Synthesis and in vitro evaluation of c‐7 and c‐8 luteolin derivatives as influenza endonuclease inhibitors

Article abstract of DOI:10.3390/ijms22147735

The part of the influenza polymerase PA subunit featuring endonuclease activity is a target for anti‐influenza therapies, including the FDA‐approved drug Xofluza. A general feature of endonuclease inhibitors is their ability to chelate Mg²⁺ or

Full text of DOI:10.3390/ijms22147735

International Journal of
Molecular Sciences
Article
Synthesis and In Vitro Evaluation of C-7 and C-8 Luteolin
Derivatives as Influenza Endonuclease Inhibitors
Robert Reiberger 1,2,† , Katerˇina Radilová 1,3,† , Michal Král’ 1,3, Václav Zima 1,2, Pavel Majer 1, Jirˇí Brynda 1,4
,
Martin Dracˇínský 1 , Jan Konvalinka 1,5 , Milan Kožíšek 1,
*
and Aleš Machara 1,
*
1
Institute of Organic Chemistry and Biochemistry of the Czech Academy of Sciences, Gilead Sciences and
IOCB Research Center, Flemingovo n. 2, 166 10 Prague, Czech Republic; robert.reiberger@uochb.cas.cz (R.R.);
katerina.radilova@uochb.cas.cz (K.R.); michal.kral@uochb.cas.cz (M.K.); vaclav.zima@uochb.cas.cz (V.Z.);
pavel.majer@uochb.cas.cz (P.M.); jiri.brynda@uochb.cas.cz (J.B.); martin.dracinsky@uochb.cas.cz (M.D.);
jan.konvalinka@uochb.cas.cz (J.K.)
Department of Organic Chemistry, Faculty of Science, Charles University, Hlavova 8,
128 00 Prague, Czech Republic
First Faculty of Medicine, Charles University, Katerˇinská 1660, 121 08 Prague, Czech Republic
Institute of Molecular Genetics of the Czech Academy of Sciences, Vídenˇská 1083,
140 00 Prague, Czech Republic
Department of Biochemistry, Faculty of Science, Charles University, Hlavova 8, 128 00 Prague, Czech Republic
Correspondence: milan.kozisek@uochb.cas.cz (M.K.); ales.machara@uochb.cas.cz (A.M.);
Tel.: +420-220-183-479 (A.M.)
2
3
4
5
*
†
These authors contributed equally to this work.
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Abstract: The part of the influenza polymerase PA subunit featuring endonuclease activity is a
target for anti-influenza therapies, including the FDA-approved drug Xofluza. A general feature
of endonuclease inhibitors is their ability to chelate Mg2+ or Mn2+ ions located in the enzyme’s
catalytic site. Previously, we screened a panel of flavonoids for PA inhibition and found luteolin
and its C-glucoside orientin to be potent inhibitors. Through structural analysis, we identified the
presence of a 3 ,4 -dihydroxyphenyl moiety as a crucial feature for sub-micromolar inhibitory activity.
Here, we report results from a subsequent investigation exploring structural changes at the C-7 and
C-8 positions of luteolin. Experimental IC50 values were determined by AlphaScreen technology.
The most potent inhibitors were C-8 derivatives with inhibitory potencies comparable to that of
luteolin. Bio-isosteric replacement of the C-7 hydroxyl moiety of luteolin led to a series of compounds
with one-order-of-magnitude-lower inhibitory potencies. Using X-ray crystallography, we solved
structures of the wild-type PA-N-terminal domain and its I38T mutant in complex with orientin at
1.9 Å and 2.2 Å resolution, respectively.
Citation: Reiberger, R.; Radilová, K.;
Král’, M.; Zima, V.; Majer, P.; Brynda,
J.; Dracˇínský, M.; Konvalinka, J.;
Kožíšek, M.; Machara, A. Synthesis
and In Vitro Evaluation of C-7 and
C-8 Luteolin Derivatives as Influenza
Endonuclease Inhibitors. Int. J. Mol.
Sci. 2021, 22, 7735. https://doi.org/
10.3390/ijms22147735
0
0
Academic Editors: Mattia Mori and
Ilaria Vicenti
Received: 26 May 2021
Accepted: 17 July 2021
Published: 20 July 2021
Keywords: bio-isosterism; cross-coupling; endonuclease inhibitor; flavonoids; influenza; Mannich
reaction; RNA polymerase
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
1. Introduction
Influenza viruses cause illness in a variety of species, including humans. Despite
the availability of vaccines and antiviral drugs, influenza remains a serious threat to hu-
man health, causing 290,000–650,000 deaths worldwide annually [1]. Influenza virus
RNA-dependent RNA polymerase (RdRP) lacks proof-reading activity, which leads to
an accumulation of point mutations known as antigenic drift. This is responsible for the
emergence of new viral variants causing seasonal flu, which requires the flu vaccine to be re-
formulated every year. Antigenic drift also contributes to increasing viral resistance against
antiviral drugs. Additionally, antigenic shift—the reassortment of viral RNA segments
from two or more different influenza strains in animals or humans—could lead to a new
pandemic strain. In fact, various zoonotic strains are considered “ticking time bombs”, as
these pathogens have the potential to mutate to facilitate human transmission given enough
Copyright:
© 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Int. J. Mol. Sci. 2021, 22, 7735. https://doi.org/10.3390/ijms22147735
https://www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2021, 22, 7735
2 of 28
time and infected organisms. Generally, vaccination is the best intervention against viral
pathogens including influenza. However, the last influenza pandemic in 2009 reminded us
that effective vaccines are often not available at the onset of a pandemic. Reformulation of
vaccines is time-consuming, and many human lives can be taken by the disease during this
process. The intricacies of vaccine development, in combination with influenza’s genomic
variability, makes the development of novel anti-influenza therapeutics imperative.
Influenza viruses contain a single-stranded, negative-sense RNA genome in complex
with RdRP [
2
–
4
]. RdRP comprises the subunits PA (polymerase acidic protein), PB1 and
0
PB2 (polymerase basic protein 1 and 2). The virus itself is unable to synthesize the 5 -mRNA
cap required for eukaryotic translation; this represents the “Achillies heel” of influenza
virus. The virus obtains host primers—short oligomers of host pre-mRNA that initiate
transcription—by a unique “cap-snatching” mechanism [5–9], which serves as a target
for pharmaceutical intervention. The process begins with binding of the PB2 subunit
to the 50-cap (m7GTP) of the host pre-mRNA. Subsequently, the PA subunit cleaves the
RNA strain approximately 10–13 nucleotides downstream from the 50-cap to acquire the
cap/primer [10]. The PB1 subunit uses this detached RNA segment as a template for viral
mRNA synthesis. RdRP is highly conserved across influenza strains, and the three subunits
involved in the cap-snatching mechanism have been recognized as attractive targets for
drug development in the past decade [11–18].
The PA subunit is a bridged binuclear metalloenzyme with an N-terminal domain (PA-
Nter) harboring the endonuclease active site that carries out cleavage of the RNA segment.
The active site is a negatively charged pocket that accommodates either Mg2+ or Mn2+ ions,
with stronger affinity for the latter [19]. These ions are critical for endonuclease activity.
Evidence suggests that PA-Nter endonuclease inhibitors must possess a metal-binding
pharmacophore with the ability to bind either Mg2+ or Mn2+ ions efficiently [9].
Even though metalloenzymes comprise more than one-third of all known enzymes,
clinical development of metalloenzyme inhibitors is rather limited and few such inhibitors
have been approved by the Food and Drug Administration (FDA) [9,20–22]. Less than 5%
of all FDA-approved drugs target metalloenzymes [23]. Unsurprisingly, metal-binding
pharmacophores exhibit a lack of structural diversity.
There is currently only one FDA-approved influenza endonuclease inhibitor: baloxavir
marboxil (trade name Xofluza), which is administrated as a prodrug [24,25]. Successful
antiviral drugs must be able to block at least the existing variant of the target enzyme and
should have a high resistance barrier. One key mutation in the influenza A/H1N1 2009
pandemic (A/H1N1pdm) and A/H3N2 viruses is Ile-38 to Thr-38 in PA-Nter. This mutation
reduced patient susceptibility to baloxavir marboxil and impaired the virus’ replicative
fitness in cells [26]. Resistance development could eventually lead to the loss of the clinical
relevance of Xofluza. Furthermore, fewer than a dozen PA-Nter endonuclease inhibitor
classes have been reported in the literature to date. These classes include diketo acids [27],
dopamine derivatives [28], hydroxylated heterocycles [29
–31], flutimide congeners [32],
green tea catechins [33 34], catechol derivatives [35], hydroxylated N-acyl-hydrazones [36
,
]
and others [18]. Recently, we identified the molecular mode of action of flavonoids in
influenza-infected cells [37]. We developed a screening assay based on AlphaScreen
technology and determined the inhibitory potency of 38 flavonoids, of which luteolin (IC50
of 73
±
3 nM) and its 8-C-glucoside orientin (IC50 of 42
±
2 nM) were the most potent
inhibitors (Figure 1). A gel-based endonuclease inhibitory assay confirmed our findings
from the competition assay. Finally, we performed structural analysis of complexes of
PA-Nter with luteolin and myricetin and described various binding poses of flavonoids in
the PA-Nter active site.

Int. J. Mol. Sci. 2021, 22, 7735
3 of 28
Figure 1. Selected hits from previous screening campaigns are shown. The tight coordination of
metal ions and interactions with PA-Nter residues are indicated on the structure of luteolin.
In the current study, we aimed to pursue structure-assisted drug design guided
by our previously reported crystal structure of PA-Nter in complex with luteolin (PDB
entry 6YA5, 2.0 Å resolution) [37]. The structure revealed that the hydroxyl group at
position C-7 forms a hydrogen bond with the Glu-26 residue of PA-Nter. The surface
complementarity and the strong interaction of hydroxyls at the B-ring with metal ions
contribute to the high affinity and inhibitory potency of luteolin. Thus, luteolin may
serve as a useful scaffold to introduce modifications that improve the inhibitory potency
and pharmacokinetic properties. Luteolin itself has low bioavailability [38,39] and is
prone to oxidation. Therefore, we replaced the C-7 hydroxyl with other moieties capable
of creating hydrogen bonds with Glu-26. Bio-isosteric replacement is a proven tool for
modulating the drug-like properties of promising therapeutics [40]. The C-7 hydroxyl
group has slightly higher acidity [41] compared to the other hydroxyls of luteolin. This
allowed us to selectively modify the C-7 position using Pd-catalyzed cross couplings via
the corresponding C-7 triflate.
We then continued to leverage the known structure–activity relationships (SAR) in
3 ,4 -dihydroxyphenyl flavones. Moreover, we expanded our research effort to explore the
chemical space around the C-8 position of the luteolin scaffold. Specifically, we set out
0
0
to investigate whether moieties introduced at the C-8 position by Mannich reaction [42
]
would be tolerated or even enhance inhibitory potency. Our goal was to find additional
points of interaction between luteolin derivatives and PA-Nter and, more importantly, to
explain why vitexin exhibits moderate inhibitory potency even though it does not have the
30,40-dihydroxyphenyl motif. This ortho-hydroquinone motif was originally identified as
the metal-binding pharmacophore and as such was considered indispensable for inhibition.
That paradigm explains the lack of inhibitory potency of apigenin but fails to rationalize
vitexin’s moderate potency (see Figure 1).
2. Results and Discussion
2.1. Compound Synthesis
Based on the SAR outlined in Figure 1, our initial efforts focused on exploring bio-
isosterism at the C-7 moiety of luteolin. Guided by general knowledge of hydrogen bond
formation and prior crystallographic study, we proposed that the hydroxyl group could
be replaced with a small group featuring either N-H or O-H bonds. We also decided
to introduce heterocyclic moieties that are not necessarily associated with textbook OH
bio-isosteric replacement. Preparation of this C-7 series started from luteolin, which
was per-acetylated. Compound
1 was then selectively mono-deacetylated at C-7 using
previously reported conditions [43] (Scheme 1). This regioselective deprotection takes
advantage of the higher acidity of the C-7 hydroxyl group in the luteolin scaffold caused
by the electron-withdrawing pyrone carbonyl moiety in the para position. Therefore,

Int. J. Mol. Sci. 2021, 22, 7735
4 of 28
thiophenolate-mediated O-deacetylation selectively generates the corresponding phenolate
(2), which was next treated with triflic anhydride to provide intermediate
3
in a decent yield.
◦
◦
Scheme 1. Reagents and conditions: (i) Ac2O, pyridine, 145 C, 3 h, 77%; (ii) thiophenol, imidazole, NMP/THF (1:3), 0 C
to r.t., 5 h, 68%; (iii) Tf2O, pyridine, DCM, 0 C, 3.5 h, 41%.
◦
Triflate
3 was subjected to a wide range of palladium-catalyzed cross-couplings. In ad-
dition to the desired products, certain reactions also yielded C-5 O-deacetylated analogues
(Scheme 2). However, formation of such byproducts was not an obstacle, because we sub-
sequently performed global deprotections of the flavone scaffolds. Hirao coupling [44] of
resulted in a high yield of diethyl phosphonate . Subsequent standard dealkylation using
trimethylsilyl bromide [45] resulted in phosphonic acid . Molybdenum hexacarbonyl
3
4
5
was used as a source of carbon monoxide for Pd-catalyzed methoxy-carbonylation. This
approach was superior to methoxycarbonylation with dicobaltoctacarbonyl [46] in terms
of yield and subsequent cleaning of the reaction apparatus. The pre-purified mixture of
methyl esters
6 and 7 was subjected to hydrolysis and to different aminolysis reactions,
which produced 8, 9 and 10.
◦
Scheme 2. Reagents and conditions: (i) Pd(PPh3)4, (EtO)2P(O)H, DIPEA, MeCN, 70 C, 3 h, 78%; (ii)
(a) TMS-Br, DCM, r.t., 32 h, (b) MeOH, r.t., 1 h, (c) KOH, THF/MeOH, r.t., 1 h, 25%; (iii) Mo(CO)6,
◦
Pd(OAc)2, dppp, Et3N, DMSO/MeOH (3:2), 70 C, 20 h, 40% (
6), 48% (7); (iv) 2M LiOH (aq.), THF,
45 ◦C, 1 h, 71%; (v) 7M NH3 (MeOH), 50 ◦C, 4 d, 21%; (vi) 2-aminoeth◦anol, K2CO3, EtOH, 50 ◦C,
◦
24 h, 23%; (vii) a) DPPA, Et3N, DMF, 100 C, 16 h, b) H2O, DMF, 100 C,◦3 h, 30%; (viii) AcOSu,
Et3N, DMF, r.t., 36 h, 23%; (ix) Zn(CN)2, XantPhos Pd G2, DIPEA, DMF, 85 C, 24 h, 61%; (x) NaN3,
AcOH, DMF, 130 ◦C, 3h, 38%; (xi) 2M LiOH (aq.), THF, r.t., 24 h, 46%; (xii) potassium [[(t-butoxy-
carbonyl)amino]methyl]triflu◦oroborate, SPhos Pd G2, K2CO3, THF/H2O (25:1), 100 ◦C, 2 h, 43%;
(xiii) TFA, THF/H2O (4:1), 50 C, 48 h, 73%.

