Synthesis and cytoprotective characterization of 8-hydroxyquinoline Betti products

Article abstract of DOI:10.3390/molecules23081934

The 8-hydroxyquinoline pharmacophore scaffold has been shown to possess a range of activities as metal chelation, enzyme inhibition, cytotoxicity, and cytoprotection. Based on our previous findings we set out to optimize the scaffold for cytoprotective ac

Full text of DOI:10.3390/molecules23081934

molecules
Article
Synthesis and Cytoprotective Characterization of
8-Hydroxyquinoline Betti Products
Iván Kanizsai 1,
*
ID , Ramóna Madácsi 1, László Hackler Jr. 1, Márió Gyuris 1, Gábor J. Szebeni 1
,
ID
Orsolya Huzián 2 and László G. Puskás 1,2,
*
1
Avidin Ltd., Alsó kiköto˝ sor. 11D, H-6726 Szeged, Hungary; r.madacsi@avicorbiotech.com (R.M.);
hackler@avidinbiotech.com (L.H.J.); gyuris.mario@gmail.com (M.G.); g.szebeni@avidinbiotech.com (G.J.S.)
Avicor Ltd., Alsó kiköto˝ sor. 11D, H-6726 Szeged, Hungary; o.huzian@avicorbiotech.com
Correspondence: i.kanizsai@avidinbiotech.com (I.K.); laszlo@avidinbiotech.com (L.G.P.)
2
*
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 11 July 2018; Accepted: 31 July 2018; Published: 2 August 2018
Abstract: The 8-hydroxyquinoline pharmacophore scaffold has been shown to possess a range of
activities as metal chelation, enzyme inhibition, cytotoxicity, and cytoprotection. Based on our
previous findings we set out to optimize the scaffold for cytoprotective activity for its potential
application in central nervous system related diseases. A 48-membered Betti-library was constructed
by the utilization of formic acid mediated industrial-compatible coupling with sets of aromatic
primary amines such as anilines, oxazoles, pyridines, and pyrimidines, with (hetero)aromatic
aldehydes and 8-hydroxiquinoline derivatives. After column chromatography and re-crystallization,
the corresponding analogues were obtained in yields of 13–90%. The synthesized analogs were
optimized with the utilization of a cytoprotection assay with chemically induced oxidative stress,
and the most active compounds were further tested in orthogonal assays, a real time cell viability
method, a fluorescence-activated cell sorting (FACS)-based assay measuring mitochondrial membrane
potential changes, and gene expression analysis. The best candidates showed potent, nanomolar
activity in all test systems and support the need for future studies in animal models of central nervous
system (CNS) disorders.
Keywords: 8-hydroxyquinoline; 8-HQ; Mannich-reaction; Betti-reaction; multicomponent reaction;
cytoprotection; phenotypic screening; neurodegeneration; multitarget directed ligand; mitochondrial
membrane potential; HIF1A
1. Introduction
In the last two decades, the 8-hydroxyquinoline (8-HQ) structure have emerged as a promising
pharmacophore scaffold for medicinal chemists, due to a coded biological and synthetic potential
owing to the active sites in the molecule on C-2, C-5, and C-7 carbons [1]. The presence of hydroxyl
substituent on the C-8 carbon creates an ortho (C-7) and/or para (C-5) direction, providing active
positions for electrophilic aromatic substitutions on C-5 (para) and for the accomplishment of aza
Fiedel-Crafts-type reactions, including Mannich- or Betti-three components reactions (Mannich-3CR
and Betti-3CR) predominantly on the C-7 (ortho) position. Higher molecular diversity and the formation
of a new chiral carbon centre could be achieved by the use of Betti-3CR: treatment of several (aromatic)
aldehydes with primary amines then 8-HQ, 5-nitro-, or 5-chloro-8-HQ. The application of Mannich-3CR
of simple formaldehyde and secondary amines as an iminium source for addition, is highlighted for
biological utilization [2,3]. Based on previously published biological studies, the structurally modified
8-HQs exert two main activities depending on the C-7 function and substitution pattern of the mother
compound, 8-HQ. These compounds are either cytotoxic or active in cytoprotection assays. These
Molecules 2018, 23, 1934; doi:10.3390/molecules23081934
www.mdpi.com/journal/molecules

Molecules 2018, 23, 1934
2 of 25
studies describe a variety of 7-aminomethylated 8-HQ, 5-chloro-8-HQ and 5-nitro-8-HQ (nitroxoline) as
products of different multicomponent reaction (MCR) techniques in different hit-to-lead optimizations.
1.1. Cytotoxicity
The most promising cytotoxic 8-HQ analogues were depicted in Figure 1. They act
through different mechanisms, namely the inhibition of Cathepsin B, KDM4 histone demethylases,
2-oxyglutarate oxygenase subtypes, and lipoxygenase (LOX)-enzymes [4–10]. Among the enzyme
inhibitors, eutomer ( )-Betti products were presented with excellent, selective 12-LOX inhibition;
−
moreover, these products were tested successfully in in vivo experiments. Additionally, INP1750
has a Gram-negative pathogen selective antibacterial effect [11]. Interestingly, if an N-sulfonated
piperazine-1-yl unit was introduced in the C-7 position, the Mannich derivatives exerted an improved
growth-inhibitory effect that was 26-fold more potent than that of 5-chloro-8-HQ against HeLa
cells [12,13].
Figure 1. Cytotoxic 8-hydroxyquinoline (8-HQ) analogues.
It is notable that the inhibitor activities were explained by an improved metal chelating
ability compared with the parent compound 8-HQ, due to optimal copper and zinc(II)-binding in
vivo [1,6,11,12,14].
1.2. Cytoprotection
In contrast with mentioned enzyme inhibition and antitumor activities, a number of 8-HQ
derivatives possessed cytoprotective activities.
As a suitable example, clioquinol (CQ, 5-Chloro-7-iodoquinolin-8-ol) has a selective, but low
binding ability for Zn2+/Cu2+-ions, and it exerts potency against several neurodegenerative disorders
(Huntington, Alzheimer’s, and Parkinson diseases) but its toxicity in long-term administration restricts
its use in the clinic [15–18]. Structural modifications on the parent compound CQ have afforded
second generation Zn2+/Cu2+ ionophores such as the PBT family (C-2 substituted 5,7-dichloro-8-HQ
e.g. PBT2 (5,7-Dichloro-2-[(dimethylamino)methyl]quinolin-8-ol)) or their related structures, which
have increased blood brain barrier permeability, more solubility, and less toxicity. In addition,

Molecules 2018, 23, 1934
3 of 25
PBT2 progressed to Phase IIa clinical trials as an anti-Alzheimer agent [19
–
22]. The multifunctional
characteristics of these 8-HQ analogs provide the basis for the emerging use of multitarget-directed
ligand (MTDL) treatment of neurogenerative diseases possessing a multifactorial nature e.g.,
Alzheimer’s disease.
An interesting medicinal chemistry concept is based on the formation of 8-HQ-hybrids (Figure 2).
Known pharmacophores e.g. propargil or N-benzyl piperidine/piperazine moieties were substituted
in C-2, C-5, or C-7 positions of 8-HQ creating analogues with an improved cytoprotective action.
In fact, a series of 2- and 5-functionalized-8-hydroxyquinoline hybrid structures, HLA-20, M30, VK28,
and MTDLs act as potent anti-neurodegenerative agents, exert significant inhibition of
aggregation in vitro, decrease metal-driven oxidative damage and -amyloid-mediated neurotoxicity.
In addition, considerable cholinesterase inhibition, ROS scavenging, and an anti-aggregating effect
on A 42 has been assessed [23 36]. These compounds incorporate known pharmacophore synthones
β-amyloid
β
β
–
from rasagiline (HLA20), donepezil (MTDL3 and MTDL4), or from rivastigmine (VK28). As a result of
original framework combinations, a subclass of C-7-hybrides were also prepared by fusing N-benzyl
piperazines/piperidines to 8-HQ, utilizing optimized Mannich-3CR conditions [37].
Figure 2. Cytoprotective 8-HQ derivatives.
Interestingly, C-2 hydrazones, thiosemicarbazones, and semicarbazones modulate the Cu-A
peptide interactions as well. 8-HQ-2-hydrazones (INHHQ) were proved to be well-tolerated, stable
derivatives which are able to cross the blood-brain barrier (BBB) and act as anti-Parkinson agents [38 39].
β
,
Phenotypic screening for functionally distinct 8-HQ derivatives on a yeast TAR DNA-binding
protein 43 (TDP-43) toxicity model indicated a considerable reverse action for the expression of
the TDP-43 protein in the case of compound HQ415 (Figure 2) [40]. Moreover, CQ can modulate
amyloidogenic proteins/peptides and consequently it can be effective in Alzheimer’s disease, but its
structural modifications towards Betti-bases (e.g., HQ415) resulted in significantly higher potency in

