibrillizing
protein into the amyloid state. This was shown by Teng
and Eisenberg who demonstrated that when 6ꢀ8 residue
fragments from amyloid-forming human proteins tau,
R-synuclein, PrP prion, and amyloid β (Aβ) were inserted
into a region of the enzyme RNase A amyloid formation
occurred.1 Baxa et al. showed that fusion of the Ure2p
prion protein with various proteins led to amyloid
formation.2 The functions of the proteins (barnase,
carbonic anhydrase, glutathione S-transferase, and green
fluorescent protein) were not substantially influenced
showingthattheyretainedtheir nativestructures. Amyloid
fibrils have been used as scaffolds to present proteins such
as cytochrome c, which retains its function on fibrils
formed from a fusion construct with the amyloid forming
SH3 domain.3 It is therefore of great interest to determine
methods by which amyloid-forming short peptides can be
expressed without driving amyloid assembly of the host
protein in the fusion construct.
The Hamley group has recently investigated the self-
assembly of peptide NH2-AAKLVFF-COOH in detail.4ꢀ7
This peptide is based on sequence Aβ(16ꢀ20), KLVFF,
(3) Baldwin, A. J.; Bader, R.; Christodoulou, J.; MacPhee, C. E.;
Dobson, C. M.; Barker, P. D. J. Am. Chem. Soc. 2006, 128, 2162–2163.
(4) Castelletto, V.; Hamley, I. W.; Harris, P. J. F. Biophys. Chem.
2008, 138, 29–35.
(5) Krysmann, M. J.; Castelletto, V.; McKendrick, J. M. E.; Hamley,
I. W.; Stain, C.; Harris, P. J. F.; King, S. M. Langmuir 2008, 24,
8158–8162.
(6) Castelletto, V.; Hamley, I. W.; Harris, P. J. F.; Olsson, U.;
Spencer, N. J. Phys. Chem. B 2009, 113, 9978–9987.
(7) Hamley, I. W.; Nutt, D. R.; Brown, G. D.; Miravet, J. F.;
† Currently at Institut f€ur Pharmakologie & Toxikologie, Karl-von-Frisch-Strasse
1 35041 Marburg, Germany.
§ Current affiliation is College of Pharmacy, Nankai University, Tianjin
300071, P.R. China.
‡ Also at Diamond Light Source, Harwell Science and Innovation Cam-
pus, Chilton, Didcot OX11 0DE, U.K.
(1) Teng, P. K.; Eisenberg, D. Protein Eng., Des. Sel. 2009, 22,
531–536.
(2) Baxa, U.; Speransky, V.; Steven, A. C.; Wickner, R. B. Proc. Natl.
Acad. Sci. U.S.A. 2002, 99, 5253–5260.
´
Escuder, B.; Rodrıguez-Llansola, F. J. Phys. Chem. B 2010, 114,
940–951.
r
10.1021/ol1028145
Published on Web 04/19/2011
2011 American Chemical Society

from the amyloid β peptide, extended at the N terminus
with two hydrophobic alanine residues. In water at suffi-
ciently high concentration, this peptide forms twisted
fibrils (as observed by TEM and cryo-TEM),4,6,7 whereas
in methanol it forms nanotubes.5ꢀ7 Both of these struc-
tures have also been reported for the related peptide
Aβ(16ꢀ22), KLVFFAE, by varying the pH in aqueous
solution.8,9 The formation of β-sheet structures for
AAKLVFF in both solvents has been confirmed by FTIR,
X-ray diffraction experiments in solution and circular
dichroism (CD) spectroscopy on dried films.4ꢀ7 In dilute
solution, the CD spectra reveal the absence of β-sheet
ordering but instead show features of a disordered con-
formation with a possible contribution from aromatic
stacking interactions resulting from the phenylalanine
residues. Solution NMR experiments were used to exam-
ine the solubility of the peptide in the two solvents and to
determine the critical aggregation concentration.7
In the present paper, we report on the expression of
AAKLVFF using a recombinant protein. This work was
motivated by the desire to explore the synthesis of the
peptide on a larger scale using appropriate hosts (e.g.,
bacteria), and it provides proof-of-concept of this. It is
noted that the cyanogen bromide cleavage step leads to a
formylated peptide, and the nature of the formylated
product was investigated in detail via synthesis of
AAKLVFF formylated either just at the N terminus or
additionally at the K residue. This indicates that CNBr
produces a peptide with backbone formylation at the N
terminus. Formylation at the ε-amino group in lysine was
achieved by blocking the peptide N terminus in azido-
AAKLVFF. Formic acid/acetic anhydride did not give a
formylated product; however, successful formylation was
achieved with p-nitrophenol in a borate buffer (pH = 10)/
acetonitrile (1:1). Formylation ofpeptides and proteins has
been investigated previously;10ꢀ12 however we are not
aware of prior reports on this in the preparation of
recombinant amyloid-type peptides.