Int. J. Mol. Sci. 2021, 22, 7735
5 of 28
One-pot Curtius rearrangement converted 3,4,5-trihydroxyflavone-7-carboxylic acid
(8) to amino-derivative 11 in an acceptable yield of 30%. In general, electron rich anilines are
prone to quick degradation, and thus the corresponding acetamide 12 was prepared from
11 using AcOSu. Palladium-catalyzed cyanation of triflate by a modified Buchwald’s
3
procedure [47] gave rise to tetrazole derivative 14 and nitrile 15. Amino-methyl transfer
to triflate 3 was accomplished by protected potassium aminomethyltrifluoroborate under
slightly modified conditions, reported by Molander [48]. The crude product of cross-
coupling was then subjected to trifluoroacetic-acid-mediated de-tert-butylation, affording
17 as a homolog of amine 11.
Our well-established method for preparation of the key intermediate
3 enabled us
to execute heteroarylations of the flavone scaffold. We hypothesized that replacement of
the hydroxyl group with pyrazole and azaindole could, in principle, ensure engagement
of Glu-26 while improving the metabolic stability of the flavone. Synthesis of 18–20 was
mediated by Pd(PPh3)4 or by Buchwald 2nd generation pre-catalysts. Regardless of which
catalyst was used, 18–20 were obtained in low yields (Scheme 3).
Scheme 3. Reagents and conditions: (i) 3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrrolo[2,3-
◦
b]pyridine, Pd(PPh3)4, Cs2CO3, DMF, 90 C, 16 h, 10%; (ii) (1H-pyrazol-3-yl)boronic acid, SPhos
Pd G2, K2CO3, THF, 100 ◦C, 16 h, 25%; (iii) (5-methyl-1H-pyrazol-3-yl)boronic acid, SPhos Pd G2,
◦
K2CO3, THF/H2O (25:1), 100 C, 16 h, 19%.
Although efficient Mannich reactions with luteolin [49] and quercetin [50,51] have
been previously described, we found this type of C–C formation reaction very challenging.
In our hands, formation of the desired products was in all cases accompanied by formation
of C-6 regioisomers, contrary to reports in the literature. We also observed formation
of other byproducts with a methylendioxy group on the B-ring serving as a 2:1 adduct
of formalin to luteolin. The very limited solubility of luteolin further complicated our
effort to optimize the Mannich reaction. Methanol worked least poorly among a variety
of solvents screened (methanol, ethanol, propan-2-ol, trifluoroethanol, 1,4-dioxane and
DMF). Room temperature and equimolar loading of formalin and the secondary amine
with respect to luteolin efficiently suppressed the double Mannich reaction at both the
C-6 and C-8 positions. To avoid issues with low regioselectivity and to exclude methyl-
endioxy formation, we attempted Mannich reactions with tetraacetate
1 and triacetate
2. These reactions led to complex reaction mixtures due to low conversions and the
lability of acetates in the presence of secondary amines. According to HPLC analysis,
subsequent methanolysis resulted in a simplified mixture of compounds, but yields of
products were low (~15%). Considering the need to prepare triacetate
2, this approach
is clearly not advantageous to the Mannich reaction of parental luteolin in methanol.
Data resulting from screening of the Mannich reaction with
Supplementary Materials.
1 and 2 are provided in the
To explore the chemical space around C-8 as much as possible, we used structurally
different secondary amines possessing additional functional groups (Scheme 4). Mannich
reactions were stirred at room temperature overnight until almost all luteolin was con-
sumed. The ratio between C-8 Mannich adduct and unwanted C-6 regioisomer ranged
from 1.7:1 to 3.0:1. Since both regioisomers have similar retention factors, the purification
of 21–32 was very laborious. Products were purified by multiple HPLC preparations

Int. J. Mol. Sci. 2021, 22, 7735
6 of 28
that further negatively influenced the yields. Alkyl esters of secondary amines were
used for preparation of 30–32, and after the Mannich reaction, these ester moieties were
trans-formed into carboxylic acids.
Scheme 4. Mannich reaction of luteolin with secondary amines in methanol. The asterisk indicates the
overall yield of the Mannich reaction with subsequent acidic hydrolysis of corresponding alkyl esters.
2.2. Relationship between Chemical Structure and Inhibitory Potency
The inhibition potencies of the prepared compounds were assessed by an assay that
we recently developed for screening PA-Nter inhibitors based on the amplified luminescent
proximity assay system (AlphaScreen) [37]. Examples of titration curves are shown in
Figure 2A and Figure S1. The series of C-7 luteolin congeners displayed moderate inhibitory
potencies with one- to two-order-of-magnitude higher IC50 values compared to luteolin
(Table 1).
Figure 2. (A) Titration curve of orientin using the AlphaScreen assay, revealing an IC50 value of 42 nM. (B) Inhibition of
endonuclease activity by orientin, documented by a gel-based endonuclease inhibitory assay. The single-stranded circular
DNA M13mp18 was used as substrate (lane C1). The substrate fully cleaved by endonuclease in the absence of inhibitor
(lane C2) was used as a control. The GelPilot 100 bp Plus Ladder molecular weight marker (lane MW1) and the GelPilot
Wide Range Ladder molecular weight marker (lane MW2) are shown for reference.

Int. J. Mol. Sci. 2021, 22, 7735
7 of 28
Table 1. Inhibition assay of influenza endonuclease. Structure-activity relationship of C-7 luteolin
derivatives.
IC50 (µM)
(AlphaScreen)
Compound
Structure
luteolin
0.073 ± 0.003
5
8
9.2 ± 2.3
0.98 ± 0.13
2.0 ± 0.6
7.6 ± 1.2
9
10
11
12
1.3 ± 0.2
3.0 ± 0.4
14
15
17
1.4 ± 0.3
1.3 ± 0.3
6.7 ± 0.8

Int. J. Mol. Sci. 2021, 22, 7735
8 of 28
Table 1. Cont.
Compound
IC50 (µM)
(AlphaScreen)
Structure
18
3.4 ± 0.6
19
20
0.81 ± 0.12
2.6 ± 0.3
32 ± 3
cynaroside
Phosphonic acid
5
inhibited PA-Nter with an IC50 of 9.2
µ
M, which was one of the
was a
and 10 were less potent than
M, respectively), which might indicate relatively confined C-7 proximal
weakest inhibitory potencies of the whole series. On the other hand, carboxylic acid
sub-micromolar inhibitor (IC50 = 0.98 M). Related amides
(IC50 = 2.0 and 7.6
8
µ
9
8
µ
space. The amino derivative 11 had approximately 20-times weaker binding potency than
luteolin. Clearly, the anticipated interaction between the C-7 amino group and side chain
of Glu-26 did not result in superior binding. We speculate that solvation of the protonated
amino group disrupted the effective formation of a salt bridge with Glu-26. Acetamide 12
,
tetrazole derivative 14, and nitrile 15 exhibited relatively flat SAR with IC50 values of 3.0, 1.4
and 1.3
inhibitory activity compared to luteolin (IC50 = 6.7
nor basic moieties at C-7 are tolerated (see the inhibitory potencies of phosphonic acid
and aminomethyl derivative 17). The relatively bulky azaindole congener 18 exhibited
appreciable inhibitory potency with an IC50 value of 3.4 M. Pyrazoles 19 and 20 differed
µM, respectively. Amino-methyl derivative 17 exhibited a significantly decreased
µM). Apparently, neither strongly acidic
5
µ
slightly in inhibitory potency; the former was more potent than its methylated analogue 20,
but both exhibited IC50 values comparable with that of tetrazole 14 (0.81 and 2.6 versus 1.4
µM). Considering the almost identical half-maximal inhibitory concentrations of weakly
basic pyrazoles 19 and 20 and acidic tetrazole 14, we surmise that interaction with PA-Nter
is not susceptible to the “proton affinity” of the moiety introduced at C-7. The inhibitory
potencies of
steric effects play a key role in this specific point of interaction with the endonuclease. To
confirm this, we screened cynaroside, a commercially available luteolin 7-O- -D-glucoside.
The introduction of a bulky glucose residue at C-7 led to an almost complete loss of
inhibition (IC50 = 32 M; three orders of magnitude worse than luteolin). We conclude
5 and 17 further strengthen our hypothesis. On the other hand, it seems that
β
±
3 µ
that relocation of amino acids surrounding Glu-26 within PA-Nter and/or a clash with the
Glu-26 side chain leads to a significant drop of inhibitory potency.
Next, we assessed the effect of C-8 substituents. As shown in Table 2, almost all
aminomethylene moieties were well-tolerated. Compounds 21
,
23
–25 and 29
–32 exhibited
inhibitory potencies roughly comparable to that of orientin (IC50 = 0.042
µM). Moieties

Int. J. Mol. Sci. 2021, 22, 7735
9 of 28
with additional basic (25) or acidic residues (30
–32) had IC50 values within the same range.
This suggests the lack of a PA-Nter amino acid featuring proton affinity in the chemical
space around C-8. The bulky nor-tropine (27, IC50 = 0.075 M) and dihydroxytetrahydro-
isoquinoline (28, IC50 = 0.12 M) scaffolds were not found to be significantly unfavorable.
µ
µ
It is likely that both bulky residues are oriented away from the PA-Nter active site and
into the solvent. This hypothesis fits well with the findings presented in Section 2.3. 4-
Hydroxypiperidine derivative 22 showed a slightly decreased potency in comparison with
3-hydroxy analogue 21 (0.14 versus 0.083
µM). However, the micromolar inhibitory potency
of alcohol 26 (IC50 = 1.2 M) has no rational explanation based on the acquired SAR. Rather,
µ
we anticipated that 26, as a cyclic analogue of 21, would be a sub-micromolar inhibitor.
Table 2. Inhibition assay of influenza endonuclease. Structure–activity relationship of C-8 luteolin
derivatives.
IC50 (µM)
(AlphaScreen)
Compound
Structure
orientin
0.042 ± 0.002
21
22
0.083 ± 0.009
0.14 ± 0.01
23
24
0.077 ± 0.013
0.054 ± 0.009

Int. J. Mol. Sci. 2021, 22, 7735
10 of 28
Table 2. Cont.
Compound
IC50 (µM)
(AlphaScreen)
Structure
25
26
0.066 ± 0.009
1.2 ± 0.2
27
0.075 ± 0.015
28
0.12 ± 0.02
29
30
0.073 ± 0.012
0.078 ± 0.013

Int. J. Mol. Sci. 2021, 22, 7735
11 of 28
Table 2. Cont.
Compound
IC50 (µM)
(AlphaScreen)
Structure
31
32
0.080 ± 0.022
0.074 ± 0.008
To assess the inhibition of endonuclease activity by selected compounds by a di-
rect mechanism-based method, we applied a gel-based endonuclease inhibitory assay
(Figure 2B). This assay was performed for five selected ligands (orientin, baloxavir acid,
luteolin, 21 and 30) with wild-type PA-Nter (see Supplementary Materials, Figure S2). The
analysis showed that orientin had a higher inhibitory potency than luteolin, in agreement
with the AlphaScreen assay. The gel-based assay also confirmed similar inhibition activities
for baloxavir acid, orientin, 21 and 30. We also attempted this assay with the PA-Nter I38T
variant, but the mutation of Ile-38 to Thr-38 led to complete loss of ssDNA cleavage ability
(see Figure S3). Thus, we used a fluorescent-labelled ssRNA substrate and performed a
FRET-based endonuclease assay with this variant. Compared to wild-type PA-Nter, the
I38T variant had only 1.9% activity (see Figure S4) toward the ssRNA substrate and none for
ssDNA. This result is in line with a recently reported observation of significantly reduced
fitness and ssRNA nuclease activity of a virus harboring the I38T variant [26].
2.3. Crystal Structures of Wild-Type and I38T PA-Nter Domains in Complex with Orientin
To reveal the structure of orientin bound to wild-type PA-Nter and the I38T mutant,
we prepared both proteins for X-ray crystallographic studies. Thanks to its high inhibitory
potency and aqueous solubility, orientin (PDBe ligand USE) was soaked into the unoccupied
protein crystals. The structure of wild-type PA-Nter in complex with orientin was refined to
1.9 Å resolution (PDB ID 7NUG), and the I38T mutant complex (PDB ID 7NUH) was refined
to 2.2 Å resolution. Both crystallographic models consisted of one protein molecule per
asymmetric unit. Two metal ions were embedded in the endonuclease active site. Based on
the strong anomalous signal observed, we speculate a mixed occupancy of Mn2+ and Mg2+
cations. The majority (0.8 occupancy) proximal ion was Mn2+, coordinated by four protein
atoms (Nε2His-41, Oδ2Asp-108, Oε2Glu-119, O Ile-120) and two hydroxyl groups from the
30,40-dihydroxyphenyl moiety of orientin. The distal octahedrally coordinated sphere was
partially assigned as the central Mg2+ cation (0.4 occupancy), which corresponds to lower
anomalous scattering and is in agreement with previously reported PA-Nter complexes
(Figure 3) [19,37].