Molecules 2018, 23, 1934
4 of 25
neuronal proteotoxicity models, presumably due to having an effect on the process of oxidative stress
and misregulation of iron metabolism besides enzyme inhibition [41].
Novel cytoprotective screening assays revealed Betti-bases as being a new subclass of potent
cytoprotective agents; nevertheless, a few number of analogues had been analyzed up to now (Figure 2).
During the utilization of a cell-microelectronic sensing technique (RT-CES), a small-membered
Q-library, composed of seven commercially available 8-HQ analogues, was tested for cytoprotective
activity in real-time to identify possible hit compound(s) against cardiac diseases. Notably, compound
Q3 implicated 8-HQ, benzocain, and benzaldehyde motifs, emerging as a suitable candidate for a
hit-to-lead optimization [42]. Systematic preparative efforts led to the analogue Q50, which was proven
to be highly potent in improving cardiac functional recovery of ischemic/reperfused myocardium in
rats [43].
The current work describes the optimization of the 8-HQ Betti products for cytoprotective
activity in glioblastoma cells as a model for neuroprotection, as well as for possible application
in CNS-related disorders.
2. Results and Discussion
Scheme 1 depicts the general synthetic procedures for the synthesis of products 1–48. For a
comprehensive biological evaluation, several primary aromatic amines, aromatic aldehydes and
8-hydroxyquinolines were subjected to the Betti-3CR. Notably, the achievement of a suitable optimal
condition and access to a large number of Betti-compound libraries is a great challenge, owing to the
fundamental Betti-conditions that proceed with very poor yields, and its improvement is strongly
dependent on the applied amine and/or aldehyde components.
Scheme 1. General protocol for the synthesis of compounds 1–48.
For a rapid synthetic method, a known industrial application was chosen to access a diverse
chemical library. For the assemblies, 1 v/v % formic acid was exploited as Brönsted-acid mediator in
acetonitrile at 75 ◦C. We focused on the preparation of Betti compounds with high purities regardless
of the yields and optimal conditions.
At first, an optionally selected 15-membered basic library was prepared and assessed in a
cytoprotection assay to reveal the possible next step for a synthetic strategy. Following a medicinal
chemistry protocol, the 8-HQ was conducted by means of simple amine inputs such as aniline,
2-aminopyridine, 2-aminopyrimidine, and 3-aminoisoxazol in combination with unsubstituted
benzaldehyde and 2-pyridinecarbaldehyde as a N-containing substrate. In addition, several structural
modifications were accomplished to prepare some substituted variants by altering either the amine or
aldehyde components. In accordance with that, 10 other examples were synthesized using substituted
benzaldehydes, containing electron withdrawing (CF3, F, and NO2) or electron donating (O-alkyl)
group in the para position, in combination with e.g., benzocain, p-benzoic acid (PABA), 5-alkyl (methyl
or tert-butyl)-substituted isoxazoles, or 6-picoline.
For pyrimidine based analogues, only two derivatives were presented, consisting of
unsubstituted pyrimidine units with phenyl (from benzaldehyde) or 4-nitrophenyl (from
p-nitrobenzaldehyde) moieties.

Molecules 2018, 23, 1934
5 of 25
In all cases, the formic acid-mediated Betti-transformations were accomplished to furnish the
pure desired products 1–15 in yields of 12–40% (Scheme 2).
Scheme 2. The tested basic chemical library with half maximal inhibitory concentration (IC50) values
in a cytoprotection assay. Each analog was prepared with the combination of the shown aldehydes,
substituted amines, and 8-HQ.
2.1. Primary Assay
We have utilized a simple and inexpensive method to screen our 8-HQ analogs for cytoprotective
activity. U251 MG glioblastoma cells were exposed to hydrogen peroxide to induce oxidative stress, and
the effects of co-treatment with the synthesized compounds were investigated after a 24 h incubation
by a fluorimetric endpoint assay. Cytoprotective compounds could be identified by resulting in more
live cells after a peroxide challenge.
2.2. Structure Activity Relationship
Gratifyingly, the first assessment delineated a preliminary structure-activity relation (SAR),
and demonstrated a high cytoprotective potential, due to the Betti-structure. In fact, we observed
sub-micromolar activities in most cases, except for compounds
5 and 7 (1.05 µM and 2.03 µM).
Consequently, application of PABA and non-substituted isoxazoles as an amine source is not suggested
for further application. Despite that, presence of an alkyl function on C-5 position for the isoxazole
ring significantly increases the efficiencies, as shown in case of compounds
0.49, and 0.25 M). Interestingly, substitutions of the amine or aldehyde are capable of enhancing the
cytoprotective activity as demonstrated by the changing IC50 values in the range from 2.03 M towards
0.11 M. Based on these preliminary results, we assumed that it was possible to increase the scaffold’s
8–10 (IC50 (8–10) = 0.15,
µ
µ
µ

Molecules 2018, 23, 1934
6 of 25
potential; however, the perfect substitution pattern could not be drawn due to similar sub-micromolar
activities for differently oriented substitution patterns in starting substrates.
Accordingly, further synthetic efforts could not be limited to one mainstream biological
optimization process, with a focus on the variation of either the amine or the aldehyde reagents;
rather, our strategy is based on the construction of a chemical library involving three subclasses
(substituted anilines (Subclass 1), 2-aminopicolines (Subclass 2) and 2-aminopyrimidines (Subclass 3))
to demonstrate structure-activity relations and to give a chance to select lead-like compounds for the
final assessment.
Coupling of benzocaine (presence of para-COOEt group) instead of aniline with
4-CF3–benzaldehyde and 8-HQ slightly attenuated the biological activity of derivative 16
from 0.15
by the substitution of R” = 4-F–C6H4 (analogues
(analogues 17; IC50 = 0.12 M). Interestingly, the application of benzocaine for the construction of a
2-pyridyl-containing analogue 17 improved the cytoprotection potential significantly (compound
with IC50 = 0.40 M in comparison with 17, IC50 = 0.12 M). Moreover, replacement of the carbetoxy
group with a NO2 or CF3 moiety resulted in synthesized compounds with excellent efficiency in
µM (for
2
) to 0.19
µM (Table 1). On the other hand, slightly better results were obtained
4
; IC50 = 0.11 M) with a 2-pyridyl group
µ
µ
3
µ
µ
cytoprotection, with 0.09 µ µM
M (R0 = 4-CF3–C6H4 and R” = 2-pyridyl; compound 18) and 0.12
(R0 = 4-NO2–C6H4 and R” = 2-pyridyl; compound 19) IC50 values.
Table 1. Betti-three components reactions (3CR) results, use of several anilines and aldehydes (Subclass 1).
0
Compounds
16
Amine (R )
Aldehyde (R”)
Yield (%) a
IC50 (µM)
SD
30
0.195
0.143
17
18
60
33
0.122
0.096
0.029
0.033
19
14
0.125
0.024
a
after column chromatography and crystallization.
From Subclass 1, three superior compounds 17 and 18 besides analogue
4 were selected as
lead-like compounds.
For the picoline family, basic compounds
combination, such as para-substituted aldehydes, regardless of the electronic nature of the substituents
and/or 6-picoline. Moreover, incorporation of the R” = 2-pyridyl unit in compound 13 (IC50 = 0.687 M)
resulted in a weak cytoprotective potential in comparison with benzaldehyde-based analogues 11
(R” = 4-F–C6H4; IC50 = 0.158 M) and 12 (R” = 4OCH(CH3)2–C6H4; IC50 = 0.289 M). Although,
both of electron withdrawing group (EWG)- or electron donating group (EDG)-substituted analogues
possess higher activity than the unsubstituted such as compound or the 2-pyridylform 13 11 with
para-fluoro moiety on the R” position demonstrated better efficiency.
6, 11, 12, and 13 highlighted the suitable reagent
µ
µ
µ
6
,
In a pyridine-based optimization a tendency could be outlined by introducing a
para–trifluoromethyl or para–nitrophenyl group on the R” function, causing a remarkable positive
effect. For a first improvement, the tested analogues 20 and 21 exerted excellent activity with
IC50 = 0.087
µM and 0.086 µM values. Notably, their representative C-2 methylated variant 23 had
diminished cytoprotection levels, thus the 8-hydroxyquinaldine proved to be an unsuitable component

Molecules 2018, 23, 1934
7 of 25
for the development process. Afterwards, we considered the in-vivo or in-use feasibilities of nitro and
trifluoromethylated derivatives in future studies. For possible toxicity issues therefore, we decided
that the trifluoromethylated structure 20 would be the favored scaffold for further modification, and
that the development of nitro derivatives was terminated. In the next steps, the positions of the
trifluoromethyl and the picolines methyl group were varied, resulting in a slightly decreased IC50
range: 0.156–0.166
aldehydes involving trifluoromethyl and/or fluoro substituents in 2,4-; 3,4-, and 3,5-positions resulted
in molecules 28 32, which displayed a decreased biological activity with an IC50 = 0.204 M at best
µM were observed for cases 25–27. Interestingly, application of di-substituted
–
µ
(Table 2). Based on these observations, 20 and 21 picoline derivatives were selected for the final study.
Table 2. Functionalization with several picolines (Subclass 2).
0
Compounds
20
Amine (R )
Aldehyde (R”)
R
Yield (%) a
IC50 (µM)
SD
H
33
0.087
0.028
21
22
23
H
51
23
71
0.086
0.562
0.824
0.046
0.136
0.390
Me
Me
24
25
26
H
H
H
34
62
18
0.135
0.156
0.166
0.073
0.052
0.040
27
28
H
H
15
35
0.156
0.206
0.078
0.168
29
H
43
0.379
0.217
30
31
32
H
H
H
90
22
53
0.246
0.460
0.204
0.171
0.199
0.111
a
after column chromatography and crystallization.