Table 1. Theoretical Analysis of Peptide Masses ([M þ H]þ)
Cleaved from GB1-AAKLVFF
Mass
Peptide sequence
6024.46
HIAAGACCTTTACAGTTACT
GAACATATGGCGGCGAAACT
GGTGTTCTTTTAAGGATCCK
TFTVTEHM
5229.86
795.48
GGTACCATGGGCAGCAGCCA
TCATCATCATCATCACACTT
ACAAATTAATCCTTAATGGT M
AAKLVFF
peak [M þ 2H]þ at 398.2419 (genetic)/398.2418 (synthetic)
(calcd 398.2426) in both spectra (SI Figure 1). In addition,
fragmention analysis confirmed the sequence AAKLVFF.
However, an ion at m/z 851.6071 was also detected in the
mass spectrum of the cleaved sequence AAKLVFF corre-
sponding to an additional mass of 56 Da which is consis-
tent with formylation of both primary amines by the
formic acid.
In order to investigate the formation of formylated by-
products in more detail, formylation of a sample of
AAKLVFF in 98% formic acid was conducted in the
presence of acetic anhydride10 in addition to a control
experiment which consisted of the formylation of synthetic
AAKLVFF in 70% formic acid with an excess of cyanogen
bromide. The experiments were both monitored by RP-
HPLC and after 6 h the formylation using 98% formic acid
displayed a new peak at 10.03 min (Peptide I, Scheme 1)
whereas, in the control experiment, a new peak was observed
at 10.59 min after 7 days (Peptide II) as shown in SI Figure 2.
Scheme 1. Formylation of Peptide AAKLVFF To Give Pep-
tides I and II
We used the GB1 fusion protein domain to express the
model amyloid forming peptide AAKLVFF. Theoreti-
cally, cleaving the GB1-AAKLVFF fusion protein se-
quence by CNBr leads to sequences shown in Table 1,
based on the UniProt Knowledgebase (Swiss-Prot and
TrEMBL).13 The corresponding peptide masses ([M þ H]þ)
from the sequence are also shown in Table 1.
The ESI-MS spectrum of the product obtained from RP-
HPLC was compared with that of synthetic AAKLVFF,
revealing the [M þ H]þ peak 795.4767 (genetic)/795.4765
(synthetic) (calcd 795.4771) and the doubly protonated
Analysis of the fragmentation peaks in the mass
spectrum of peptide I revealed the [M þ H]þ peak
823.4708 (calcd 823.4720) indicating that it was the
monoformylated product, formylated at the backbone
N terminus (Scheme 1).
In order to investigate further the single selective for-
mylation reaction, the peptide azido-AAKLVFF III
blocked at the N-terminus with 3-azidopropanoic acid
which contained only the primary amine on the lysine
side-chain was synthesized (Scheme 2). In this case,
(8) Mehta, A. K.; Lu, K.; Childers, W. S.; Liang, S.; Dong, J.; Snyder,
J. P.; Pingali, S. V.; Thiyagarajan, P.; Lynn, D. G. J. Am. Chem. Soc.
2008, 130, 9829–9835.
(9) Liang, Y.; Pingali, S. V.; Jogalekar, A. S.; Snyder, J. P.; Thiyagarajan,
P.; Lynn, D. G. Biochemistry 2008, 47 (36), 10018–10026.
(10) Dempsey, C. E. J. Chem. Soc., Perkin Trans. 1 1982, 11, 2625–
2629.
(11) Goodlett, D. R.; Armstrong, F. B.; Creech, R. J.; van Breemen,
R. B. Anal. Biochem. 1990, 186 (1), 116–120.
(12) Duewel, H. S.; Honek, J. F. J. Protein Chem. 1998, 17 (4),
337–350.
(13) http://expasy.org/tools/peptide-mass.html.
Org. Lett., Vol. 13, No. 10, 2011
2573

(Figure 1) and are reported in the experimental section
(Supporting Information).
Scheme 2. Formylation of Peptide Azido-AAKLVFF (III) To
Produce Peptide IV
The self-assembly of peptides I, II, and III was studied
using FTIR spectroscopy, circular dichroism (CD), and
cryogenic-transmission electron microscopy (cryo-TEM).
We have previously reported in detail on the self-assembly
of synthetic AAKLVFF in water, using these techniques.4,6
Figure 2 shows representative cryo-TEM images of these
peptides, showing self-assembly into fibrils. Due to inso-
lubility in water, peptide II was dissolved in a 1:1 water/
acetonitrile mixture. Peptide I exhibits short rigid fibrils,
which at high magnification can be seen to be twisted. In
contrast, peptide II shows longer, less straight fibrils which
at higher magnification do not, in general, show twisting.