Int. J. Mol. Sci. 2021, 22, 7735
12 of 28
Figure 3. Comparison of crystal structures of PA-Nter in complex with orientin (
and luteolin (
A
; PDB ID 7NUG)
B
; PDB ID 6YA5). The active site pocket containing two metal ions (purple-blue spheres)
is presented as a grey surface. Interacting residues and ligands are in stick representation. Hydrogen
bonds are shown as black dashes. Coordinating water molecules (W1, W2 and W3) are presented as
red spheres.
The distal ion was coordinated by Oε2Glu-80, Oδ2Asp-108, the 40-hydroxyl group of
orientin, and three water molecules (W1, W2, W3). Unoccupied PA-Nter (PDB entry 5DES,
not shown) harbors metal ions coordinated by two additional water molecules, which are
replaced by the two hydroxyl groups from the flavonoid’s B ring in our wild-type and I38T
variant structures. Orientin adopts a similar position as luteolin in a previously described
PA-Nter structure (PDB ID 6YA5) [37]. Ligands in both structures form a hydrogen bond
with Oε2Glu-26 at the C-7 position. The previously observed high affinity of luteolin for
PA-Nter is likely to be enhanced by the additional hydrogen bonding network surrounding
orientin’s glucosyl moiety. This was observed in both protein variants, as most of the
water molecules in the first solvation shell are located at similar positions (Figure 4).
However, there is a little ligand shift visible in the mutant variant. Wild-type Ile-38 moves
orientin towards the solvent and differs from the mutant variant with an RMSD of 0.466 Å.
Moreover, there is a visible movement of the Tyr-24 side chain in the mutant variant, likely
to be due to the ligand shift.

Int. J. Mol. Sci. 2021, 22, 7735
13 of 28
Figure 4. Structural alignment of wild-type PA-Nter (pale cyan) and its I38T mutant (yellow), both in complex with orientin
(PDB ID 7NUG, 7NUH). The active site ( ) containing two metal ions (purple-blue spheres) is presented as a surface
cavity in grey. Closeup view, 90◦ clockwise rotated (
), onto interacting residues, Ile-38/Thr-38, and ligands (all in stick
A
B
representation) reveals shift of the glucoside moiety. The hydrogen bond between ligand and the Glu-26 side chain is shown
as a grey dash. Common waters contributing to protein-ligand binding, with a maximum distance of 3 Å from the ligand,
are presented as spheres with color coding corresponding to each structure. Metal-coordinating water molecules (W1, W2
and W3) and W21 (red) are shown as spheres.
The side chain of Tyr-24 in the mutant variant approaches the active site pocket,
whereas in the wild-type, Tyr-24 is pushed away from the cavity (RMSD of 0.029 Å for side
chain atoms). Thr-38, which is one atom shorter than Ile-38, helps accommodate orientin.
O
γ1Thr-38 forms a hydrogen bond through W21 to the glucosyl moiety of the ligand (O6)
(Figure 5). This is not observed in the wild-type, as Ile-38 does not contain a hydroxyl
group capable of such interaction.

Int. J. Mol. Sci. 2021, 22, 7735
14 of 28
Figure 5. Closeup view of the active site pocket of I38T PA-Nter. Metal ions are shown as purple-blue
spheres. Ligand and amino acid residues are shown in stick representation, where red represents
oxygen atoms. The hydrogen bonds between the ligand and the Glu-26 side chain and between the
ligand, W21, and the Thr-38 side chain are depicted as grey dashes. Water molecules are shown as
yellow spheres, except for W21 which is shown as a red sphere with its 2Fo–Fc electron density map
in magenta mesh contoured at 1.5 σ.
3. Materials and Methods
3.1. AlphaScreen Assay
AlphaScreen experiments were performed using a Perkin Elmer Enspire plate reader
in 96-well ProxiPlates. Biotinylated L-742.001 derivative [37] was captured on Streptavidin-
coated donor beads (Perkin Elmer). Separately, GST-PA-Nter fusion protein was bound to
GSH-coated acceptor beads (Perkin Elmer). These solutions were incubated for 60 min at
room temperature in the dark and subsequently mixed and incubated for an additional
120 min. In experiments screening for endonuclease inhibitors, compounds were mixed
with both types of beads prior to the 120-min incubation. The optimal concentrations of
biotinylated L-742.001 derivative and GST-PA-Nter were 15 nM and 50 nM, respectively.
The concentrations of donor and acceptor beads were 5 µg/mL each in a 50 µL reaction
volume. All experiments were performed in 25 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05%
Tween20, 1 mM MnCl2, 10 mM MgCl2, and 1 mM 2-mercaptoethanol.
3.2. Cloning, Expression and Purification of Recombinant Proteins
DNA encoding the first 196 amino acids of the N-terminal domain of the influenza
polymerase acidic subunit (PA-Nter) from the viral strain A/California/07/2009 (H1N1)
(GenBank accession No. CY121685.1) was prepared using GenScript USA Inx. The flexible
loop (residues 51–72) was replaced with a GGS linker [52]. Constructs with affinity tags
(GST-PA-Nter and His6-SUMO-Nter) were prepared for both wild-type and I 38T PA-Nter.
First, DNA encoding PA-Nter was inserted into the plasmid pGEX-1λT. Next, PA-Nter with
a (GS)4 linker and N-terminal extension was cloned into the plasmid pETM11-SUMO3
(EMBL, Heidelberg, Germany) using BamHI and XhoI sites. The I38T mutation was
introduced into both GST- and His6-SUMO-tagged constructs using the following primers
for site-directed mutagenesis: 50–CAAGTTTGCTGCAACATGCACACAT TTG–30 and
50–CAAATGTGTGCATGTTGCACAAACTTG–30. All tagged PA-Nter constructs were
expressed in E. coli BL21 (DE3) RIL. Cells were harvested and resuspended in lysis buffer
(25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA (GST) or 50 mM Tris/HCl, pH
8.0, 200 mM NaCl, 10 mM imidazole (His6-SUMO)) and lysed with an EmulsiFlex device
(Avestin, Ottawa, ON, Canada) at a pressure of 1200 bar. GST-tagged PA-Nter soluble
proteins were loaded onto a glutathione-agarose column (ThermoFisher Scientific) and

Int. J. Mol. Sci. 2021, 22, 7735
15 of 28
eluted with elution buffer (50 mM Tris/HCl, pH 7.5, 150 mM NaCl, 10 mM reduced L
glutathione, 1 mM EDTA). Analogously, His6-SUMO PA-Nter was purified using Ni-NTA
Agarose (Roche Diagnostics GmbH, Mannheim, Germany) and eluted with Ni-NTA elution
buffer (50 mM Tris/HCl, pH 8.0, 200 mM NaCl, 250 mM imidazole). The His6-SUMO
tag was removed by the ULP1 protease. All proteins were purified on a Superdex 75
(GE Healthcare/Amersham Pharmacia, Uppsala, Sweden) gel filtration chromatography
column, yielding >95% purity as estimated by SDS-PAGE.
3.3. Gel-Based Endonuclease Inhibitory Assay
To compare the endonuclease activities of wild-type and I38T PA-Nter in the presence
of selected compounds (baloxavir acid, luteolin, orientin), we used a gel-based endonucle-
ase inhibitory assay. The single-stranded DNA substrate M13mp18 (New England Biolabs)
was cleaved in vitro by either protein. Each reaction (10 µL) contained 1 µM protein (GST-
PA-Nter wild type/GST-PA-Nter I38T mutant) in digestion buffer (25 mM Tris-HCl, pH
7.4, 150 mM NaCl, 0.05% Tween20, 1 mM MnCl2, 10 mM MgCl2, 1 mM 2-mercaptoethanol)
and was incubated with various concentrations of inhibitors (BXA/LU2/OTN/21
Reactions were initiated by the addition of 0.2 g of M13mp18 plasmid. Reactions were
incubated at 37 ◦C for 5 h and stopped by adding 1
L of 0.2 M EDTA. Finally, cleavage
/30).
µ
µ
of DNA substrate was visualized by agarose electrophoresis using 1% agarose gel stained
with GelRed.
3.4. Crystallization and Diffraction Data Collection
Hexagonal bifrustum crystals of empty wild-type and I38T PA-Nter subunits were
obtained by the hanging-drop vapor diffusion method. Protein solution (12 mg/mL) was
mixed with crystallization reservoir solution (12.5% w/v PEG 1000, 12.5% w/v PEG 3350,
0.1% M MOPS/HEPES-Na pH 7.5, 0.06 M magnesium chloride, 0.06 M calcium chloride)
◦
and PA-Nter seed in a 1:1:0.2 ratio. Crystals grew at 18 C until they reached approximately
0.2 mm in diameter. Ligands (100 mM solution in DMSO) were soaked in for 15 min (the
final DMSO concentration did not exceed 5%). Crystals were harvested, flash-cooled by
plunging into liquid nitrogen and stored at −196 ◦C.
Diffraction qualities were tested at BESSY II and data were collected at
−
173 ◦C on
a home diffractometer (MicroMax-007 HF microfocus equipped with a PILATUS 300 K
detector, Rigaku). The crystal of wild-type PA-Nter soaked with orientin diffracted to a
resolution of up to 1.87 Å, and the I38T PA-Nter/orientin crystal diffracted up to 2.15 Å.
Diffraction data were processed, integrated, and reduced using XDS [53] and scaled using
XSCALE from the XDS suite [54]. Both crystals belonged to the P6422 space group and
contained one molecule per asymmetric unit, with a solvent content of 47.5% (wild-type
PA-Nter), and 48.2% (I38T PA-Nter). We observed anomalous signals up to a resolution of
3.0 Å for wild-type and 3.5 Å for the I38T variant. Therefore, the data were processed with
unmerged Friedel pairs. Detailed crystal parameters and data collection statistics are given
in Table S1.
3.5. Structure Determination and Analyses
Structures of wild-type and I38T PA-Nter were determined by molecular replacement
with MOLREP [55] from the CCP4 package [56] using a previously reported structure of
PA-Nter as a template (PDB entry 6YA5 [37]). The final step of complex structure polishing
was carried out by cycles of manual adjustments using Coot software [57] followed by
refinement in REFMAC 5.8.0103 [58]. MolProbity [59] was used to validate the quality
of the final models. Refinement statistics are given in Table S1. All figures illustrating
structural representations were prepared with PyMOL (The PyMOL Molecular Graphics
System, Version 2.4.2 accessed on 10 March 2020; Schrödinger, LLC., New York, NY, USA).
Atomic coordinates and experimental structure factors are deposited in the Protein Data
Bank under codes 7NUG for wild-type PA-Nter in complex with orientin and 7NUH for
I38T PA-Nter in complex with orientin.

Int. J. Mol. Sci. 2021, 22, 7735
16 of 28
3.6. Chemistry
Unless otherwise noted, all reactions were carried out under argon in oven-dried
glassware. Solvents were distilled from drying agents as indicated and transferred under
nitrogen: THF (Na/benzophenone), toluene (Na/benzophenone), MeCN (CaH2), and
DCM (CaH2). Chromatography was performed using a Teledyne ISCO Combi Flash Rf+
flash chromatography system with RediSep Rf Gold Silica or RediSep Rf Gold Reversed-
phase C18 columns. All starting materials were used as purchased (Sigma Aldrich, Alfa
Aesar, TCI, Fluorochem, Combi-Blocks), unless otherwise indicated. Compounds luteolin
and orientin were purchased from Sigma-Aldrich (product numbers L9283 and O9765).
All inhibitors were purified using an ECOM TOY18DAD800 compact preparative system
[flow rate 15 mL/min; gradient 0–60% MeCN/H2O (0.1% trifluoroacetic acid) over 60
min], with a ProntoSIL 120-10-C18 ace-EPS column, 10
compounds and composition of the reaction mixtures were tested on a Waters UPLC-MS
Acquity with QDa Mass Detector (flow rate 0.5 mL/min, gradient 0–100 % MeCN/H2O
µ
m, 20
×
250 mm. The purity of
(0.1% formic acid) over 7 min) with an ACQUITY UPLC BEH C18 Column, 130 Å, 1.7
µm,
2.1 mm × 100 mm with a 2.1 mm
×
5 mm pre-column. The final inhibitors were of at least
90% purity. H-NMR spectra were recorded on Bruker instruments at 400, 500 or 600 MHz;
13C-NMR spectra were recorded at 100, 126 or 150 MHz. Chemical shifts are provided
1
in δ-scale; coupling constants J are given in Hz. ESI high resolution mass spectra were
recorded using a Thermo Scientific LTQ Orbitrap XL (Termo Fisher Scientific, Waltham,
Massachusetts, USA) controlled by MassLynx software.
Compounds
1 and 2 were prepared according to literature procedures [43]. Analytical
data for these compounds were in agreement with published data.
3.7. 4-(5,7-Diacetoxy-4-oxo-4H-chromen-2-yl)-1,2-phenylene Diacetate (1)
Neat acetic anhydride (10 mL) was added to luteolin (1.43 g, 5.0 m◦mol), followed by
the addition of pyridine (1.0 mL). The reaction mixture was heated to 145 C for 3 h. The hot
mixture was poured into ice and stirred for 30 min. The suspension was filtered off, and the
solids were mixed with a boiling mixture of MeOH/CHCl3 (9:1, 15 mL). The product was
isolated by filtration from the cool suspension to furnish the desired compound
1
(1.75 g,
1
77%). H NMR (400 MHz, CDCl3)
δ
= 7.74 (dd, J = 8.4, 2.2 Hz, 1H), 7.70 (d, J = 2.1 Hz, 1H),
7.38–7.32 (m, 2H), 6.85 (d, J = 2.2 Hz, 1H), 6.61 (s, 1H), 2.44 (s, 3H), 2.35 (s, 6H), 2.33 (s, 3H)
ppm. 13C NMR (101 MHz, CDCl3)
δ
= 176.3, 169.5, 168.1, 167.9, 160.9, 157.7, 154.2, 150.4,
145.0, 142.8, 129.8, 124.6, 124.5, 121.8, 115.0, 114.0, 109.2, 109.1, 21.3, 21.2, 20.8, 20.8 ppm.
3.8. 4-(5-Acetoxy-7-hydroxy-4-oxo-4H-chromen-2-yl)-1,2-phenylene Diacetate (2)
4-(5,7-Diacetoxy-4-oxo-4H-chromen-2-yl)-1,2-phenylene diacetate (1) (1.70 g, 3.7 mmol,
1.00 eq.) was dissolved in THF (56 mL) and NMP (19 mL). Then, imidazole (88.5 mg,
1.3 mmol, 0.35 eq.) was added at 0 ◦C followed by addition of thiophenol (0.45 mL, 4.4
mmol, 1.18 eq.) via septum under a nitrogen atmosphere at 0 ◦C. The reaction mixture
was stirred and slowly warmed to room temperature over 2 h until the starting material
was fully consumed (TLC, UPLC-MS). Volatiles were evaporated and the oily residue was
dissolved in EtOAc (150 mL). The organic phase was washed with 5% HCl (aq., 5
×
45 mL),
and organic solvents were evaporated. The solids were mixed with EtOH, and the product
1
was isolated by filtration to furnish the desired compound
MHz, DMSO-d6)
Hz, 1H), 6.80 (s, 1H), 6.60 (d, J = 2.3 Hz, 1H), 2.35 (s, 3H), 2.34 (s, 3H), 2.32 (s, 3H) ppm. 13C
NMR (101 MHz, DMSO-d6) = 175.2, 168.9, 168.2, 168.0, 162.3, 159.4, 158.2, 150.1, 144.6,
142.5, 129.5, 124.8, 124.5, 121.7, 109.5, 108.8, 108.0, 101.0, 21.0, 20.4 (2C) ppm.
2
(1.05 g, 68%). H NMR (400
δ
= 11.17 (s, 1H), 8.08–7.95 (m, 2H), 7.49 (d, J = 9.0 Hz, 1H), 6.97 (d, J = 2.3
δ