Molecules 2018, 23, 1934
8 of 25
Although the preliminary test defined high potential derivatives 14 and 15 with the introduction of
a non-substituted pyrimidine moiety (IC50 values 0.233 M and 0.106 M), additional transformations
µ
µ
should be accomplished that focus on the impact of replacing of CF3 with either EWG groups or ED
functions. Also, the influence on the activity of further substituents on the phenyl ring was tested.
In addition, further efforts were taken to determine the importance of introducing a methyl moiety
on the pyrimidine heterocycle. Exploiting the earlier presented method, 16 analogues were prepared,
with yields of up to 68% (Table 3). Except for 33 (besides the compound 14 and 15), all Betti-products
were derived from the 4-methyl-2-amino-1,3-pyrimidine as amine input. The firstly-prepared 33, with
a 4-CF3–C6H4 function on the R” position, demonstrated a slightly better effect in comparison with
R” = C6H5 (14) or 4-NO2–C6H4 (15). Gratifyingly, the introduction of a methyl on the pyrimidine ring
also increased the cytoprotection activity. For R” = 4-NO2–C6H4 (35), a similar IC50 value (0.114
was observed. Replacing CF3 with SF5 (36) or halogenides such as fluorine (37), bromine (38), or iodine
39) slightly attenuated the efficiency. Interestingly, the combination of 4-chlorobenzaldehydes,
µM)
(
4-methyl-2-amino-pyrimidine, and 8-HQ afforded one of the most potent derivatives, 40, with a
73-nM IC50 value. Despite that, the 2,4- or 3,5-disubstituted phenyl moieties reduced the bioactivities;
however, an acceptable cytoprotection level was provided by the incorporation of the 2,4-CF3–C6H3
group (compound 43, IC50 = 0.119
into a bromine unit decreased the activity to 0.183
case. The presence of an electron-donating group on the R” position (analogue 47, IC50 = 0.481
a C-2 methyl function (derivative 48, IC50 = 0.887 µM) diminished the cytoprotective potential.
According to our results, compounds 34 35 40, and 43 were proved to be the most potent
pyrimidine derivatives and were selected for final assessment.
µ
M). Modification on the pyrimidine structure, replacing methyl
M, while a solubility issue also occurred in that
M) or
µ
µ
,
,
Table 3. Functionalization with several pyrimidines (Subclass 3).
0
Compounds
33
Amine (R )
Aldehyde (R”)
R
Yield (%) a
IC50 (µM)
SD
H
32
0.138
0.077
34
35
36
37
38
39
H
H
H
H
H
H
46
19
68
16
18
29
0.119
0.114
0.140
0.163
0.149
0.135
0.080
0.095
0.152
0.109
0.067
0.098

Molecules 2018, 23, 1934
9 of 25
Table 3. Cont.
0
Compounds
40
Amine (R )
Aldehyde (R”)
R
Yield (%) a
IC50 (µM)
SD
H
40
0.073
0.021
41
42
H
H
31
59
0.169
0.413
0.129
0.240
43
44
H
H
16
25
0.119
0.139
0.050
0.064
45
46
47
H
H
H
15
15
15
0.313
0.183
0.481
0.067
0.157
0.082
48
Me
25
0.887
0.226
a
after column chromatography and crystallization.
2.3. Evaluation of the Most Active Compounds in a Real-Time Cytoprotection Assay
In our primary assay, we have identified compounds that showed excellent activity. However,
the derivatization of the basic scaffold with the combination of beneficial substitutions resulted in a
handful of products with very similar activity and at the same time, significantly different modifications.
Since the primary assay was unable to pinpoint one or two products that could be marked as leads,
in an attempt to narrow down our selection of the most active compounds (compounds
4, 17, 18,
20 21 34 35 40, and 43 with IC50 between 0.08 and 0.12 M) we have utilized an orthogonal assay
,
,
,
,
µ
to determine cytoprotective activity. Cell-based phenotypic screening, including end-point in vitro
cellular screening protocols to identify cytoprotective compounds, are commonly used [44]; however,
real-time cellular assays provide more information on the kinetics of drug action. Previously we
have successfully adopted the RT-CES system to identify cytoprotective compounds [37]. Briefly,
cells grown on golden electrodes in microplates were incubated with hydrogen peroxide alone or
in the presence of our compounds. Using this system, cell viability can be monitored continuously
with one-minute resolution through the measurement of impedance of the electrodes. The detected
impedance is converted to an arbitrary measure (cell index) that is proportional to the number of

Molecules 2018, 23, 1934
10 of 25
attached cells, the strength of their attachment and cell morphology, since these properties influence
electrode coverage.
Using this real-time technique we have determined the IC50 values for each selected compound
24 h after treatment. The calculated values were comparable to the ones determined in the primary
assay, hence this assay was also unable to pinpoint a lead. Interestingly, the 4-CF3 and 4-methyl
pyrimidine sidechain containing 34 performed the best with the lowest IC50 value, and significant
effect (29% protection) at 110 nM concentration. Our least active compound, 48, bearing a methyl
group in position 2 on the 8-HQ structure, also performed poorly in this assay. Results are summarized
in Figure 3.
Figure 3. Real-time cytoprotection assay. (
analog were followed for 60 h after treatment. (
h after treatment. Percentages were calculated in relation to non-treated and hydrogen peroxide-only
treated cell data. ( ): Comparison of IC50 values determined from the primary (resazurin, end-point)
A): Real-time viability data traces of the most active 34
B
): Cytoprotective activity of the tested compounds 24
C
assay and the real time assay 24 h after treatment.
2.4. Mitochondrial Membrane Depolarization following Oxidative Stress is Reversed by Treatment with the
Novel 8-HQ Analogs
Mitochondrial dysfunction is a prominent feature in neurodegenerative diseases, it can result in
production and amplification of reactive oxygen species, and may be important in the pathophysiology
of these diseases. Changes in the mitochondrial membrane potential (MMP) are detected in oxidative
stress, and were suggested even as a biomarker for oxidative environmental stress [45].

Molecules 2018, 23, 1934
11 of 25
The selected 10 most active analogues (compounds
4,
15
,
17,
18
,
20,
21
,
34
,
35
,
40, and 43) were
also tested as to whether they were able to reverse the mitochondrial membrane depolarization caused
by the induced oxidative stress by hydrogen peroxide. The applied hydrogen peroxide treatment
was higher in these experiments than in the previous assays (500
significant effect in the 2 h timeframe of this assay. All tested analogs effectively reversed the detected
membrane depolarization. In this assay, the most active compounds (21 34, and 43) were active even at
µM vs. 250 µM), in order to see a
,
the lowest applied 33 nM concentration. Figure 4 shows the effect of treatments compared to hydrogen
peroxide treatment only (set by normalization as 1).
**
1.25
**
1.00
*
**
*
**
0.75
0.50
0.25
0.00
**
*
**
**
**
**
**
**
**
**
**
**
**
**
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
M
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
n
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
3
0
0
1
3
1
3
1
3
1
3
1
3
1
3
1
3
1
3
1
3
1
3
4
15
17
18
20
21
34
35
40
43
Figure 4. Mitochondrial membrane depolarization assay. Treatment with the synthesized analogs
reversed the mitochondrial membrane potential changes caused by oxidative stress. All data was
calculated by relation to hydrogen peroxide only treatment set to 1. Statistical significance (t-test):
* p < 0.05 and ** p < 0.01.
2.5. 8-HQ Analogues Induce Hypoxia Related Genes and Glucose Transporter Expression
The contribution of cerebrovascular deficiencies (such as cerebral ischemia/stroke) and the
dysregulation of brain insulin signaling have been strongly implicated in neurodegenerative diseases
in recent years [46]. Reduction of blood supply leading to a hypoxic condition is known to activate
cellular responses through hypoxia-inducible factors (HIFs). The stabilization of HIF1A protein
controlling the expression of stress adaptation related genes is a major factor in the oxidative stress
response [47]. Since our original 8-HQ analog (Q50, 21) showed potent activity in ischemic/reperfused
myocardium in rats, it was selected along with a highly active (34) and less active compounds (47
48), and was investigated for its effect on oxidative stress response genes. Quantitative real-time PCR
(qRT-PCR) analysis of the expression of oxidative stress-related genes HMOX-1, VEGF, and a glucose
transporter GLUT1 was carried out.
,
Results depicted in Figure 5 showed significant gene activation following treatment at 100 and
300 nM concentrations in the case of 21 and 34, while gene-inducing capacity decreased parallel to
cytoprotective activity with the less active compounds.