The difference in morphology of these samples highlights
the influence of packing and electrostatic interactions on
the intermolecular stacking of the β-sheets. Peptide III
formed a very dense network of extended fibrils as shown
in Figure 2c. It was also necessary to dilute this sample
(compared to conditions used for I and II) in order to
image the fibrillar network by cryo-TEM. The presence of
the azido group appears to enhance fibrillization of
AAKLVFF, possibly due to enhanced hydrophobic
interactions.
formylation was not observed in 98% formic acid/acetic
anhydride; however, successful formylation to produce
peptide IV was achieved based on a method reported by
Dempsey,10 using p-nitrophenol in a borate buffer (pH =
10)/acetonitrile mixture (1:1) (Scheme 2). As a conse-
quence, formylation of peptide AAKLVFF was attempted
using these same conditions and the isolated product dis-
played an identical retention time (tR) with peptide II. The
ESI-MS spectrum of the product showed the [M þ H]þ
ion at 851.4673, thereby confirming bis-formylation, both
on the backbone and on the lysine side chain (calcd
851.4669).
The genetic AAKLVFF was isolated from its mono-
formylated (Peptide I) and bis-formylated (Peptide II)
analogues following repeated semipreparative HPLC (SI
Figure 2b). All of the 1H NMR data have been analyzed
Figure 2. Cryo-TEM images (a) monoformylated peptide I (2wt%
in H2O), (b) bis-formylated peptide II (2wt%in1:1H2O/CH3CN),
(c) azido-AAKLVFF, peptide III (0.012 wt % in H2O). The scale
bars represent 200 nm.
These fibrils are rich in β-sheets as shown by the
representative FTIR spectrum for peptide III in Figure
3a (and our previous extensive characterization of
AAKLVFF4,6,7). FTIR spectroscopy in the amide I region
provides information on the secondary structure.
Figure 3a shows a peak at 1625 cmꢀ1 associated with the
β-sheet and a smaller peak at 1672 cmꢀ1 often ascribed to
the presence of TFA counterions.14ꢀ16 The CD spectrum
Figure 1. Comparison of 1H NMR (DMSO-d6) of genetic and
synthetic AAKLVFF fragments, Peptide I (formylation on
backbone) and Peptide II (formylation on backbone and lysine
side chain).
(14) Pelton, J. T.; McLean, L. R. Anal. Biochem. 2000, 277, 167–176.
Org. Lett., Vol. 13, No. 10, 2011
2574

(Figure 3b) measured under the same conditions shows a
maximum at around 190 nm and a broad minimum
around 210 nm, also consistent with a β-sheet structure.
N terminus and on the lysine ε-amino group. Self-assembly
of mono- and bis-formylated AAKLVFF leads to fibrils
with distinct structures. A model system with an azido-
functionalized N terminus (blocked for formylation
studies) also self-assembles, with a much greater density
of fibrils than the case for the other peptides and with well
resolved β-sheet features in the FTIR and CD spectra. The
azido-functionalized peptide is also under investigation as
a building block to construct three-dimensional chemical
structures, e.g. star-type macromolecules or peptide-func-
tionalized hyperbranched molecules, by “click” chemistry.
Acknowledgment. This work was supported by EPSRC
Grant EP/F048114/1 to I.W.H. that supported GC and
EPSRC Platform Grant EP/G026203/1 that supported
DC. We thank Dr. Valeria Castelletto and Ms. Claire
Moulton (University of Reading) for assistance with FTIR
and CD spectroscopy. We are grateful to Steve Furzeland
and Derek Atkins (Unilever, Colworth, U.K.) for the cryo-
TEM experiments. We thank the University of Reading
for the award of anRETF studentship for Mr. H. G. Zhou.
Figure 3. (a) FTIR and (b) CD data for an 0.98 wt % solution of
peptide III in D2O.
In summary, we have shown that genetic engineering
methods can be used to produce a model amyloid peptide.
CNBr cleavage leads to a product that is formylated at the
(15) Gaussier, H.; Morency, H.; Lavoie, M. C.; Subirade, M. Appl.
Environ. Microbiol. 2002, 68 (10), 4803–4808.
(16) Eker, F.; Griebenow, K.; Schweitzer-Stenner, R. Biochemistry
Supporting Information Available.
Experimental
2004, 43 (22), 6893–6898.
(17) Huth, J. R.; Bewley, C. A.; Jackson, B. M.; Hinnebusch, A. G.;
Clore, G. M.; Gronenborn, A. M. Protein Sci. 1997, 6 (11), 2359–2364.
(18) Bradford, M. M. Anal. Biochem. 1976, 72 (1ꢀ2), 248–254.
(19) Choikhet, K.; Glatz, B.; Rozing, G. LCGC Eur. 2003, 16.
(20) Williams, S. J. Chromatogr., A 2004, 1052 (1ꢀ2), 1–11.
methods, scheme showing DNA sequence of fusion construct
used to synthesize GB1-AAKLVFF, electrospray mass spec-
tra, RP-HPLC chromatograms. This material is available
free of charge via the Internet at http://pubs.acs.org.
Org. Lett., Vol. 13, No. 10, 2011
2575