Int. J. Mol. Sci. 2021, 22, 7735
17 of 28
3.9. 4-(5-Acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-1,2-phenylene
Diacetate (3)
A flask with 4-(5-acetoxy-7-hydroxy-4-oxo-4H-chromen-2-yl)-1,2-phenylene diacetate
2) (1.00 g, 2.4 mmol, 1.0 eq.) was purged with nitrogen. The solids were mixed with
(
dry CH2Cl2 (12 mL) and the suspension was cooled to 0 ◦C. Pyridine (0.39 mL, 4.9 mmol,
2.0 eq.) was added dropwise. After 10 min,◦trifluoromethanesulfonic anhydride (0.53 mL,
3.2 mmol, 1.3 eq.) was added dropwise at 0 C under a nitrogen atmosphere. The resulting
red-colored reaction mixture was stirred for 3.5 h until the starting material was fully
consumed (TLC, UPLC-MS). Then, the reaction mixture was diluted with additional
CH2Cl2 (15 mL) and washed with sat. NH4Cl (aq., 1
and water (1 10 mL). The organic phase was dried over anhydrous MgSO4 and then
evaporated under reduced pressure. The residue was purified by flash chromatography
(SiO2, cyclohexane/EtOAc = 100:0 50:50) to afford the desired triflate (533 mg, 41%).
1H NMR (400 MHz, CDCl3)
= 7.74 (dd, J = 8.5, 2.3 Hz, 1H), 7.71 (d, J = 2.1 Hz, 1H), 7.44
(d, J = 2.4 Hz, 1H), 7.38 (d, J = 8.4 Hz, 1H), 6.99 (d, J = 2.4 Hz, 1H), 6.65 (s, 1H), 2.45 (s, 3H),
2.35 (s, 3H), 2.33 (s, 3H) ppm. 13C NMR (101 MHz, CDCl3)
= 175.6, 169.1, 168.1, 167.8,
161.3, 157.6, 151.6, 151.3, 145.3, 142.9, 129.2, 124.7, 124.6, 121.9, 120.4, 117.1, 113.6, 109.5,
109.4, 21.1, 20.8, 20.7 ppm. 19F NMR (376 MHz, CDCl3)
72.4 ppm. HRMS (ESI) m/z
calcd for C22H16F3O11S [M+H+]+ 545.0359, found 545.0356.
× 10 mL), sat. CuSO4 (aq., 2 × 10 mL)
×
→
3
δ
δ
δ
=
−
3.10. 4-(5-Acetoxy-7-(diethoxyphosphoryl)-4-oxo-4H-chromen-2-yl)-1,2-phenylene Diacetate (4)
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-
1,2-phenylene diacetate (
0.3 eq.) was sealed, and the mixture was dissolved in anhydrous MeCN (1.8 mL) followed
by an addition of diethylphosphite (30 L, 0.221 mmol, 1.2 eq.) and DIPEA (42 L, 0.240
3) (100 mg, 0.184 mmol, 1.0 eq.) and Pd(PPh3)4 (64 mg, 0.055 mmol,
µ
µ
mmol, 1.3 eq.) via septum. The mixture was degassed with a stream of argon for 15 min
followed by heating to 70 ◦C for 3 h until the starting material was fully consumed (TLC,
UPLC-MS). The reaction mixture was cooled to room temperature, filtered through Celite,
and washed with EtOAc. Solvents were evaporated and the resulting mixture was purified
by flash chromatography (SiO2, cyclohexane/EtOAc = 100:0
→
0:100) to afford the desired
1
phosphonate
4
(76 mg, 78%). H NMR (400 MHz, CDCl3)
δ
= 7.93 (dd, J = 14.9, 1.3 Hz, 1H),
7.76–7.70 (m, 2H), 7.39–7.31 (m, 2H), 6.65 (s, 1H), 4.27–4.04 (m, 4H), 2.42 (s, 3H), 2.32 (s, 3H),
2.30 (s, 3H), 1.34 (td, J = 7.0, 0.6 Hz, 6H) ppm. 13C NMR (101 MHz, CDCl3)
δ
= 176.3, 169.5,
168.0, 167.8, 161.2, 156.8 (d, J = 23.5 Hz), 149.6, 149.4, 145.1, 142.8, 135.9, 134.0, 129.4, 124.6,
124.5, 121.8, 121.5 (d, J = 9.5 Hz), 120.3 (d, J = 10.3 Hz), 119.4 (d, J = 2.6 Hz), 109.2, 63.1, 63.0,
21.1, 20.7, 20.6, 16.4, 16.4 ppm. 31P NMR (162 MHz, CDCl3)
δ = 16.58 ppm. HRMS (ESI)
m/z calcd for C25H25O11PNa [M+Na+]+ 555.1026, found 555.1023.
3.11. (2-(3,4-Dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromen-7-yl)phosphonic Acid (5)
4-(5-Acetoxy-7-(diethoxyphosphoryl)-4-oxo-4H-chromen-2-yl)-1,2-phenylene diacetate (
4)
(312 mg, 0.58 mmol, 1.0 eq.) was dissolved in dry CH2Cl2 (18 mL). Then, bromo-trimethyl-
silane (0.77 mL, 5.86 mmol, 10 eq.) was added dropwise under a nitrogen atmosphere. The
reaction mixture was stirred for 31 h until the starting material was fully consumed (TLC,
UPLC-MS). The solvent was evaporated and MeOH (3.1 mL) was added. The white suspension
was allowed to stir for 1 h followed by evaporation of the solvent. THF (5.8 mL) was added,
followed by an addition of 1 M KOH in MeOH (2.9 mL, 2.9 mmol, 5.0 eq). The reaction mixture
was allowed to stir for 1 h. Solvent was evaporated, and the resulting mixture was purified by
flash chromatography (SiO2-C18, H2O (0.1% TFA)/MeCN= 100:0
final phosphonic acid
(51 mg, 25%). 1H NMR (400 MHz, DMSO-d6)
J = 8.3, 2.3 Hz, 1H), 7.48 (d, J = 2.3 Hz, 1H), 7.34 (dd, J = 14.0, 1.2 Hz, 1H), 6.97 (dd, J = 13.7, 1.2
Hz, 1H), 6.91 (d, J = 8.3 Hz, 1H), 6.87 (s, 1H) ppm. 13C NMR (101 MHz, DMSO-d6)
= 183.1,
→
30:70) to afford the desired
5
δ
= 12.83 (s, 1H), 7.51 (dd,
δ
165.7, 159.9 (d, J = 19.7 Hz), 155.8, 155.6, 150.7, 146.3, 143.6, 141.9, 121.6, 120.0, 116.5, 114.2, 112.5
(d, J = 9.9 Hz), 111.5 (d, J = 2.6 Hz), 109.6 (d, J = 9.9 Hz), 104.2 ppm. 31P NMR (162 MHz, DMSO)
δ = 11.98 ppm. HRMS (ESI) m/z calcd for C15H10O8P [M−H+]– 349.0118, found 349.0118.

Int. J. Mol. Sci. 2021, 22, 7735
18 of 28
3.12. Palladium-Catalyzed Methoxycarbonylation of Triflate 3
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-1,2-
phenylene diacetate ( ) (100 mg, 0.184 mmol, 1.0 eq.), 1,3-bis(diphenylphosphino)propane
3
(7.50 mg, 0.018 mmol, 0.1 eq.), Mo(CO)6 (24 mg, 0.092 mmol, 0.5 eq.) and palladium acetate
(4.00 mg, 0.018 mmol, 0.1 eq.) was sealed, and dry DMSO (1.1 mL) and dry MeOH (0.7 mL)
were added via septum. The mixture was degassed with a stream of argon for 15 min followed
by◦addition of triethylamine (57
µL, 0.405 mmol, 2.2 eq.). The reaction mixture was heated to
70 C for 20 h until the starting material was fully consumed (UPLC-MS). The reaction mixture
was cooled to room temperature, diluted with MeOH (5 mL), and filtered through a syringe
filter. The solvents were evaporated, and the residue was purified by flash chromatography
(SiO2-C18, H2O (0.1% TFA)/MeCN = 100:0
ester 6 (28 mg, 40%) and deacetylated ester 7 (29 mg, 48%).
→
20:80) to afford the desired monoacetylated
3.13. Methyl 5-acetoxy-2-(3,4-dihydroxyphenyl)-4-oxo-4H-chromene-7-carboxylate (6)
1H NMR (401 MHz, DMSO-d6)
7.52 (m, 1H), 7.50 – 7.43 (m, 2H), 6.90 (d, J = 8.2 Hz, 1H), 6.69 (s, 1H), 3.92 (s, 3H), 2.33 (s,
3H) ppm. 13C NMR (101 MHz, DMSO-d6)
175.2, 169.0, 164.2, 162.9, 156.4, 149.9, 148.8,
δ 9.98 (s, 1H), 9.37 (s, 1H), 8.12 (t, J = 1.5 Hz, 1H), 7.56 –
δ
145.8, 133.9, 121.1, 119.3, 119.2, 118.8, 117.4, 116.0, 113.6, 106.2, 53.0, 20.9 ppm. HRMS (ESI)
m/z calcd for C19H14O8Na [M+Na+]+ 393.0581, found 393.0580.
3.14. Methyl 2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7-carboxylate (7)
1H NMR (401 MHz, DMSO-d6)
1.6 Hz, 1H), 7.55 (dd, J = 8.4, 2.3 Hz, 1H), 7.51 (d, J = 2.3 Hz, 1H), 7.22 (d, J = 1.6 Hz, 1H),
6.93–6.91 (m, 2H), 3.91 (s, 3H) ppm. 13C NMR (101 MHz, DMSO-d6)
182.9, 166.5, 165.3,
δ 12.91 (s, 1H), 10.11 (s, 1H), 9.42 (s, 1H), 7.64 (d, J =
δ
160.4, 156.0, 150.9, 146.3, 135.8, 121.4, 120.2, 116.5, 114.3, 113.0, 111.1, 108.7, 104.3, 53.3 ppm.
HRMS (ESI) m/z calcd for C17H12O7 [M+H+]+ 329.0656, found 329.0655.
3.15. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7-carboxylic acid (8)
A solution of methyl 2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7- car-
◦
boxylate (
7
) (136 mg, 0.41 mmol, 1.0 eq.) in THF (8.4 mL) was heated to 45 C under a
nitrogen atmosphere, followed by addition of 2 M aq. LiOH (4.2 mL, 8.3 mmol, 20 eq.)
via septum. The reaction mixture was stirred for 1 h until the starting material was fully
consumed (UPLC-MS). The solvents were evaporated and the residue was purified by flash
chromatography (SiO2-C18, H2O (0.1% TFA)/MeCN= 100:0
→
20:80) to afford the desired
1
final carboxylic acid
8
(93 mg, 71 %). H NMR (400 MHz, DMSO-d6)
δ
= 12.87 (s, 1H), 10.09
(s, 1H), 9.43 (s, 1H), 7.61 (d, J = 1.3 Hz, 1H), 7.53 (dd, J = 8.4, 2.3 Hz, 1H), 7.49 (d, J = 2.3 Hz,
1H), 7.21 (d, J = 1.3 Hz, 1H), 6.91 (d, J = 9.0 Hz, 2H) ppm. 13C NMR (101 MHz, DMSO-d6)
= 182.6, 165.8, 165.6, 159.9, 155.5, 150.4, 145.9, 136.9, 121.1, 119.7, 116.1, 113.8, 112.3, 110.8,
108.2, 103.8 ppm. HRMS (ESI) m/z calcd for C16H10O7 [M
H+]– 313.0354, found 313.0351.
δ
−
3.16. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7-carboxamide (9)
A tube with a mixture of methyl 5-acetoxy-2-(3,4-dihydroxyphenyl)-4-oxo-4H-chromene-
7-carboxylate (6) (21.5 mg, 0.058 mmol, 1.0 eq.) and methyl 2-(3,4-dihydroxyphenyl)-5-
hydroxy-4-oxo-4H-chromene-7-carboxylate (7) (22 mg, 0.067 mmol, 1.15 eq.) was sealed, and
7 M ammonia in MeOH (10 mL) was added via septum. The reaction mixture was heated to
◦
50 C and stirred for 4 days until the starting materials were fully consumed (UPLC-MS). The
solvents were evaporated and the residue was purified by preparative HPLC to obtain the
1
final amide
9
(8.0 mg, 21%). H NMR (600 MHz, DMSO-d6)
δ
= 12.82 (s, 1H), 10.07 (s, 1H),
9.45 (d, J = 2.5 Hz, 1H), 8.20 (s, 1H), 7.68 (s, 1H), 7.60 (d, J = 1.5 Hz, 1H), 7.51 (dd, J = 8.4, 2.3 Hz,
1H), 7.47 (d, J = 2.3 Hz, 1H), 7.25 (d, J = 1.3 Hz, 1H), 6.92 (d, J = 8.5 Hz, 1H), 6.89 (s, 1H) ppm.
13C NMR (151 MHz, DMSO-d6)
δ = 182.6, 166.1, 165.5, 159.8, 155.5, 150.3, 145.9, 140.7, 121.2,
119.5, 116.1, 113.7, 111.3, 109.6, 106.6, 103.8 ppm. HRMS (ESI) m/z calcd for C16H11NO6Na
[M+Na+]+ 336.0479, found 336.0479.