Molecules 2018, 23, 1934
12 of 25
Figure 5. Induction of hypoxia-related gene and glucose transporter expression. HIF1A-regulated
genes were activated following treatment with selected analogs in a dose- and cytoprotective
activity-dependent manner. Statistical significance (t-test): * p < 0.05 and ** p < 0.01.
3. Materials and Methods
All NMR spectra were recorded in deuterated dimethyl sulfoxide (DMSO) at 298 K on a Bruker
Avance 500 (Billerica, MA, USA) or Bruker Avance Neo 500 spectrometer (Billerica, MA, USA). All
chemical shifts (δ) were reported in ppm relative to the residual solvent signal. HRMS spectra were
recorded on a Thermo Scientific Q Exactive Plus mass spectrometer (Waltham, MA, USA) using a
heated electrospray ionization (HESI-II) probe ion source. TLC was performed on aluminum sheets
coated with silica gel 60 F254 (Merck, 1.05554, Budapest, Hungary). Visualization was done under UV
light (254 nm). Column chromatography was carried out using silica gel (Merck, 60 Å, 0.063–0.200 mm,
Budapest, Hungary). Melting points were determined by a Stuart SMP10 device (Staffordshire, UK),
and they were uncorrected. All chemicals and solvents were of commercial grade and were used
without further purification.
3.1. General Procedure for the Syntheses of Compounds 1–48
To a solution of 1 mmol aldehyde, 3
×
volume of acetonitrile and 1 equivalent volume of amine
were added to 0.6 equivalent of quinolin◦e derivatives and 1% (v/v) formic acid. The reaction mixture
was stirred at higher temperature (75 C). The reaction was monitored by TLC (eluent: hexane
isomeric mixture:acetone). If the product precipitated, it was filtered, washed with hexane, and dried.
If the reaction mixture was homogeneous, it was evaporated to dryness and was purified by column
chromatography (eluent: hexane:acetone from 20:1 to 4:1, v/v). The crude product was crystallized
from hexane/ethyl-acetate. The molecular structures were determined by means of 1D and 2D-NMR
technologies (see Supplementary Materials)
7-(Phenyl(phenylamino)methyl)quinolin-8-ol (
1
): white solid, yield: 26% (51 mg), melting point (m.p.):
9.99 (s, 1H), 8.82 (s, 1H), 8.24 (d, J = 7.0 Hz,
141–143 ◦C, C22H18N2O; 1H-NMR (500 MHz, DMSO)
δ
1H), 7.59 (d, J = 7.8 Hz, 1H), 7.53–7.48 (m, 1H), 7.43–7.38 (m, 2H), 7.35 (d, J = 7.9 Hz, 1H), 7.32–7.23 (m,
2H), 7.24–7.14 (m, 1H), 7.01–6.92 (m, 2H), 6.67–6.59 (m, 2H), 6.49–6.42 (m, 2H), 6.14 (d, J = 5.3 Hz, 1H);
13C-NMR (126 MHz, CDCl3)
δ 149.77 (s), 148.25 (s), 147.97 (s), 142.87 (s), 138.11 (s), 136.04 (s), 128.75 (s),
128.34 (s), 127.51 (s), 127.36 (s), 126.82 (s), 126.29 (s), 125.45 (s), 121.69 (s), 117.54 (s), 118.06 (s), 112.94
(s), 54.16 (s); HRMS (ESI) m/z calcd. for C22H18N2O [M + H]+: 327.1492, found: 327.1493.

Molecules 2018, 23, 1934
13 of 25
7-((Phenylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (
2
): white solid, yield: 29% (69 mg), m.p.:
83–85 ◦C, C23H17F3N2O; 1H-NMR (500 MHz, DMSO)
δ 10.14 (s, 1H), 8.84 (d, J = 2.2 Hz, 1H), 8.26 (d,
J = 8.2 Hz, 1H), 7.67 (d, J = 7.9 Hz, 2H), 7.62 (d, J = 7.8 Hz, 2H), 7.56 (d, J = 8.5 Hz, 1H), 7.52 (dd, J = 7.7,
3.7 Hz, 1H), 7.38 (d, J = 8.4 Hz, 1H), 7.00 (t, J = 7.4 Hz, 2 H), 6.64 (d, J = 7.8 Hz, 2H), 6.55 (d, J = 6.9 Hz,
1H), 6.50 (t, J = 7.0 Hz, 1H), 6.23 (d, J = 6.9 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
δ 149.95 (s), 148.38 (s),
147.73 (s), 147.68 (s), 138.14 (s), 136.09 (s), 128.84 (s), 128.09 (s), 127.71 (s), 127.53 (q, J = 31.9 Hz), 126.16
(s), 125.29 (q, J = 3.3 Hz), 124.58 (s), 121.88 (s), 117.76 (s), 116.48 (s), 113.04 (s), 54.03 (s); HRMS (ESI)
m/z calcd. for C23H17F3N2O [M + H]+: 395.1366, found: 395.1369.
◦
7-((Phenylamino)(pyridin-2-yl)methyl)quinolin-8-ol (
3
): white solid, yield: 13% (26 mg), m.p.: 129–130 C,
C21H17N3O; 1H-NMR (500 MHz, DMSO)
δ
10.16 (s, 1H), 8.86 (dd, J = 4.2, 1.5 Hz, 1H), 8.56 (dd, J = 4.8,
0.7 Hz, 1H), 8.25 (dd, J = 8.3, 1.5 Hz, 1H), 7.76 (td, J = 7.7, 1.8 Hz, 1H), 7.59–7.47 (m, 3H), 7.33 (d,
J = 8.6 Hz, 1H), 7.27 (ddd, J = 7.4, 5.0, 0.8 Hz, 1H), 7.02 (dd, J = 8.1, 7.6 Hz, 2H), 6.70 (d, J = 7.8 Hz, 2H),
6.61 (d, J = 7.1 Hz, 1H), 6.50 (t, J = 7.3 Hz, 1H), 6.27 (d, J = 7.0 Hz, 1H); 13C-NMR (126 MHz, DMSO)
δ
160.99 (s), 150.53 (s), 149.30 (s), 148.69 (s), 147.80 (s), 138.59 (s), 137.43 (s), 136.48 (s), 129.28 (s), 128.05
(s), 126.81 (s), 125.23 (s), 122.81 (s), 122.50 (s), 122.21 (s), 117.96 (s), 116.68 (s), 113.31 (s), 55.40 (s); HRMS
(ESI) m/z calcd. for C21H17N3O [M + H]+: 328.1444, found: 328.1445.
Ethyl 4-((4-fluorophenyl)(8-hydroxyquinolin-7-yl)methylamino)benzoate (
4): white solid, yield: 17% (42 mg),
m.p.: 142–144 ◦C, C25H21FN2O3; 1H-NMR (500 MHz, DMSO)
δ
10.17 (s, 1H), 8.87 (dd, J = 4.2, 1.5 Hz,
1H), 8.30 (dd, J = 8.3, 1.5 Hz, 1H), 7.64 (d, J = 8.9 Hz, 2H), 7.56 (dd, J = 8.3, 4.2 Hz, 1H), 7.51 (d, J = 8.6 Hz,
1H), 7.45–7.38 (m, 3H), 7.34 (d, J = 7.2 Hz, 1H), 7.20–7.14 (m, 2H), 6.69 (d, J = 8.8 Hz, 2H), 6.25 (d,
J = 7.2 Hz, 1H), 4.18 (q, J = 7.0 Hz, 2H), 1.24 (t, J = 7.1 Hz, 3H).; 13C-NMR (126 MHz, CDCl3)
δ 165.78
(s), 161.24 (d, J = 243.6 Hz), 151.80 (s), 150.01 (s), 148.42 (s), 138.11 (s), 136.11 (s), 130.78 (s), 129.38 (d,
J = 8.1 Hz), 127.72 (s), 125.97 (s), 124.27 (s), 121.90 (s), 117.72 (s), 116.96 (s), 115.26 (s), 115.09 (s), 111.95
(s), 59.58 (s), 53.35 (s), 14.34 (s).
4-((4-Fluorophenyl)(8-hydroxyquinolin-7-yl)methylamino)benzoic acid (
5): white solid, yield: 13% (30 mg),
m.p.: 185–187 ◦C, C23H17FN2O3; 1H-NMR (500 MHz, DMSO)
δ
12.01 (s, 1H), 10.22 (s, 1H), 8.85 (d,
J = 2.2 Hz, 1H), 8.28 (d, J = 8.1 Hz, 1H), 7.69 (d, J = 7.9 Hz, 2H), 7.61 (d, J = 8.9 Hz, 2H), 7.59 (d, J = 8.4 Hz,
2H), 7.54 (dd, J = 8.0, 3.9 Hz, 1H), 7.48 (d, J = 8.5 Hz, 1H), 7.39 (d, J = 8.5 Hz, 1H), 7.31 (d, J = 6.9 Hz,
1H), 6.66 (d, J = 8.3 Hz, 2H), 6.31 (d, J = 6.7 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
δ 167.37 (s), 151.48 (s),
150.16 (s), 149.13 (d, J = 297.5 Hz), 148.49 (s), 146.83 (s), 138.14 (s), 136.14 (s), 131.02 (s), 128.20 (s), 127.85
(s), 126.06 (s), 125.41 (d, J = 2.8 Hz), 123.73 (s), 122.01 (s), 118.04 (s), 117.84 (s), 111.92 (s), 53.82 (s).
7-(Phenyl(pyridin-2-ylamino)methyl)quinolin-8-ol (
C21H17N3O; 1H-NMR (500 MHz, DMSO)
9.92 (s, 1H), 8.85 (dd, J = 4.0, 1.3 Hz, 1H), 8.29 (dd, J = 8.3,
6
): white solid, yield: 25% (49 mg), m.p.: 172–174 ◦C,
δ
1.1 Hz, 1H), 7.92 (d, J = 4.1 Hz, 1H), 7.62 (d, J = 8.5 Hz, 1H), 7.54 (dd, J = 8.3, 4.2 Hz, 1H), 7.42–7.34 (m,
5 H), 7.29 (t, J = 7.6 Hz, 2 H), 7.20 (t, J = 7.3 Hz, 1 H), 6.86 (d, J = 8.5 Hz, 1 H), 6.68 (d, J = 8.4 Hz, 1 H),
6.55–6.37 (m, 1H); 13C-NMR (126 MHz, DMSO)
δ 158.43 (s), 150.00 (s), 148.69 (s), 147.90 (s), 144.00 (s),
138.57 (s), 137.12 (s), 136.47 (s), 128.62 (s), 127.86 (s), 127.66 (s), 127.04 (s), 126.95 (s), 126.36 (s), 122.05 (s),
117.73 (s), 112.51 (s), 109.26 (s), 52.08 (s); HRMS (ESI) m/z calcd. for C21H17N3O [M + H]+: 328.1444,
found: 328.1447.
7-(Isoxazol-3-ylamino)(pyridin-2-yl)methyl)quinolin-8-ol (
7
δ
): white solid, yield: 27% (52 mg), m.p.:
10.02 (s, 1H), 8.82 (d, J = 2.1 Hz, 1H), 8.49
145–146 ◦C, C18H14N4O2; 1H-NMR (500 MHz, DMSO)
(d, J = 3.4 Hz, 1H), 8.31 (bs, 1H), 8.24 (d, J = 8.1 Hz, 1H), 7.73 (t, J = 7.5 Hz, 1H), 7.54 (d, J = 8.5 Hz,
1H), 7.52–7.46 (m, 2H), 7.33 (d, J = 8.5 Hz, 1H), 7.27–7.12 (m, 2H), 6.35 (d, J = 7.9 Hz, 1H), 6.09 (bs, 1H);
13C-NMR (126 MHz, CDCl3)
δ 162.79 (s), 160.56 (s), 158.17 (s), 149.88 (s), 148.84 (s), 148.23 (s), 138.14
(s), 136.83 (s), 136.00 (s), 127.57 (s), 126.24 (s), 124.61 (s), 122.27 (s), 121.81 (s), 121.73 (s), 117.23 (s), 97.02
(s), 55.73 (s); HRMS (ESI) m/z calcd. for C18H14N4O2 [M + H]+: 319.1190, found: 319.1189.
7-((5-tert-Butylisoxazol-3-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (
8): white solid, yield:
18% (48 mg), m.p.: 185–187 ◦C, C24H22F3N3O2; 1H-NMR (500 MHz, DMSO)
δ
10.08 (s, 1H), 8.84 (bs,