Int. J. Mol. Sci. 2021, 22, 7735
19 of 28
3.17. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-N-(2-hydroxyethyl)-4-oxo-4H-chromene-7-carboxamide (10
)
Methyl 2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7-carboxylate ( ) (70 mg,
7
0.213 mmol, 1.0 eq.) was mixed with dry EtOH (2 mL). Potassium carbonate (100 mg, 0.723
mmol, 3.4 eq.) was added, followed by 2-aminoethanol (0.6 mL). The reaction mixture was
◦
heated to 50 C and stirred for 48 h until the starting materials was fully consumed (UPLC-MS).
The solvents were evaporated and the residue was purified by preparative HPLC to obtain the
final amide 10 (17 mg, 23%). 1H NMR (400 MHz, DMSO-d6)
δ = 12.81 (s, 1H), 10.07 (s, 1H), 9.45
(s, 1H), 8.68 (t, J = 5.6 Hz, 1H), 7.59 (d, J = 1.5 Hz, 1H), 7.51 (dd, J = 8.3, 2.3 Hz, 1H), 7.48 (d, J
= 2.3 Hz, 1H), 7.23 (d, J = 1.5 Hz, 1H), 6.92 (d, J = 8.4 Hz, 1H), 6.89 (s, 1H), 3.53 (t, J = 6.1 Hz,
2H), 3.35 (q, J = 5.2, 4.4 Hz, 2H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ = 182.6, 165.4, 164.6,
159.8, 155.5, 150.3, 145.9, 140.9, 121.2, 119.5, 116.1, 113.7, 111.2, 109.3, 106.4, 103.7, 59.5, 42.4 ppm.
HRMS (ESI) m/z calcd for C18H15NO7Na [M+Na+]+ 380.0741, found 380.0742.
3.18. 7-Amino-2-(3,4-dihydroxyphenyl)-5-hydroxy-4H-chromen-4-one (11)
2-(3,4-Dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7-carboxylic acid (
0.102 mmol, 1.0 eq.) was dissolved in dry DMF (1 mL) followed by dropwise addition
of triethylamine (21 L, 0.143 mmol, 1.4 eq.) and diphenylphosphoryl azide (31 L,
8) (32 mg,
µ
µ
0.143 mmol, 1.4 eq.) under a nitrogen atmosphere. The reaction mixture was heated to
100 ◦C and st◦irred for 16 h. Water (1 mL) was added and the reaction mixture was stirred
for 3 h at 100 C. The solvents were evaporated and the residue was purified by preparative
1
HPLC to obtain the final amine 11 (8.7 mg, 30%). H NMR (500 MHz, DMSO-d6)
δ
= 12.93
(s, 1H), 9.83 (s, 1H), 9.39 (s, 1H),
δ = 7.36–7.33 (m, 2H), 6.87 (d, J = 8.1 Hz, 1H), 6.51 (s, 1H),
6.12 (d, J = 1.8 Hz, 1H), 5.92 (d, J = 2.0 Hz, 1H) ppm. 13C NMR (126 MHz, DMSO-d6)
δ
=
181.1, 163.2, 161.6, 158.1, 156.3, 149.7, 146.1, 122.3, 119.0, 116.5, 113.6, 103.0, 101.5, 96.3, 90.7
ppm. HRMS (ESI) m/z calcd for C15H12NO5 [M+H+]+ 286.0710, found 286.0710.
3.19. N-(2-(3,4-Dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromen-7-yl)acetamide (12)
7-Amino-2-(3,4-dihydroxyphenyl)-5-hydroxy-4H-chromen-4-one (11) (30 mg, 0.10 mmol,
1.0 eq.) was dissolved in dry DMF (0.5 mL), followed by addition of DIPEA (37 µL, 0.21 mmol,
2.0 eq.) and N-succinimidyl acetate (33 mg, 0.15 mmol, 1.5 eq.). The reaction mixture was
allowed to stir at room temperature for 36 h until the starting material was fully consumed
(UPLC-MS). The reaction mixture was directly purified by preparative HPLC to obtain the final
product 12 (7.9 mg, 23%). 1H NMR (400 MHz, DMSO-d6)
δ
= 10.57 (s, 1H), 7.78 (dd, J = 8.6, 2.3
Hz, 1H), 7.73 (d, J = 2.2 Hz, 1H), 7.06 (d, J = 8.6 Hz, 1H), 6.67 (s, 1H), 6.17 (d, J = 1.8 Hz, 1H),
5.94 (d, J = 2.0 Hz, 1H), 2.30 (s, 3H) ppm. 13C NMR (101 MHz, DMSO-d6)
= 180.6, 168.7, 161.7,
δ
161.1, 157.6, 155.9, 152.5, 138.7, 125.2, 122.0, 121.5, 117.3, 103.2, 101.1, 95.9, 90.4, 20.6 ppm. HRMS
(ESI) m/z calcd for C17H12NO6 [M−H+]– 326.0670, found 326.0671.
3.20. 4-(5-Acetoxy-7-cyano-4-oxo-4H-chromen-2-yl)-1,2-phenylene Diacetate (13)
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-
1,2-phenylene diacetate (3) (100 mg, 0.184 mmol, 1.00 eq.), zinc cyanide (12.0 mg, 0.101 mmol,
0.55 eq.), and XantPhos Pd G2 (2.00 mg, 0.002 mmol, 0.01 eq.) was sealed and purged
with nitrogen. Dry DMF (0.9 mL) and DIPEA (15 µL, 0.084 mmol, 0.15 eq.) were added.
The reaction mixture was heated to 85 ◦C and stirred for 16 h until the starting material
was fully consumed (TLC, UPLC-MS). Then the reaction mixture was cooled to room
temperature, and EtOAc (5 mL) was added. The reaction mixture was washed with water
(2
under reduced pressure. The resulting mixture was purified by flash chromatography
(SiO2, cyclohexane/EtOAc = 100:0 60:40) to afford the desired nitrile 13 (47 mg, 61 %).
1H NMR (400 MHz, CDCl3)
= 7.79 (d, J = 1.5 Hz, 1H), 7.75 (d, J = 2.2 Hz, 1H), 7.73–7.71
(m, 1H), 7.38 (d, J = 8.4 Hz, 1H), 7.27 (d, J = 1.5 Hz, 1H), 6.67 (s, 1H), 2.46 (s, 3H), 2.35 (s, 3H),
2.34 (s, 3H) ppm. 13C NMR (101 MHz, CDCl3)
= 175.5, 169.2, 168.0, 167.7, 161.4, 156.8,
×
10 mL), and the organic phase was dried over anhydrous MgSO4 and then evaporated
→
δ
δ
150.2, 145.3, 142.8, 128.9, 124.6, 124.5, 122.1, 121.8, 120.6, 120.2, 116.9, 116.2, 109.5, 21.0, 20.7,
20.6 ppm. HRMS (ESI) m/z calcd for C22H15NO8Na [M+Na+]+ 444.0690, found 444.0691.

Int. J. Mol. Sci. 2021, 22, 7735
20 of 28
3.21. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-7-(2H-tetrazol-5-yl)-4H-chromen-4-one (14)
A tube with 4-(5-acetoxy-7-cyano-4-oxo-4H-chromen-2-yl)-1,2-phenylene diacetate (13
)
(58 mg, 0.134 mmol, 1.0 eq) and NaN3 (36 mg, 0.562 mmol, 4.0 eq.) was sealed and the mixture
was dissolved in dry DMF (0.5 mL). The mixture was degassed with a stream of argon for 10
min, followed by addition of glacial acetic acid (2 drops) via septum and the reaction mixture
was heated to 130 ◦C for 16 h until the starting material was fully consumed (TLC, UPLC-MS).
The reaction mixture was cooled to room temperature, and 4 M HCl was added until the pH
reached 2. The solvents were evaporated, and the residue was purified by preparative HPLC to
obtain the final tetrazole derivative 14 (18 mg, 38%). 1H NMR (400 MHz, DMSO-d6)
δ = 13.02
(s, 1H), 10.09 (s, 1H), 9.45 (s, 1H), 7.77 (d, J = 1.5 Hz, 1H), 7.52 (dd, J = 8.4, 2.4 Hz, 1H), 7.49 (d, J
= 2.3 Hz, 1H), 7.39 (d, J = 1.6 Hz, 1H), 6.98 –6.86 (m, 2H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ
= 182.3, 165.4, 160.5, 156.1, 150.4, 145.9, 130.5, 121.0, 119.6, 116.1, 113.7, 111.2, 108.7, 105.8, 103.9
ppm. HRMS (ESI) m/z calcd for C16H11N4O5 [M+H+]+ 339.0724, found 339.0724.
3.22. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromene-7-carbonitrile (15)
4-(5-Acetoxy-7-cyano-4-oxo-4H-chromen-2-yl)-1,2-phenylene diacetate (13) (47 mg,
0.11 mmol, 1.0 eq.) was dissolved in THF (1.1 mL), followed by addition of 2 M aq. LiOH
(0.33 mL, 0.66 mmol, 6.0 eq.). The reaction mixture was allowed to stir for 24 h at room
temperature under a nitrogen atmosphere until the starting material was fully consumed
(UPLC-MS). Then, solvents were evaporated and the residue was purified by preparative
1
HPLC to obtain the final nitrile 15 (25 mg, 77%). H NMR (400 MHz, DMSO-d6)
δ
= 13.12
(s, 1H), 10.15 (s, 1H), 9.46 (s, 1H), 7.72 (d, J = 1.3 Hz, 1H), 7.50 (dd, J = 8.3, 2.3 Hz, 1H), 7.46
(d, J = 2.3 Hz, 1H), 7.25 (d, J = 1.5 Hz, 1H), 6.94 (s, 1H), 6.91 (d, J = 8.3 Hz, 1H) ppm. 13C
NMR (101 MHz, DMSO-d6) δ = 182.3, 165.7, 160.3, 155.5, 150.6, 145.9, 120.8, 119.8, 117.4,
116.6, 116.0, 113.9, 112.8, 111.8, 104.2 ppm. HRMS (ESI) m/z calcd for C16H10NO5 [M+H+]+
296.0554, found 296.0551.
3.23. Tert-Butyl ((2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromen-7-yl)methyl)carbamate (16)
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-
1,2-phenylene diacetate (3) (100 mg, 0.184 mmol, 1.0 eq.), potassium (((tert-butoxy- car-
bonyl)amino)methyl)trifluoroborate (66 mg, 0.276 mmol, 1.5 eq.), K2CO3 (127 mg, 0.552 mmol,
3.0 eq.) and SPhos Pd G2 (15 mg, 0.018 mmol, 0.1 eq.) was sealed, and THF/water (25:1, 3.5
mL) was added via septum. The mixture was degassed with a stream of argon for 15 min,
followed by heating to 100 ◦C for 2 h until the starting material was fully consumed (TLC,
UPLC-MS). The reaction mixture was cooled to room temperature, diluted with EtOAc (2 mL),
and filtered through a syringe filter. The solvents were evaporated and the residue was puri-
fied by flash chromatography (SiO2-C18, H2O/MeCN= 100:0
→
0:100) to afford the desired
1
carbamate 16 (32 mg, 43%). H NMR (400 MHz, DMSO-d6)
δ = 12.78 (s, 1H), 7.54 (t, J = 6.2
Hz, 1H), 7.47 (dd, J = 8.3, 2.3 Hz, 1H), 7.44 (d, J = 2.3 Hz, 1H), 6.98 (s, 1H), 6.91 (d, J = 8.3 Hz,
1H), 6.81 (s, 1H), 6.67 (d, J = 1.3 Hz, 1H), 4.21 (d, J = 6.1 Hz, 2H), 1.42 (s, 9H) ppm. 13C NMR
(101 MHz, DMSO-d6) δ = 183.0, 165.2, 160.2, 156.2, 150.7, 149.8, 146.3, 121.6, 119.8, 116.5, 113.9,
109.5, 109.1, 105.5, 103.8, 78.6, 43.9, 28.7 ppm. HRMS (ESI) m/z calcd for C21H22NO7 [M+H+]+
400.1391, found 400.1386.
3.24. 7-(Aminomethyl)-2-(3,4-dihydroxyphenyl)-5-hydroxy-4H-chromen-4-one (17)
Tert-butyl ((2-(3,4-dihydroxyphenyl)-5-hydroxy-4-oxo-4H-chromen-7-yl)methyl) car-
bamate (16) (25 mg, 0.063 mmol) was dissolved in THF/water (4:1, 1.5 mL), followed by
◦
addition of trifluoroacetic acid (0.6 mL). The reaction mixture was heated to 50 C and
allowed to stir for 48 h. The solvents were evaporated and the residue was purified by
1
preparative HPLC to obtain the final amine 17 (19 mg, 73%). H NMR (400 MHz, DMSO-d6)
δ
= 12.85 (s, 1H), 10.12 (s, 1H), 9.52 (s, 1H), 8.40 (s, 2H), 7.51–7.42 (m, 2H), 7.24 (d, J = 1.6
Hz, 1H), 6.97–6.90 (m, 2H), 6.87 (d, J = 1.8 Hz, 1H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ
= 182.5, 165.1, 159.9, 155.6, 150.3, 145.9, 142.1, 121.1, 119.3, 116.1, 113.6, 110.9, 109.5, 107.3,
103.7, 42.0 ppm. HRMS (ESI) m/z calcd for C16H14NO5 [M+H+]+ 300.0867, found 300.0870.