Molecules 2018, 23, 1934
14 of 25
1H), 8.28 (d, J = 8.2 Hz, 1H), 7.66 (d, J = 7.8 Hz, 2H), 7.59–7.50 (m, 4H), 7.40 (d, J = 8.4 Hz, 1H), 7.10 (d,
J = 7.8 Hz, 1H), 6.31 (d, J = 7.7 Hz, 1H), 5.66 (s, 1H), 1.18 (s, 9H); 13C-NMR (126 MHz, DMSO)
179.26
δ
(s), 163.57 (s), 150.17 (s), 148.89 (s), 148.27 (s), 138.57 (s), 136.54 (s), 128.11 (s), 127.84 (q, J = 31.9 Hz),
126.38 (s), 125.69 (q, J = 3.9 Hz), 124.93 (s), 124.78 (q, J = 272.2 Hz), 122.35 (s), 118.05 (s), 91.12 (s), 54.54
(s), 32.63 (s), 28.89 (s); HRMS (ESI) m/z calcd. for C24H22F3N3O2 [M + H]+: 442.1737, found: 442.1739.
7-((4-Fluorophenyl)(5-methylisoxazol-3-ylamino)methyl)quinolin-8-ol (
9): white solid, yield: 13% (27 mg),
m.p.: 153–155 ◦C, C20H16FN3O2; 1H-NMR (500 MHz, DMSO)
δ
9.98 (s, 1H), 8.86 (dd, J = 3.9, 1.1 Hz,
1H), 8.30 (d, J = 8.3 Hz, 1H), 7.59 (d, J = 8.5 Hz, 1H), 7.55 (dd, J = 8.3, 4.2 Hz, 1H), 7.41 (d, J = 8.7 Hz,
1H), 7.38 (dd, J = 8.4, 5.9 Hz, 2H), 7.13 (t, J = 8.8 Hz, 2H), 7.01 (d, J = 8.3 Hz, 1H), 6.23 (d, J = 8.3 Hz, 1H),
5.73 (s, 1H), 2.20 (s, 3H); 13C-NMR (126 MHz, DMSO)
δ 167.92 (s), 164.03 (s), 161.48 (d, J = 242.6 Hz),
149.95 (s), 148.76 (s), 139.56 (s), 138.55 (s), 136.49 (s), 129.32 (d, J = 8.1 Hz), 127.96 (s), 126.27 (s), 125.66
(s), 122.18 (s), 117.87 (s), 115.36 (d, J = 21.2 Hz), 94.33 (s), 54.21 (s), 12.45 (s); HRMS (ESI) m/z calcd. for
C20H16FN3O2 [M + H]+: 350.1299, found: 350.1300.
7-((5-Methylisoxazol-3-ylamino)(4-nitrophenyl)methyl)quinolin-8-ol (10): white solid, yield: 26% (59 mg),
◦
1
o.p.: 138–140 C, C20H16N4O4; H-NMR (500 MHz, DMSO)
δ 10.16 (s, 1H), 8.84 (s, 1H), 8.28 (d,
J = 8.1 Hz, 1H), 8.16 (d, J = 8.2 Hz, 2H), 7.61 (d, J = 8.1 Hz, 2H), 7.56–7.48 (m, 2H), 7.40 (d, J = 8.4 Hz,
1H), 7.15 (d, J = 7.7 Hz, 1H), 6.34 (d, J = 7.7 Hz, 1H), 5.74 (s, 1H), 2.18 (s, 3H); 13C-NMR (126 MHz,
CDCl3)
δ 167.76 (s), 163.53 (s), 150.90 (s), 149.77 (s), 148.49 (s), 146.35 (s), 138.15 (s), 136.10 (s), 128.01 (s),
127.77 (s), 125.93 (s), 124.02 (s), 123.56 (s), 122.00 (s), 117.73 (s), 93.91 (s), 54.18 (s), 12.01 (s); HRMS (ESI)
m/z calcd. for C20H16N4O4 [M + H]+: 377.1244, found: 377.1250.
7-((4-Fluorophenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (11): white solid, yield: 12% (26 mg),
◦
m.p.: 157–159 C, C22H18FN3O; 1H-NMR (500 MHz, DMSO)
δ 9.97 (s, 1H), 8.82 (d, J = 2.5 Hz, 1H), 8.26
(d, J = 8.0 Hz, 1H), 7.63 (d, J = 8.5 Hz, 1H), 7.50 (dd, J = 8.1, 4.0 Hz, 1H), 7.41–7.31 (m, 3H), 7.30–7.17 (m,
2H), 7.08 (t, J = 8.7 Hz, 2H), 6.80 (d, J = 8.4 Hz, 1H), 6.40 (t, J = 12.7 Hz, 1H), 6.33 (d, J = 6.9 Hz, 1H),
2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 160.92 (d, J = 242.0 Hz), 157.50 (s), 155.70 (s), 149.53 (s),
148.29 (s), 139.82 (s), 138.13 (s), 137.24 (s), 136.04 (s), 128.95 (d, J = 8.0 Hz), 127.48 (s), 126.60 (s), 125.68
(s), 121.68 (s), 117.43 (s), 114.84 (d, J = 21.2 Hz), 111.29 (s), 105.17 (s), 51.11 (s), 24.23 (s); HRMS (ESI)
m/z calcd. for C22H18FN3O [M + H]+: 360.1507, found: 360.1508.
7-((4-Isopropoxyphenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (12): white solid, yield: 25%
(60 mg), m.p.: 132–134 ◦C, C25H25N3O2; 1H-NMR (500 MHz, DMSO)
δ 9.80 (d, J = 117.5 Hz, 1H), 8.85
(dd, J = 4.1, 1.4 Hz, 1H), 8.29 (dd, J = 8.3, 1.3 Hz, 1H), 7.67 (d, J = 8.5 Hz, 1H), 7.53 (dd, J = 8.3, 4.2 Hz,
1H), 7.40 (d, J = 8.6 Hz, 1H), 7.26 (t, J = 8.2 Hz, 3H), 7.16 (d, J = 8.9 Hz, 1H), 6.82 (d, J = 8.7 Hz, 2H), 6.73
(d, J = 8.7 Hz, 1H), 6.41 (d, J = 8.3 Hz, 1H), 6.34 (d, J = 7.1 Hz, 1H), 4.53 (h, J = 6.0 Hz, 1H), 2.22 (s, 3H),
1.22 (d, J = 6.0 Hz, 6H); 13C-NMR (126 MHz, DMSO)
δ 158.05 (s), 156.55 (s), 156.12 (s), 149.85 (s), 148.66
(s), 138.57 (s), 137.64(s), 136.45 (s), 135.71 (s), 128.73 (s), 127.80 (s), 127.12 (s), 126.66 (s), 122.00 (s), 117.73
(s), 115.62 (s), 111.54 (s), 105.42 (s), 69.45 (s), 51.58 (s), 24.68 (s), 22.33 (s); HRMS (ESI) m/z calcd. for
C25H25N3O2 [M + H]+: 400.2020, found: 400.2018.
7-((6-Methylpyridin-2-ylamino)(pyridin-2-yl)methyl)quinolin-8-ol (13): white solid, yield: 16% (33 mg),
m.p.: 170–173 ◦C, C21H18N4O; 1H-NMR (500 MHz, DMSO)
δ 10.12 (s, 1H), 8.82 (s, 1H), 8.49 (s, 1H),
8.23 (d, J = 7.9 Hz, 1H), 7.71 (t, J = 7.1 Hz, 1H), 7.55–7.44 (m, 3H), 7.31 (d, J = 8.3 Hz, 1H), 7.27–7.18 (m,
3H), 6.76 (d, J = 7.1 Hz, 1H), 6.40 (t, J = 17.7 Hz, 1H), 6.33 (d, J = 6.7 Hz, 1H), 2.19 (s, 3H); 13C-NMR
(126 MHz, CDCl3) δ 161.06 (s), 157.24 (s), 155.73 (s), 149.93 (s), 148.71 (s), 148.25 (s), 138.24 (s), 137.33 (s),
136.80 (s), 135.99 (s), 127.55 (s), 126.75 (s), 125.22 (s), 122.13 (s), 121.96 (s), 121.68 (s), 117.34 (s), 111.37
(s), 104.91 (s), 53.29 (s), 24.15 (s); HRMS (ESI) m/z calcd. for C21H18N4O [M + H]+: 343.1553, found:
343.1555.
7-(Phenyl(pyrimidin-2-ylamino)methyl)quinolin-8-ol (14): white solid, yield: 15% (30 mg), m.p.:
192–195 ◦C, C20H16N4O; 1H-NMR (500 MHz, DMSO) δ 9.98 (s, 1H), 8.85 (d, J = 2.9 Hz, 1H), 8.33–8.27
(m, 3H), 8.08 (d, J = 9.4 Hz, 1H), 7.76 (d, J = 8.5 Hz, 1H), 7.54 (dd, J = 8.2, 4.1 Hz, 1H), 7.44–7.36 (m, 3H),