Int. J. Mol. Sci. 2021, 22, 7735
21 of 28
3.25. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-7-(1H-pyrrolo[2 ,3-B]pyridin-3-yl)-4H-chromen-4-one (18)
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-
1,2-phenylene diacetate (3) (100 mg, 0.184 mmol, 1.0 eq.), 3-(4,4,5,5-tetramethyl-1,3,2-
dioxaborolan-2-yl)-1H-pyrrolo[2,3-b]pyridine (54 mg, 0.221 mmol, 1.2 eq.), Cs2CO3 (240 mg,
0.736 mmol, 4.0 eq.) and Pd(PPh3)4 (21 mg, 0.018 mmol, 0.1 eq.) was sealed, and dry THF
(3.5 mL) was added via septum. The mixture was degassed with a stream of argon for 15
min. then heated to 100 ◦C for 16 h until the starting material was fully consumed (TLC,
UPLC-MS). The reaction mixture was cooled to room temperature, diluted with MeOH
(5 mL), and filtered through a syringe filter. The solvents were evaporated and the residue
1
was purified by preparative HPLC to obtain the final product 18 (6.6 mg, 10%). H NMR
(400 MHz, DMSO-d6) δ = 12.87 (s, 1H), 12.27 (s, 1H), 10.02 (s, 1H), 9.42 (s, 1H), 8.49 (dd, J =
8.1, 1.6 Hz, 1H), 8.34 (dd, J = 4.6, 1.6 Hz, 1H), 8.25 (d, J = 2.8 Hz, 1H), 7.60 – 7.43 (m, 3H),
7.28–7.23 (m, 1H), 7.20 (d, J = 1.5 Hz, 1H), 6.94 (d, J = 8.1 Hz, 1H), 6.81 (s, 1H) ppm. 13C
NMR (101 MHz, DMSO-d6) δ = 182.6, 165.1, 160.6, 156.9, 150.4, 149.5, 146.3, 143.7, 143.2,
128.5, 127.3, 122.0, 119.8, 117.6, 117.2, 116.4, 114.2, 113.3, 108.3, 108.2, 104.4, 103.8 ppm.
HRMS (ESI) m/z calcd for C22H13N2O5 [M−H+]– 385.0830, found 385.0827.
3.26. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-7-(1H-pyrazol-3-yl)-4H-chromen-4-one (19)
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-
1,2-phenylene diacetate (3) (100 mg, 0.184 mmol, 1.0 eq.), (1H-pyrazol-3-yl)boronic acid (31
mg, 0.276 mmol, 1.5 eq.), K2CO3 (127 mg, 0.920 mmol, 5.0 eq.), and SPhos Pd G2 (15 mg,
0.018 mmol, 0.1 eq.) was sealed, and dry THF (3.5 mL) was added via septum. The mixture
was degassed with a stream of argon for 15 min, then heated to 100 ◦C for 16 h until the
starting material was fully consumed (TLC, UPLC-MS). The reaction mixture was cooled
to room temperature, diluted with MeOH (5 mL), and filtered through a syringe filter. The
solvents were evaporated and the residue was purified by preparative HPLC to obtain the
1
final product 19 (15 mg, 25%). H NMR (400 MHz, DMSO-d6)
δ
= 12.84 (s, 1H), 7.83 (d, J =
2.3 Hz, 1H), 7.59 (d, J = 1.5 Hz, 1H), 7.52–7.46 (m, 2H), 7.27 (d, J = 1.5 Hz, 1H), 6.96 (d, J =
2.3 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.81 (s, 1H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ
= 182.4, 164.9, 160.1, 157.3, 156.3, 150.0, 147.3, 145.8, 140.1, 132.2, 121.4, 119.3, 116.0, 113.7,
109.0, 107.2, 103.6, 103.5 ppm. HRMS (ESI) m/z calcd for C18H13N2O5 [M+H+]+ 337.0819,
found 337.0819.
3.27. 2-(3,4-Dihydroxyphenyl)-5-hydroxy-7-(5-methyl-1H-pyrazol-3-yl)-4H-chromen-4-one (20
A tube with 4-(5-acetoxy-4-oxo-7-(((trifluoromethyl)sulfonyl)oxy)-4H-chromen-2-yl)-
1,2-phenylene diacetate ( ) (100 mg, 0.184 mmol, 1.0 eq.), (5-methyl-1H-pyrazol-3-yl)boronic
)
3
acid (35 mg, 0.276 mmol, 1.5 eq.), K2CO3 (127 mg, 0.920 mmol, 5 eq.), and SPhos Pd G2
(15 mg, 0.018 mmol, 0.1 eq.) was sealed, and THF/water (25:1, 3.5 mL) was added via
◦
septum. The mixture was degassed with a stream of argon for 15 min, then heated to 100 C
for 16 h until the starting material was fully consumed (TLC, UPLC-MS). The reaction
mixture was cooled to room temperature, diluted with MeOH (5 mL), and filtered through
a syringe filter. Then solvents were evaporated and the residue was purified by preparative
1
HPLC to obtain the final product 20 (12 mg, 19%). H NMR (400 MHz, DMSO-d6)
δ
= 7.51
(d, J = 1.5 Hz, 1H), 7.51–7.46 (m, 2H), 7.19 (d, J = 1.3 Hz, 1H), 6.92 (d, J = 8.2 Hz, 1H), 6.80 (s,
1H), 6.66 (d, J = 1.0 Hz, 1H), 2.28 (s, 3H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ
= 182.3,
164.8, 160.1, 158.4, 158.1, 156.2, 150.0, 145.8, 140.3, 121.4, 119.3, 116.0, 113.7, 108.9, 107.0,
103.5, 103.3, 102.7, 10.9 ppm. HRMS (ESI) m/z calcd for C19H15N2O5 [M+H+]+ 351.0976,
found 351.0975.

Int. J. Mol. Sci. 2021, 22, 7735
22 of 28
3.28. 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-8-((3-hydroxypiperidin-1-yl)methyl)-4H-chromen
-4-one (21)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of 3-hydroxypiperidine (35 mg, 0.35 mmol, 1.0 eq.) and a 35% formalin solution
(27 µL, 0.35 mmol, 1.0 eq.). The reaction mixture was allowed to stir at room temperature
for 16 h. The solvents were evaporated and the residue was purified by preparative HPLC
1
to obtain the final product 21 (27 mg, 20%). H NMR (500 MHz, DMSO-d6, 330 K)
δ
= 13.27
(s, 1H), 9.89 (s, 1H), 9.35 (s, 1H), 7.47 (dd, J = 8.2, 2.3 Hz, 1H), 7.45 (d, J = 2.3 Hz, 1H), 6.94 (d,
J = 8.2 Hz, 1H), 6.74 (d, J = 0.6 Hz, 1H), 6.39 (s, 1H), 5.33 (s, 1H), 4.63–4.29 (m, 2H), 4.01–2.80
(m, 5H), 2.11–1.31 (m, 4H) ppm. 13C NMR (126 MHz, DMSO-d6, 330 K)
δ = 181.7, 164.1,
163.7, 162.5, 156.5, 150.0, 145.9, 121.5, 119.3, 116.2, 113.7, 103.9, 103.2, 98.4, 95.5, 57.3, 51.9,
49.1 ppm. HRMS (ESI) m/z calcd for C21H20NO7 [M−H+]– 398.1245, found 398.1244.
3.29. 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-8-((4-hydroxypiperidin-1-yl)methyl)-4H-chromen-
4-one (22)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of 4-hydroxypiperidine (35 mg, 0.35 mmol, 1.0 eq.) and a 35% formalin solution
(27 µL, 0.35 mmol, 1.0 eq.). The reaction mixture was allowed to stir at room temperature
for 16 h. The solvents were evaporated and the residue was purified by preparative HPLC
1
to obtain the final product 22 (58 mg, 32%). H NMR (400 MHz, DMSO-d6)
δ = 13.32 (s,
1H), 12.17 (br s, 1H), 10.12 (br s, 1H), 9.38 (br s, 1H), 7.56–7.44 (m, 2H), 6.95 (d, J = 9.0 Hz,
1H), 6.79 (s, 1H), 6.43 (s, 2H), 4.43 (br s, 2H), 3.91 (br s, 1H), 3.39 – 2.97 (m, 4H), 1.89–1.48
(m, 4H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ = 182.2, 164.5, 164.2, 162.8, 156.8, 150.4,
146.3, 121.8, 119.7, 116.6, 113.8, 104.2, 103.5, 98.8, 96.1, 59.9, 51.1, 47.9, 31.7 ppm. HRMS
(ESI) m/z calcd for C21H22NO7 [M+H+]+ 400.1391, found 400.1387.
3.30. 1-((2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-chromen-8-yl)methyl)piperidin-4-one (23
)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of 4-piperidone monohydrate hydrochloride (54 mg, 0.35 mmol, 1.0 eq.), 35%
formalin solution (27 µL, 0.35 mmol, 1.0 eq.), and triethylamine (49 µL, 0.35 mmol, 1.0 eq.).
The reaction mixture was allowed to stir at room temperature for 16 h. Then, solvents were
evaporated and the residue was purified by preparative HPLC to obtain the final product
23 as a 3:1 mixture of C-8 and C-6 regioisomers (38 mg, 21%). Spectral data includes the
1
C-8 regioisomer only. H NMR (400 MHz, DMSO-d6)
δ
= 13.09 (s, 1H), 7.49–7.45 m, 2H),
6.93–6.91 (m, 1H), 6.73 (s, 1H), 6.29 (s, 1H), 3.97 (s, 2H), 2.93 (t, J = 5.8 Hz, 4H), 2.41 (t, J =
6.1 Hz, 4H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ
= 208.1, 183.3, 164.2, 164.0, 161.0, 155.8,
150.2, 146.2, 122.2, 119.5, 116.5, 113.9, 104.1, 103.1, 98.9, 94.1, 52.5, 49.4, 40.8 ppm. HRMS
(ESI) m/z calcd for C21H18NO7 [M−H+]– 396.1089, found 396.1085.
3.31. 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-8-(morpholinomethyl)-4H-chromen-4-one (24)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of morpholine (30 µL, 0.35 mmol, 1.0 eq.) and a 35% formalin solution (27 µL,
0.35 mmol, 1.0 eq.). The reaction mixture was allowed to stir at room temperature for 16 h.
Then, solvents were evaporated and the residue was purified by preparative HPLC to
1
obtain the final product 24 (46 mg, 26%). H NMR (400 MHz, DMSO-d6, 330 K)
δ
= 13.33 (s,
1H), 12.13 (br s, 1H), 10.07 (br s, 1H), 9.59 (br s, 1H), 7.51 (dd, J = 8.3, 2.3 Hz, 1H), 7.48 (d, J
= 2.3 Hz, 1H), 6.93 (d, J = 8.3 Hz, 1H), 6.79 (s, 1H), 6.42 (s, 1H), 4.47 (s, 2H), 4.01–3.20 (m,
8H) ppm. 13C NMR (101 MHz, DMSO-d6, 330 K)
δ = 181.8, 164.1, 163.9, 162.5, 156.4, 150.0,
145.9, 121.3, 119.4, 116.2, 113.6, 103.7, 103.0, 98.4, 95.2, 63.2, 51.5, 48.9 ppm. HRMS (ESI) m/z
calcd for C20H18NO7 [M−H+]— 384.1089, found 384.1087.

Int. J. Mol. Sci. 2021, 22, 7735
23 of 28
3.32. 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-8-((4-methylpiperazin-1-yl)methyl)-4H-chromen-
4-one (25)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of N-methyl-piperazine (40 L, 0.35 mmol, 1.0 eq.) and a 35% formalin solution
(27 L, 0.35 mmol, 1.0 eq.). The reaction mixture was allowed to stir at room temperature
µ
µ
for 16 h. Then, solvents were evaporated and the residue was purified by preparative
1
HPLC to obtain the final product 25 (44 mg, 31%). H NMR (500 MHz, DMSO-d6, 330 K)
δ
= 13.10 (br s, 1H), 7.46–7.41 (m, 2H), 6.93 (d, J = 8.7 Hz, 1H), 6.68 (s, 1H), 6.34 (s, 1H), 4.01
(br s, 2H), 3.34–2.87 (m, 8H), 2.75 (s, 3H) ppm. 13C NMR (126 MHz, DMSO-d6)
= 181.9,
164.0, 163.3, 161.2, 155.9, 149.9, 145.9, 121.7, 119.1, 116.2, 113.6, 103.8, 102.9, 98.4, 51.9, 49.1,
48.4, 42.3 ppm. HRMS (ESI) m/z calcd for C21H21N2O6 [M
H+]– 397.1405, found 397.1403.
δ
−
3.33. 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-8-(((2-hydroxyethyl)(methyl)amino)methyl)-4H
-chromen-4-one (26)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of N-methylethanolamine (28
µL, 0.35 mmol, 1.0 eq.) and a 35% formalin solution
(27 L, 0.35 mmol, 1.0 eq.). The reaction mixture was allowed to stir at room temperature
µ
for 16 h. Then, solvents were evaporated and the residue was purified by preparative
1
HPLC to obtain the final product 26 (42 mg, 32%). H NMR (400 MHz, DMSO-d6)
δ
= 13.96
(s, 1H), 12.21 (br s, 1H), 10.08 (br s, 1H), 9.54 (br s, 1H), 7.47 – 7.41 (m, 2H), 6.91 (d, J =
9.0 Hz, 1H), 6.76 (s, 1H), 6.65 (s, 1H), 5.34 (br s, 1H), 4.27 (br s, 2H), 3.80 (t, J = 5.4 Hz, 2H),
3.25 (br s, 2H), 2.75 (s, 3H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ = 181.8, 164.4, 163.5,
161.3, 157.6, 150.1, 145.9, 121.2, 119.2, 116.1, 113.5, 103.3, 102.9, 100.3, 93.5, 57.6, 55.4, 47.7,
40.5 ppm. HRMS (ESI) m/z calcd for C19H20NO7 [M+H+]+ 374.1234, found 374.1235.
3.34. 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-8-((3-hydroxy-8-azabicyclo[3.2.1]octan-8-yl)methyl)-
4Hn -chromen-4-one (27)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by an
addition of nortropine hydrochloride (58 mg, 0.35 mmol, 1.0 eq.), a 35% formalin solution
(27 µL, 0.35 mmol, 1.0 eq.), and triethylamine (49 µL, 0.35 mmol, 1.0 eq.). The reaction
mixture was allowed to stir at room temperature for 16 h. Then, solvents were evaporated
and the residue was purified by preparative HPLC to obtain the final product 27 (10 mg,
1
7%). H NMR (500 MHz, DMSO-d6)
δ = 13.27 (s, 1H), 11.94 (br s, 1H), 10.09 (br s, 1H),
9.51 (br s, 1H), 8.83 (br s, 1H), 7.48 (dd, J = 8.3, 2.4 Hz, 1H), 7.43 (d, J = 2.4 Hz, 1H), 6.93
(d, J = 8.4 Hz, 1H), 6.81 (s, 1H), 6.38 (s, 1H), 4.95 (br s, 1H), 4.27 (s, 2H), 4.17–3.66 (m, 4H),
2.47–2.35 (m, 4H), 2.18 (br d, J = 15.4 Hz, 2H), 1.88 (br d, J = 14.3 Hz, 2H) ppm. 13C NMR
(126 MHz, DMSO-d6) δ = 181.9, 164.3, 163.7, 162.5, 156.6, 150.2, 146.1, 121.7, 119.5, 116.3,
113.8, 104.0, 103.4, 98.5, 96.7, 62.1, 60.6, 44.9, 37.2 (2C), 24.4 (2C) ppm. HRMS (ESI) m/z calcd
for C23H22NO7 [M−H+]– 424.1402, found 424.1400.
3.35. 8-((6,7-Dihydroxy-3,4-dihydroisoquinolin-2(1H)-yl)methyl)-2-(3,4-dihydroxyphenyl)-5,7-
dihydroxy-4H-chromen-4-one (28)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in MeOH (5 mL), followed by
addition of 6,7-dihydroxy-1,2,3,4-tetrahydroisoquinolin-2-ium chloride (71 mg, 0.35 mmol,
1.0 eq.), a 35% formalin solution (27 µL, 0.35 mmol, 1.0 eq.), and triethylamine (49 µL, 0.35
mmol, 1.0 eq.). The reaction mixture was allowed to stir at room temperature for 16 h.
Then, solvents were evaporated and the residue was purified by preparative HPLC to
1
obtain the final product 28 (46 mg, 23 %). H NMR (400 MHz, DMSO-d6)
δ
= 13.29 (s, 1H),
12.07 (br s, 1H), 10.07 (br s, 1H), 9.62 (br s, 1H), 9.12 (br s, 1H), 9.06 (s, 1H), 7.52–7.46 (m,
1H), 7.45 (d, J = 2.3 Hz, 1H), 6.92 (d, J = 8.3 Hz, 1H), 6.79 (s, 1H), 6.57 (s, 1H), 6.53 (s, 1H),
6.41 (s, 1H), 4.54 (s, 2H), 4.36 (s, 2H), 3.58 (br s, 2H), 2.91 (t, J = 6.9 Hz, 2H) ppm. 13C NMR
(101 MHz, DMSO-d6)
δ = 182.2, 164.4, 164.2, 162.8, 156.8, 150.4, 146.3, 145.9, 144.9, 121.8
(2C), 119.7, 118.9, 116.6, 115.3, 114.0, 113.5, 104.2, 103.4, 98.7, 96.1, 53.0, 49.8, 48.2, 24.8 ppm.
HRMS (ESI) m/z calcd for C25H20NO8 [M−H+]– 462.1194, found 462.1193.