Molecules 2018, 23, 1934
15 of 25
7.28 (t, J = 7.6 Hz, 2H), 7.19 (t, J = 7.3 Hz, 1H), 7.00 (d, J = 9.4 Hz, 1H), 6.60 (t, J = 4.7 Hz, 1H); 13C-NMR
(126 MHz, DMSO) 162.17 (s), 158.51 (s), 149.91 (s), 148.72 (s), 143.59 (s), 138.51 (s), 136.49 (s), 128.63
δ
(s), 127.92 (s), 127.49 (s), 127.33 (s), 127.01 (s), 125.81 (s), 122.13 (s), 117.79 (s), 111.07 (s), 52.31 (s); HRMS
(ESI) m/z calcd. for C20H16N4O [M + H]+: 329.1397, found: 329.1397.
7-((4-Nit◦rophenyl)(pyrimidin-2-ylamino)methyl)quinolin-8-ol (15): yellow solid, yield: 40% (90 mg), m.p.:
121–123 C, C20H15N5O3; 1H-NMR (500 MHz, DMSO)
δ 10.17 (s, 1H), 8.84 (d, J = 2.4 Hz, 1H), 8.29 (dd,
J = 8.7, 6.1 Hz, 3H), 8.23 (d, J = 9.0 Hz, 1H), 8.15 (d, J = 8.4 Hz, 2H), 7.69 (d, J = 8.5 Hz, 1H), 7.62 (d,
J = 8.4 Hz, 2H), 7.53 (dd, J = 8.0, 3.9 Hz, 1H), 7.40 (d, J = 8.5 Hz, 1H), 7.07 (d, J = 9.0 Hz, 1H), 6.62 (t,
J = 4.3 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
δ 161.62 (s), 158.17 (s), 151.08 (s), 149.79 (s), 148.46 (s),
146.32 (s), 138.11 (s), 136.11 (s), 128.16 (s), 127.79 (s), 126.68 (s), 123.95 (s), 123.56 (s), 121.96 (s), 117.69
(s), 111.07 (s), 51.78 (s); HRMS (ESI) m/z calcd. for C20H15N5O3 [M + H]+: 374.1248, found: 374.1250.
Ethyl 4-((8-hydroxyquinolin-7-yl)(4-(trifluoromethyl)phenyl)methylamino)benzoate (16): white solid, yield:
30% (84 mg), m.p.: 95–98 ◦C, C26H21F3N2O3; 1H-NMR (500 MHz, DMSO)
δ 10.27 (s, 1H), 8.88 (dd,
J = 4.1, 1.2 Hz, 1H), 8.31 (dd, J = 8.3, 1.1 Hz, 1H), 7.72 (d, J = 8.3 Hz, 2H), 7.66 (d, J = 8.7 Hz, 2H), 7.61
(d, J = 8.2 Hz, 2H), 7.57 (dd, J = 8.3, 4.2 Hz, 1H), 7.50 (d, J = 8.6 Hz, 1H), 7.44–7.39 (m, 2H), 6.71 (d,
J = 8.7 Hz, 2H), 6.35 (d, J = 7.1 Hz, 1H), 4.18 (q, J = 7.1 Hz, 2H), 1.24 (t, J = 7.1 Hz, 3H); 13C-NMR
(126 MHz, DMSO) δ 166.21 (s), 152.16 (s), 150.63 (s), 148.95 (s), 147.18 (s), 138.58 (s), 136.59 (s), 131.27 (s),
128.63 (s), 128.30 (s), 128.12–127.65(m), 126.48 (s), 125.87 (q, J = 3.2 Hz), 124.07 (s), 122.47 (s), 118.28 (s),
117.62 (s), 112.46 (s), 60.06 (s), 54.22 (s), 14.78 (s); HRMS (ESI) m/z calcd. for C26H21F3N2O3 [M + H]+:
467.1577, found: 467.1584.
Ethyl 4-((8-hydroxyquinolin-7-yl)(pyridin-2-yl)methylamino)benzoate (17): white solid, yield: 60% (144 mg),
m.p.: 157–159 ◦C, C24H21N3O3; 1H-NMR (500 MHz, DMSO)
δ 10.22 (s, 1H), 8.84 (s, 1H), 8.54 (s, 1H),
8.23 (d, J = 8.1 Hz, 1H), 7.75 (t, J = 7.5 Hz, 1H), 7.62 (d, J = 8.0 Hz, 2H), 7.53–7.50 (m, 1H), 7.48 (d,
J = 8.3 Hz, 2H), 7.42 (d, J = 6.5 Hz, 1H), 7.32 (d, J = 8.4 Hz, 1H), 7.28–7.22 (m, 1H), 6.73 (d, J = 7.9 Hz,
2H), 6.34 (d, J = 6.5 Hz, 1H), 4.14 (q, J = 6.8 Hz, 2H), 1.20 (t, J = 6.6 Hz, 3H); 13C-NMR (126 MHz, CDCl3)
δ
165.77 (s), 159.85 (s), 151.43 (s), 150.19 (s), 148.99 (s), 148.35 (s), 138.14 (s), 137.11 (s), 136.06 (s), 130.79
(s), 127.73(s), 126.24 (s), 123.92 (s), 122.56 (s), 122.11 (s), 121.89 (s), 117.63 (s), 116.94 (s), 111.95 (s), 59.58
(s), 54.84 (s), 14.33 (s); HRMS (ESI) m/z calcd. for C24H21N3O3 [M + H]+: 400.1656, found: 400.1661.
7-(Pyridin-2-yl(4-(trifluoromethyl)phenylamino)methyl)quinolin-8-ol (18): white solid, yield: 33% (78 mg),
m.p.: 162–164 ◦C, C22H16F3N3O; 1H-NMR (500 MHz, DMSO)
δ
10.22 (s, 1H), 8.84 (d, J = 3.4 Hz, 1H),
8.55 (d, J = 4.0 Hz, 1H), 8.23 (d, J = 8.2 Hz, 1H), 7.75 (t, J = 7.5 Hz, 1H), 7.54–7.47 (m, 3H), 7.34–7.30 (m,
4H), 7.29–7.23 (m, 1H), 6.79 (d, J = 8.2 Hz, 2H), 6.31 (d, J = 6.8 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
δ
160.33 (s), 150.95 (s), 150.80 (s), 149.54 (s), 148.80 (s), 138.55 (s), 137.57 (s), 136.53 (s), 128.18 (s), 126.65
(s), 126.61 (s), 125.71 (q, J = 269.9 Hz), 124.33 (s), 123.01 (s), 122.57 (s), 122.33 (s), 118.10 (s), 116.35 (q,
J = 31.8 Hz), 112.68 (s), 55.33 (s); HRMS (ESI) m/z calcd. for C22H16F3N3O [M + H]+: 396.1318, found:
396.1323.
7-((3-Fluoro-4-(trifluoromethyl)phenyl)(morpholino)methyl)quinolin-8-ol7-((4-nitrophenylamino)
(pyridin-2-yl)methyl)quinolin-8-ol (19): yellow-green (viridian) solid, yield: 14% (31 mg), m.p.:
◦
1
128–131 C, C21H16N4O3; H-NMR (500 MHz, DMSO)
δ 10.32 (s, 1H), 8.87–8.83 (m, 1H), 8.57 (d,
J = 3.1 Hz, 1H), 8.25 (d, J = 8.2 Hz, 1H), 8.12 (d, J = 6.6 Hz, 1H), 7.94 (d, J = 8.6 Hz, 2H), 7.77 (t, J = 7.6 Hz,
1H), 7.53 (dd, J = 7.8, 3.8 Hz, 1H), 7.50–7.41 (m, 2H), 7.34 (d, J = 8.5 Hz, 1H), 7.31–7.25 (m, 1H), 6.78 (bs,
2H), 6.39 (d, J = 6.7 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
δ 159.21 (s), 153.27 (s), 150.30 (s), 149.11
(s), 148.46 (s), 138.14 (s), 137.25 (s), 136.43 (s), 136.11 (s), 127.87 (s), 126.09 (s), 126.03 (s), 123.23 (s),
122.76 (s), 122.21 (s), 122.03 (s), 117.77 (s), 55.15 (s); HRMS (ESI) m/z calcd. for C21H16N4O3 [M + H]+:
373.1295, found: 373.1299.
7-((6-Methylpyridin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (20): white solid, yield: 33%
(81 mg), m.p.: 147–150 ◦C, C23H18F3N3O; 1H-NMR (500 MHz, DMSO)
δ
10.06 (s, 1H), 8.83 (bs, 1H),
8.27 (d, J = 8.0 Hz, 1H), 7.66–7.59 (m, 3H), 7.56 (d, J = 7.4 Hz, 2H), 7.52 (d, J = 2.7 Hz, 1H), 7.40 (d,