Int. J. Mol. Sci. 2021, 22, 7735
24 of 28
3.36. (S)-1-((2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-chromen-8-yl)methyl)pyrro-
lidine-2-carboxamide (29)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in EtOH (5 mL), followed by
an addition of L-prolinamide hydrochloride (71 mg, 0.35 mmol, 1.0 eq.), a 35% formalin
solution (27 µL, 0.35 mmol, 1.0 eq.), and triethylamine (49 µL, 0.35 mmol, 1.0 eq.). The
reaction mixture was allowed to stir at room temperature for 16 h. Then, solvents were
evaporated and the residue was purified by preparative HPLC to obtain the final product
1
29 (19 mg, 10%). H NMR (400 MHz, DMSO-d6)
δ
= 13.31 (s, 1H), 11.85 (br s, 1H), 10.08 (br
s, 1H), 9.52 (br s, 1H), 9.38 (br s, 1H), 7.96 (s, 1H), 7.69 (s, 1H), 7.55 (dd, J = 8.4, 2.3 Hz, 1H),
7.47 (d, J = 2.3 Hz, 1H), 6.93 (d, J = 8.4 Hz, 1H), 6.77 (s, 1H), 6.34 (s, 1H), 4.54 (d, Jgem = 13.7
Hz, 1H), 4.48 (d, Jgem = 13.7 Hz, 1H), 4.16 (br d, J = 9.3 Hz, 1H), 3.56 (br s, 2H), 2.47–2.35 (m,
1H), 2.04–1.93 (m, 1H), 1.89–1.77 (m, 2H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ = 181.8,
169.3, 164.1, 163.6, 162.4, 156.4, 150.0, 145.8, 121.3, 119.6, 116.0, 113.9, 103.7, 103.0, 98.3, 96.0,
65.9, 53.9, 45.5, 29.2, 22.3 ppm. HRMS (ESI) m/z calcd for C21H21N2O7 [M+H+]+ 413.1343,
found 413.1344.
3.37. ((2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-chromen-8-yl)methyl)-L-proline (30)
Luteolin (100 mg, 0.35 mmol, 1.0 eq.) was dissolved in EtOH (5 mL), followed by
addition of L-proline tert-butyl ester hydrochloride (72 mg, 0.35 mmol, 1.0 eq.) and a 35%
formalin solution (27 µL, 0.35 mmol, 1.0 eq.). The reaction mixture was stirred at room
temperature for 16 h. The solvent was evaporated under reduced pressure and the residue
was purified by preparative HPLC to obtain the monosubstituted luteolin C-8 derivative
as tert-butyl ester (UPLC-MS: m/z = 470). The monosubstituted luteolin C-8 derivative was
used in the next step without further characterization. The tert-butyl ester was dissolved
in a mixture of TFA/DCM (1:1, 1 mL) with 1,3-dimethoxybenzene (25 µL, 0.19 mmol, 0.54
eq.) as a scavenger. The reaction mixture was allowed to stir at room temperature for 16 h.
The reaction mixture was concentrated using a stream of nitrogen, and the product was
precipitated with tert-butyl methyl ether. The precipitate was collected and purified by
1
preparative HPLC to obtain the product 30 (9.5 mg, 7% – over two steps). H NMR (500
MHz, DMSO-d6) δ = 13.25 (s, 1H), 9.91 (br s, 1H), 7.68 (d, J = 2.3 Hz, 1H), 7.48 (dd, J = 8.4,
2.3 Hz, 1H), 6.88 (d, J = 8.2 Hz, 1H), 6.77 (s, 1H), 6.31 (s, 1H), 4.50 (d, Jgem = 13.7 Hz, 1H),
4.39 (d, Jgem = 13.7 Hz, 1H), 4.03 (m, 1H), 3.39 (m, 1H), 3.13–2.98 (m, 1H), 2.39–2.31 (m, 1H),
1.96 (m, 2H), 1.79 (m, 1H) ppm. 13C NMR (126 MHz, DMSO-d6)
δ = 181.9, 170.8, 164.0,
163.7, 161.9, 156.0, 149.8, 145.9, 121.2, 119.0, 116.1, 114.3, 103.7, 102.7, 98.3, 97.4, 67.0, 53.6,
46.1, 28.4, 22.5. HRMS (ESI) m/z calcd for C21H18NO8 [M−H+]– 412.1035, found 412.1037.
3.38. 1-((2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-chromen-8-yl)methyl)piperidine-
4-carboxylic acid (31)
Luteolin (143 mg, 0.50 mmol, 1.0 eq.) was dissolved in MeOH (7 mL), followed by
addition of ethyl 4-piperidinecarboxylate (77
solution (38 L, 0.35 mmol, 1.0 eq.). The reaction mixture was allowed to stir at room
temperature for 16 h. The solvent was evaporated under reduced pressure and the residue
was purified by flash chromatography (SiO2-C18, H2O (0.1% TFA)/MeCN= 100:0 20:80)
µL, 0.50 mmol, 1.0 eq.) and a 35% formalin
µ
→
to obtain the monosubstituted luteolin C-8 derivative as an ethyl ester (UPLC-MS: m/z
= 456). The monosubstituted luteolin C-8 derivative was used in the next step without
further characterization. The ethyl ester was dissolved in THF (2 mL) and 5% aq. HCl
◦
(2 mL) was added. The reaction mixture was allowed to stir at 70 C for 7 h until the
starting material was fully consumed (UPLC-MS). Then, solvents were evaporated and
the residue was purified by preparative HPLC to obtain the final product 31 (60 mg, 22% –
1
over 2 steps). H NMR (400 MHz, DMSO-d6)
δ
= 13.31 (s, 1H), 12.07 (br s, 1H), 10.09 (br s,
1H), 9.56 (br s, 1H), 7.49 (dd, J = 8.3, 2.3 Hz, 1H), 7.46 (d, J = 2.2 Hz, 1H), 6.93 (d, J = 8.3 Hz,
1H), 6.79 (s, 1H), 6.40 (s, 1H), 4.41 (s, 2H), 3.73–3.37 (m, 4H), 3.28–3.08 (m, 1H), 2.13–1.69 (m,
4H) ppm. 13C NMR (101 MHz, DMSO-d6)
δ = 181.8, 174.7, 164.1, 163.8, 162.5, 156.4, 150.0,

Int. J. Mol. Sci. 2021, 22, 7735
25 of 28
145.9, 121.3, 119.3, 116.2, 113.6, 103.8, 103.1, 98.4, 95.6, 51.5 (2C), 48.7, 37.6, 25.4 (2C) ppm.
HRMS (ESI) m/z calcd for C22H20NO8 [M−H+]– 426.1194, found 426.1190.
3.39. N-((2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-chromen-8-yl)methyl)-
N-methylglycine (32)
Luteolin (143 mg, 0.50 mmol, 1.0 eq.) was dissolved in MeOH (7 mL), followed
by addition of sarcosine methyl ester hydrochloride (70 mg, 0.50 mmol, 1.0 eq.), a 35%
formalin solution (38 µL, 0.35 mmol, 1.0 eq.), and triethylamine (70 µL, 0.50 mmol, 1.0 eq.).
The reaction mixture was allowed to stir at room temperature for 16 h. The solvent was
evaporated under reduced pressure and the residue was purified by flash chromatography
(SiO2-C18, H2O (0.1% TFA)/MeCN= 100:0
→
40:60) to obtain the monosubstituted luteolin
C-8 derivative as a methyl ester (UPLC-MS: m/z = 402). The monosubstituted luteolin C-8
derivative was used in the next step without further characterization. The methyl ester
was dissolved in THF (2 mL) and 5% aq. HCl (2 mL) was added. The reaction mixture
◦
was allowed to stir at 70 C for 3 days until the starting material was fully consumed
(UPLC-MS). The solvents were evaporated and the residue was purified by preparative
HPLC to obtain the final product 32 (29 mg, 12% – over 2 steps). 1H NMR (400 MHz,
DMSO-d6)
7.49 (d, J = 2.3 Hz, 1H), 6.92 (d, J = 8.3 Hz, 1H), 6.76 (s, 1H), 6.35 (s, 1H), 4.49 (s, 2H), 4.00 (s,
2H), 2.75 (s, 3H) ppm. 13C NMR (101 MHz, DMSO-d6)
= 181.8, 168.1, 164.0 (2C), 162.3,
δ = 13.30 (s, 1H), 10.09 (br s, 1H), 9.54 (br s, 1H), 7.52 (dd, J = 8.3, 2.3 Hz, 1H),
δ
156.4, 149.9, 145.9, 121.3, 119.3, 116.0, 113.8, 103.8, 103.0, 98.4, 96.1, 55.5, 48.2, 40.9 ppm.
HRMS (ESI) m/z calcd for C19H18NO8 [M+H+]+ 388.1027, found 388.1026.
4. Conclusions
Bio-isosteric replacement of the hydroxyl group at C-7 failed to provide luteolin
congeners with comparable inhibitory potency against the influenza PA-Nter domain.
However, the introduction of diverse substituents at C-8 increased the binding affinity
of the resulting compounds. Crystallographic study of the orientin complex with I38T
PA-Nter revealed an additional point of interaction of the flavonoid with Thr-38 mediated
by a water molecule.
Supplementary Materials: Supplementary materials can be found at https://www.mdpi.com/
article/10.3390/ijms22147735/s1.
Author Contributions: Synthesis of compounds, R.R. and V.Z.; structural work, K.R., J.B.; IC50
determination, M.K. (Michal Král’); supervision, P.M.; NMR experiments, M.D.; funding acquisition,
J.K.; original draft preparation, M.K. (Milan Kožíšek) and A.M. All authors have read and agreed to
the published version of the manuscript.
Funding: This research was funded by EATRIS-CZ (grant No. LM2018133) from the Ministry of Education
of the Czech Republic and by the European Regional Development Fund; OP RDE; Project: “Chemical
biology for drugging undruggable targets (ChemBioDrug)” (No. CZ.02.1.01/0.0/0.0/16_019/0000729).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available in the article.
Acknowledgments: The authors thank Radko Soucˇek for HPLC analyses as well as Hillary Hoffman
and Joshua Smith for proofreading of the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Iuliano, A.D.; Roguski, K.M.; Chang, H.H. Estimates of global seasonal influenza-associated respiratory mortality: A modelling
study. Lancet 2018, 391, 1285–1300. [CrossRef]
2.
Fodor, E. The RNA polymerase of influenza A virus: Mechanisms of viral transcription and replication. Acta Virol. 2013, 57,
113–122. [CrossRef]