Molecules 2018, 23, 1934
16 of 25
J = 8.3 Hz, 1H), 7.34 (d, J = 8.4 Hz, 1H), 7.26 (t, J = 7.1 Hz, 1H), 6.93 (d, J = 8.1 Hz, 1H), 6.46 (d, J = 8.0 Hz,
1H), 6.35 (d, J = 6.6 Hz, 1H), 2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
157.41 (s), 155.70 (s), 149.70 (s),
δ
148.68 (s), 148.38 (s), 138.15 (s), 137.27 (s), 136.07 (s), 127.79 (s), 127.62 (s), 127.16 (q, J = 31.7 Hz), 126.67
(s), 125.11 (dd, J = 6.9, 3.8 Hz), 124.96 (s), 124.39 (q, J = 271.7 Hz), 121.81 (s), 117.57 (s), 111.44 (s), 105.41
(s), 52.20 (s), 24.24 (s); HRMS (ESI) m/z calcd. for C23H18F3N3O [M + H]+: 410.1475, found: 410.1478.
7-((6-Methylpyridin-2-yl◦amino)(4-nitrophenyl)methyl)quinolin-8-ol (21): pale yellow solid, yield: 51%
(118 mg), m.p.: 159–161 C, C22H18N4O3; 1H-NMR (500 MHz, DMSO)
δ 10.13 (s, 1H), 8.84 (d, J = 2.8 Hz,
1H), 8.28 (d, J = 8.1 Hz, 1H), 8.15 (d, J = 8.5 Hz, 2H), 7.64–7.56 (m, 3H), 7.53 (dd, J = 8.1, 4.0 Hz, 1H), 7.40
(t, J = 8.4 Hz, 2H), 7.33–7.19 (m, 1H), 6.96 (d, J = 8.3 Hz, 1H), 6.47 (d, J = 8.2 Hz, 1H), 6.36 (d, J = 7.1 Hz,
1H), 2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 157.28 (s), 155.70 (s), 151.99 (s), 149.79 (s), 148.45 (s),
146.17 (s), 138.16 (s), 137.30 (s), 136.10 (s), 128.14 (s), 127.72 (s), 126.66 (s), 124.48 (s), 123.48 (s), 121.92 (s),
117.67 (s), 111.56 (s), 105.57 (s), 51.47 (s), 24.24 (s); HRMS (ESI) m/z calcd. for C22H18N4O3 [M + H]+:
387.1452, found: 387.1451.
2-Methyl-7-((6-methylpyridin-2-ylamino)(4-nitrophenyl)methyl)quinolin-8-ol (22): ivory-white solid, yield:
23% (55 mg), m.p.: 134–136 ◦C, C23H20N4O3; 1H-NMR (500 MHz, DMSO)
δ 9.64 (s, 1H), 8.20–8.10 (m,
3H), 7.62 (d, J = 8.7 Hz, 2H), 7.53 (d, J = 8.5 Hz, 1H), 7.44 (d, J = 8.4 Hz, 1H), 7.41 (d, J = 8.6 Hz, 1H),
7.37 (d, J = 8.5 Hz, 1H), 7.30 (dd, J = 8.0, 7.4 Hz, 1H), 6.97 (d, J = 8.5 Hz, 1H), 6.50 (d, J = 8.3 Hz, H),
6.39 (d, J = 7.2 Hz, 1 H), 2.69 (d, J = 10.1 Hz, 3H), 2.22 (s, 3H); 13C-NMR (126 MHz, DMSO)
δ 157.73 (s),
157.60 (s), 156.12 (s), 152.53 (s), 149.34 (s), 146.59 (s), 137.87 (s), 137.74 (s), 136.58 (s), 128.52 (s), 126.23
(s), 125.95 (s), 124.69 (s), 123.91 (s), 123.17 (s), 117.96 (s), 111.99 (s), 106.04 (s), 51.87 (s), 25.16 (s), 24.69
(s); HRMS (ESI) m/z calcd. for C23H20N4O3 [M + H]+: 401.1608, found: 401.1609.
2-Methyl-7-((6-methylpyridin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (23): beige solid,
yield: 71% (180 mg), m.p.: 122–124 ◦C, C24H20F3N3O; 1H-NMR (500 MHz, DMSO)
δ 9.54 (s, 1H), 8.15
(d, J = 8.4 Hz, 1H), 7.82 (d, J = 3.9 Hz, 1H), 7.65–7.59 (m, 3H), 7.55 (d, J = 7.9 Hz, 2H), 7.39 (d, J = 8.4 Hz,
1H), 7.33 (d, J = 8.5 Hz, 1H), 7.27 (d, J = 6.7 Hz, 1H), 7.07 (t, J = 18.0 Hz, 1H), 6.54–6.43 (m, 2H), 2.67 (s,
3H), 2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 157.02 (s), 155.79 (s), 149.05 (s), 148.68 (s), 144.77 (s),
137.48 (s), 136.92 (s), 136.10 (s), 127.85 (s), 127.08 (dd, J = 63.3, 31.6 Hz), 126.25 (s), 125.75 (s), 124.97 (dd,
J = 6.8, 3.8 Hz), 124.64 (s), 124.42 (q, J = 271.9 Hz), 122.59 (s), 117.34 (s), 117.14 (s), 112.75 (s), 52.45 (s),
24.69 (s), 16.92 (s); HRMS (ESI) m/z calcd. for C24H20F3N3O [M + H]+: 424.1631, found: 424.1631.
7-((6-Methylpyridin-2-ylamino)(4-(trifluoromethoxy)phenyl)methyl)quinolin-8-ol (24): white solid, yield:
34% (87 mg), m.p.: 99–101 ◦C, C23H18F3N3O2; 1H-NMR (500 MHz, DMSO)
δ 10.00 (s, 1H), 8.82 (d,
J = 2.0 Hz, 1H), 8.27 (d, J = 8.1 Hz, 1H), 7.63 (d, J = 8.4 Hz, 1H), 7.51 (dd, J = 7.6, 3.6 Hz, 1H), 7.45 (d,
J = 8.1 Hz, 2H), 7.39 (d, J = 8.4 Hz, 1H), 7.30 (d, J = 8.6 Hz, 1H), 7.28–7.21 (m, 3H), 6.86 (d, J = 8.2 Hz,
1H), 6.43 (d, J = 8.1 Hz, 1H), 6.34 (d, J = 6.9 Hz, 1H), 2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 157.44
(s), 155.70 (s), 149.71 (s), 148.31 (s), 146.90 (s), 143.21 (s), 138.17 (s), 137.25 (s), 136.05 (s), 128.89 (s), 127.57
(s), 126.57 (s), 125.30 (s), 121.73 (s), 120.78 (s), 117.42 (s), 116.02 (d, J = 260.6 Hz), 111.35 (s), 105.28 (s),
51.14 (s), 24.24 (s); HRMS (ESI) m/z calcd. for C23H18F3N3O2 [M + H]+: 426.1424, found: 426.1423.
7-((6-Methylpyridin-2-ylamino)(3-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (25): white solid, yield: 62%
(152 mg), m.p.: 148–152 ◦C, C23H18F3N3O; 1H-NMR (500 MHz, DMSO)
δ 10.07 (s, 1H), 8.83 (s, 1H),
8.27 (d, J = 8.2 Hz, 1H), 7.71 (s, 1H), 7.69–7.60 (m, 2H), 7.56–7.46 (m, 3H), 7.44–7.35 (m, 2H), 7.27 (t,
J = 7.6 Hz, 1H), 6.93 (d, J = 8.6 Hz, 1H), 6.45 (d, J = 8.2 Hz, 1H), 6.35 (d, J = 6.9 Hz, 1H), 2.19 (s, 3H);
13C-NMR (126 MHz, CDCl3)
δ 157.37 (s), 155.70 (s), 149.67 (s), 148.41 (s), 145.29 (s), 138.12 (s), 137.32
(s), 136.08 (s), 131.32 (s), 129.29 (s), 128.88 (d, J = 31.4 Hz), 127.60 (s), 126.44 (s), 125.22 (q, J = 48.0 Hz),
125.03 (s), 123.34 (s), 121.82 (s), 117.62 (s), 111.49 (s), 105.40 (s), 51.40 (s), 24.21 (s); HRMS (ESI) m/z
calcd. for C23H18F3N3O [M + H]+: 410.1475, found: 410.1476.
7-((3-Methylpyridin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (26): white solid, yield: 18%
◦
(44 mg), m.p.: 148–151 C, C23H18F3N3O; 1H-NMR (500 MHz, DMSO)
δ
10.09 (s, 1H), 8.83 (d, J = 3.1 Hz,
1H), 8.28 (d, J = 8.2 Hz, 1H), 7.81 (d, J = 4.1 Hz, 1H), 7.69 (d, J = 8.4 Hz, 1H), 7.62 (d, J = 7.9 Hz, 2 H),