Int. J. Mol. Sci. 2021, 22, 7735
26 of 28
3.
4.
5.
6.
Eisfeld, A.J.; Neumann, G.; Kawaoka, Y. At the centre: Influenza A virus ribonucleoproteins. Nat. Rev. Microbiol. 2015, 13, 28–41.
[CrossRef]
Ortin, J.; Martin-Benito, J. The RNA synthesis machinery of negative-stranded RNA viruses. Virology 2015, 479, 532–544.
[CrossRef]
Dias, A.; Bouvier, D.; Crepin, T.; McCarthy, A.A.; Hart, D.J.; Baudin, F.; Cusack, S.; Ruigrok, R.W.H. The cap-snatching
endonuclease of influenza virus polymerase resides in the PA subunit. Nature 2009, 458, 914–918. [CrossRef] [PubMed]
Walker, A.P.; Fodor, E. Interplay between influenza virus and the host RNA polymerase II transcriptional machinery. Trends
Microbiol. 2019, 27, 398–407. [CrossRef] [PubMed]
7.
8.
De Vlugt, C.; Sikora, D.; Pelchat, M. Insight into influenza: A virus cap-snatching. Viruses 2018, 10, 641. [CrossRef] [PubMed]
Guilligay, D.; Tarendeau, F.; Resa-Infante, P.; Coloma, R.; Crepin, T.; Sehr, P.; Lewis, J.; Ruigrok, R.W.H.; Ortin, J.; Hart, D.J.;
et al. The structural basis for cap binding by influenza virus polymerase subunit PB2. Nat. Struct. Mol. Biol. 2008, 15, 500–506.
[CrossRef]
9.
Credille, C.V.; Dick, B.L.; Morrison, C.N.; Stokes, R.W.; Adamek, R.N.; Wu, N.C.; Wilson, I.A.; Cohen, S.M. Structure-activity
relationships in metal-binding pharmacophores for influenza endonuclease. J. Med. Chem. 2018, 61, 10206–10217. [CrossRef]
[PubMed]
10. Bouloy, M.; Plotch, S.J.; Krug, R.M. Globin messenger-RNAs are primers for transcription of influenza viral-RNA In Vitro. Proc.
Natl. Acad. Sci. USA 1978, 75, 4886–4890. [CrossRef] [PubMed]
11. Hayden, F.G.; Shindo, N. Influenza virus polymerase inhibitors in clinical development. Curr. Opin. Infect. Dis. 2019, 32, 176–186.
[CrossRef]
12. Stevaert, A.; Naesens, L. The influenza virus polymerase complex: An update on its structure, functions, and significance for
antiviral drug design. Med. Res. Rev. 2016, 36, 1127–1173. [CrossRef]
13. Clark, M.P.; Ledeboer, M.W.; Davies, I.; Byrn, R.A.; Jones, S.M.; Perola, E.; Tsai, A.; Jacobs, M.; Nti-Addae, K.; Bandarage, U.K.; et al.
Discovery of a novel, first-in-class, orally bioavailable azaindole inhibitor (VX-787) of influenza PB2. J. Med. Chem. 2014, 57,
6668–6678. [CrossRef] [PubMed]
14. Byrn, R.A.; Jones, S.M.; Bennett, H.B.; Bral, C.; Clark, M.P.; Jacobs, M.D.; Kwong, A.D.; Ledeboer, M.W.; Leeman, J.R.; Mc-
Neil, C.F.; et al. Preclinical activity of VX-787, a first-in-class, orally bioavailable inhibitor of the influenza virus polymerase PB2
subunit. Antimicrob. Agents Chemother. 2015, 59, 1574–1587. [CrossRef] [PubMed]
15. Sugiyama, K.; Obayashi, E.; Kawaguchi, A.; Suzuki, Y.; Tame, J.R.H.; Nagata, K.; Park, S.Y. Structural insight into the essential
PB1-PB2 subunit contact of the influenza virus RNA polymerase. EMBO J. 2009, 28, 1803–1811. [CrossRef]
16. He, X.J.; Zhou, J.; Bartlam, M.; Zhang, R.G.; Ma, J.Y.; Lou, Z.Y.; Li, X.M.; Li, J.J.; Joachimiak, A.; Zeng, Z.H.; et al. Crystal structure
of the polymerase PA(C)-PB1(N) complex from an avian influenza H5N1 virus. Nature 2008, 454, 1123–1126. [CrossRef] [PubMed]
17. Hejdanek, J.; Radilova, K.; Pachl, P.; Hodek, J.; Machara, A.; Weber, J.; Rezacova, P.; Konvalinka, J.; Kozisek, M. Structural
characterization of the interaction between the C-terminal domain of the influenza polymerase PA subunit and an optimized
small peptide inhibitor. Antivir. Res. 2021, 185, 104971. [CrossRef]
18. Ju, H.; Zhang, J.; Huang, B.S.; Kang, D.W.; Huang, B.; Liu, X.Y.; Zhan, P. Inhibitors of influenza virus polymerase acidic (PA)
endonuclease: Contemporary developments and perspectives. J. Med. Chem. 2017, 60, 3533–3551. [CrossRef]
19. Kowalinski, E.; Zubieta, C.; Wolkerstorfer, A.; Szolar, O.H.J.; Ruigrok, R.W.H.; Cusack, S. Structural analysis of specific metal
chelating inhibitor binding to the endonuclease domain of influenza pH1N1 (2009) polymerase. PLoS Pathog. 2012, 8, e1002831.
[CrossRef]
20. Chen, A.Y.; Adamek, R.N.; Dick, B.L.; Credille, C.V.; Morrison, C.N.; Cohen, S.M. Targeting metalloenzymes for therapeutic
intervention. Chem. Rev. 2019, 119, 1323–1455. [CrossRef]
21. Rouffet, M.; Cohen, S.M. Emerging trends in metalloprotein inhibition. Dalton Trans. 2011, 40, 3445–3454. [CrossRef]
22. Riccardi, L.; Genna, V.; De Vivo, M. Metal-ligand interactions in drug design. Nat. Rev. Chem. 2018, 2, 100–112. [CrossRef]
23. Yang, Y.; Hu, X.Q.; Li, Q.S.; Zhang, X.X.; Ruan, B.F.; Xu, J.; Liao, C.Z. Metalloprotein inhibitors for the treatment of human
diseases. Curr. Top. Med. Chem. 2016, 16, 384–396. [CrossRef] [PubMed]
24. Kikuchi, T.; Watanabe, A. Baloxavir heralds a new era in influenza virus biology. Respir. Investig. 2019, 57, 1–2. [CrossRef]
[PubMed]
25. Noshi, T.; Kitano, M.; Taniguchi, K.; Yamamoto, A.; Omoto, S.; Baba, K.; Hashimoto, T.; Ishida, K.; Kushima, Y.; Hattori, K.; et al.
In Vitro characterization of baloxavir acid, a first-in-class cap-dependent endonuclease inhibitor of the influenza virus polymerase
PA subunit. Antivir. Res. 2018, 160, 109–117. [CrossRef]
26. Omoto, S.; Speranzini, V.; Hashimoto, T.; Noshi, T.; Yamaguchi, H.; Kawai, M.; Kawaguchi, K.; Uehara, T.; Shishido, T.;
Naito, A.; et al. Characterization of influenza virus variants induced by treatment with the endonuclease inhibitor baloxavir
marboxil. Sci. Rep. 2018, 8, 1–15. [CrossRef] [PubMed]
27. Hastings, J.C.; Selnick, H.; Wolanski, B.; Tomassini, J.E. Anti-influenza virus activities of 4-substituted 2,4-dioxobutanoic acid
inhibitors. Antimicrob. Agents Chemother. 1996, 40, 1304–1307. [CrossRef]
28. Liao, Y.X.; Ye, Y.L.; Li, S.M.; Zhuang, Y.L.; Chen, L.Y.; Chen, J.X.; Cui, Z.N.; Huo, L.J.; Liu, S.W.; Song, G.P. Synthesis and SARs
of dopamine derivatives as potential inhibitors of influenza virus PA(N) endonuclease. Eur. J. Med. Chem. 2020, 189, 112048.
[CrossRef]

Int. J. Mol. Sci. 2021, 22, 7735
27 of 28
29. Sagong, H.Y.; Bauman, J.D.; Patel, D.; Das, K.; Arnold, E.; LaVoie, E.J. Phenyl substituted 4-Hydroxypyridazin-3(2H)-ones and
5-Hydroxypyrimidin-4(3H)-ones: Inhibitors of influenza A endonuclease. J. Med. Chem. 2014, 57, 8086–8098. [CrossRef]
30. Parhi, A.K.; Xiang, A.; Bauman, J.D.; Patel, D.; Vijayan, R.S.K.; Das, K.; Arnold, E.; LaVoie, E.J. Phenyl substituted 3-
hydroxypyridin-2(1H)-ones: Inhibitors of influenza A endonuclease. Bioorg. Med. Chem. 2013, 21, 6435–6446. [CrossRef]
31. Credille, C.V.; Chen, Y.; Cohen, S.M. Fragment-based identification of influenza endonuclease inhibitors. J. Med. Chem. 2016, 59,
6444–6454. [CrossRef] [PubMed]
32. Tomassini, J.E.; Davies, M.E.; Hastings, J.C.; Lingham, R.; Mojena, M.; Raghoobar, S.L.; Singh, S.B.; Tkacz, J.S.; Goetz, M.A. A
novel antiviral agent which inhibits the endonuclease of influenza viruses. Antimicrob. Agents Chemother. 1996, 40, 1189–1193.
[CrossRef] [PubMed]
33. Kuzuhara, T.; Iwai, Y.; Takahashi, H.; Hatakeyama, D.; Echigo, N. Green tea catechins inhibit the endonuclease activity of
influenza A virus RNA polymerase. PLoS Curr. 2009, 1, RRN1052. [CrossRef] [PubMed]
34. Song, J.M.; Lee, K.H.; Seong, B.L. Antiviral effect of catechins in green tea on influenza virus. Antivir. Res. 2005, 68, 66–74.
[CrossRef] [PubMed]
35. Sagong, H.Y.; Parhi, A.; Bauman, J.D.; Patel, D.; Vijayan, R.S.K.; Das, K.; Arnod, E.; LaVoie, E.J. 3-Hydroxyquinolin-2(1H)-ones as
inhibitors of influenza A endonuclease. ACS Med. Chem. Lett. 2013, 4, 547–550. [CrossRef]
36. Carcelli, M.; Rogolino, D.; Gatti, A.; De Luca, L.; Sechi, M.; Kumar, G.; White, S.W.; Stevaert, A.; Naesens, L. N-acylhydrazone
inhibitors of influenza virus PA endonuclease with versatile metal binding modes. Sci. Rep. 2016, 6, 1–14. [CrossRef]
37. Zima, V.; Radilova, K.; Kozisek, M.; Albinana, C.B.; Karlukova, E.; Brynda, J.; Fanfrlik, J.; Flieger, M.; Hodek, J.; Weber, J.; et al.
Unraveling the anti-influenza effect of flavonoids: Experimental validation of luteolin and its congeners as potent influenza
endonuclease inhibitors. Eur. J. Med. Chem. 2020, 208, 112754. [CrossRef]
38. Sarawek, S.; Derendorf, H.; Butterweck, V. Pharmacokinetics of luteolin and metabolites in rats. Nat. Prod. Commun. 2008, 3,
2029–2036. [CrossRef]
39. Thilakarathna, S.H.; Rupasinghe, H.P.V. Flavonoid bioavailability and attempts for bioavailability enhancement. Nutrients 2013
,
5, 3367–3387. [CrossRef]
40. Patani, G.A.; LaVoie, E.J. Bioisosterism: A rational approach in drug design. Chem. Rev. 1996, 96, 3147–3176. [CrossRef] [PubMed]
41. Li, M.; Han, X.W.; Yu, B. Facile synthesis of flavonoid 7-O-glycosides. J. Org. Chem. 2003, 68, 6842–6845. [CrossRef]
42. Subramaniapillai, S.G. Mannich reaction: A versatile and convenient approach to bioactive skeletons. J. Chem. Sci. 2013, 125,
467–482. [CrossRef]
43. Li, Y.Q.; Yang, F.; Wang, L.; Cao, Z.; Han, T.J.; Duan, Z.A.; Li, Z.; Zhao, W.J. Phosphoramidate protides of five flavones and their
antiproliferative activity against HepG2 and L-O2 cell lines. Eur. J. Med. Chem. 2016, 112, 196–208. [CrossRef] [PubMed]
44. Hirao, T.; Masunaga, T.; Ohshiro, Y.; Agawa, T. A Novel synthesis of dialkyl arenephosphonates. Synthesis 1981, 1, 56–57.
[CrossRef]
45. Albinana, C.B.; Machara, A.; Rezacova, P.; Pachl, P.; Konvalinka, J.; Kozisek, M. Kinetic, thermodynamic and structural analysis
of tamiphosphor binding to neuraminidase of H1N1 (2009) pandemic influenza. Eur. J. Med. Chem. 2016, 121, 100–109. [CrossRef]
46. Huang, H.; Song, C.J.; Wang, Z.; Li, M.Y.; Chang, J.B. Total synthesis of tanshinone IIA. Tetrahedron Lett. 2020, 61. [CrossRef]
47. Cohen, D.T.; Buchwald, S.L. Mild palladium-catalyzed cyanation of (hetero)aryl halides and triflates in aqueous media. Org. Lett.
2015, 17, 202–205. [CrossRef] [PubMed]
48. Molander, G.A.; Shin, I. Synthesis and Suzuki-Miyaura cross-coupling reactions of potassium Boc-protected aminomethyltrifluo-
roborate with aryl and hetaryl halides. Org. Lett. 2011, 13, 3956–3959. [CrossRef]
49. Wen, G.; Liu, Q.; Hu, H.B.; Wang, D.M.; Wu, S. Design, synthesis, biological evaluation, and molecular docking of novel flavones
as H3R inhibitors. Chem. Biol. Drug Des. 2017, 90, 580–589. [CrossRef]
50. Helgren, T.R.; Sciotti, R.J.; Lee, P.; Duffy, S.; Avery, V.M.; Igbinoba, O.; Akoto, M.; Hagen, T.J. The synthesis, antimalarial activity
and CoMFA analysis of novel aminoalkylated quercetin analogs. Bioorg. Med. Chem. Lett. 2015, 25, 327–332. [CrossRef]
51. Joshi, D.; Field, J.; Murphy, J.; Abdelrahim, M.; Schonherr, H.; Sparrow, J.R.; Ellestad, G.; Nakanishi, K.; Zask, A. Synthesis of
antioxidants for prevention of age-related macular degeneration. J. Nat. Prod. 2013, 76, 450–454. [CrossRef] [PubMed]
52. DuBois, R.M.; Slavish, P.J.; Baughman, B.M.; Yun, M.K.; Bao, J.; Webby, R.J.; Webb, T.R.; White, S.W. Structural and biochemical
basis for development of influenza virus inhibitors targeting the PA endonuclease. PLoS Pathog. 2012, 8, e1002830. [CrossRef]
[PubMed]
53. Kabsch, W. Xds. Acta Crystallogr. D 2010, 66, 125–132. [CrossRef] [PubMed]
54. Kabsch, W. Integration, scaling, space-group assignment and post-refinement. Acta Crystallogr. D 2010, 66, 133–144. [CrossRef]
55. Vagin, A.; Teplyakov, A. MOLREP: An automated program for molecular replacement. J. Appl. Crystallogr. 1997, 30, 1022–1025.
[CrossRef]
56. Winn, M.D.; Ballard, C.C.; Cowtan, K.D.; Dodson, E.J.; Emsley, P.; Evans, P.R.; Keegan, R.M.; Krissinel, E.B.; Leslie, A.G.W.;
McCoy, A.; et al. Overview of the CCP4 suite and current developments. Acta Crystallogr. Sect. D Struct. Biol. 2011, 67, 235–242.
[CrossRef]
57. Emsley, P.; Cowtan, K. Coot: Model-building tools for molecular graphics. Acta Crystallogr. Sect. D Struct. Biol. 2004, 60, 2126–2132.
[CrossRef]

Int. J. Mol. Sci. 2021, 22, 7735
28 of 28
58. Murshudov, G.N.; Skubak, P.; Lebedev, A.A.; Pannu, N.S.; Steiner, R.A.; Nicholls, R.A.; Winn, M.D.; Long, F.; Vagin, A.A.
REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr. Sect. D Struct. Biol. 2011, 67, 355–367.
[CrossRef]
59. Chen, V.B.; Arendall, W.B.; Headd, J.J.; Keedy, D.A.; Immormino, R.M.; Kapral, G.J.; Murray, L.W.; Richardson, J.S.; Richardson,
D.C. MolProbity: All-atom structure validation for macromolecular crystallography. Acta Crystallogr. Sect. D Struct. Biol. 2010, 66,
12–21. [CrossRef] [PubMed]