Molecules 2018, 23, 1934
17 of 25
7.58–7.48 (m, 3H), 7.39 (d, J = 8.4 Hz, 1H), 7.27 (d, J = 6.7 Hz, 1H), 7.11 (d, J = 8.1 Hz, 1H), 6.53–6.45
(m, 2H), 2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
155.75 (s), 149.93 (s), 148.57 (s), 148.34 (s), 144.73
δ
(s), 138.18 (s), 136.95 (s), 136.06 (s), 127.93 (s), 127.67 (s), 127.32 (s), 127.10 (q, J = 31.3 Hz), 125.00 (q,
J = 2.9 Hz), 124.88 (s), 124.42 (q, J = 272.0 Hz), 121.79 (s), 117.48 (s), 117.17 (s), 112.75 (s), 52.33 (s), 16.95
(s); HRMS (ESI) m/z calcd. for C23H18F3N3O [M + H]+: 410.1475, found: 410.1479.
7-((4-Methylpyridin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (27): mulatto solid, yield:
15% (37 mg), m.p.: 151–153 ◦C, C23H18F3N3O; 1H-NMR (500 MHz, DMSO)
δ 10.06 (s, 1H), 8.86 (dd,
J = 4.1, 1.4 Hz, 1H), 8.30 (dd, J = 8.3, 1.3 Hz, 1H), 7.80 (d, J = 5.2 Hz, 1H), 7.66 (d, J = 8.2 Hz, 2H), 7.59 (d,
J = 8.5 Hz, 1H), 7.57–7.53 (m, 3H), 7.42 (d, J = 8.6 Hz, 1H), 7.37 (d, J = 8.4 Hz, 1H), 6.97 (d, J = 8.4 Hz,
1H), 6.54 (s, 1H), 6.36 (d, J = 5.1 Hz, 1H), 2.15 (s, H); 13C-NMR (126 MHz, DMSO)
δ 158.49 (s), 150.16
(s), 149.13 (s), 148.81 (s), 147.58 (s), 147.46 (s), 138.59 (s), 136.52 (s), 128.27 (s), 128.05 (s), 127.60 (q,
J = 31.5 Hz), 127.03 (s), 125.58(q, J = 3.5 Hz), 125.49 (s), 124.83 (q, J = 271.6 Hz), 122.24 (s), 117.96 (s),
114.48 (s), 109.35 (s), 51.91 (s), 21.09 (s); HRMS (ESI) m/z calcd. for C23H18F3N3O [M + H]+: 410.1475,
found: 410.1477.
7-((3-Fluoro-5-(trifluoromethyl)phenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (28): white solid,
yield: 35% (90 mg), m.p.: 163–165 ◦C, C23H17F4N3O; 1H-NMR (500 MHz, DMSO)
δ 10.19 (s, 1H), 8.87
(dd, J = 4.0, 1.2 Hz, 1H), 8.31 (dd, J = 8.3, 1.1 Hz, 1H), 7.67 (d, J = 8.6 Hz, 1H), 7.60 (s, 1H), 7.56 (dd,
J = 8.3, 4.2 Hz, 1H), 7.51 (d, J = 9.2 Hz, 2H), 7.45 (d, J = 8.4 Hz, 2H), 7.31 (t, J = 7.7 Hz, 1H), 6.95 (d,
J = 8.7 Hz, 1H), 6.50 (d, J = 8.3 Hz, 1H), 6.40 (d, J = 7.2 Hz, 1H), 2.22 (s, 3H); 13C NMR (126 MHz, DMSO)
δ
162.40 (d, J = 246.4 Hz), 157.62 (s), 156.15 (s), 150.19 (s), 149.34 (d, J = 6.8 Hz), 148.95 (s), 138.57 (s),
137.84 (s), 136.57 (s), 131.17 (qd, J = 32.7, 8.7 Hz), 128.16 (s), 126.69 (s), 124.86 (s), 123.82 (dq, J = 272.8,
2.6 Hz), 122.40 (s), 120.30–120.02 (m), 118.39 (d, J = 21.8 Hz), 118.22 (s), 112.16 (s), 111.39 (dq, J = 25.1,
3.4 Hz), 106.01 (s), 51.75 (s), 24.64 (s); HRMS (ESI) m/z calcd. for C23H17F4N3O [M + H]+: 428.1381,
found: 428.1388.
7-((3,5-bis(Trifluoromethyl)phenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (29): white solid, yield:
43% (123 mg), m.p.: 144–146 ◦C, C24H17F6N3O; 1H-NMR (500 MHz, DMSO)
δ 10.20 (s, 1H), 8.84 (bs,
1H), 8.28 (d, J = 8.1 Hz, 1H), 8.03 (s, 2H), 7.92 (s, 1H), 7.69 (d, J = 8.4 Hz, 1H), 7.58–7.48 (m, 2H), 7.43
(d, J = 8.4 Hz, 1H), 7.29 (t, J = 7.6 Hz, 1H), 6.98 (d, J = 8.3 Hz, 1H), 6.48 (d, J = 8.1 Hz, 1H), 6.38 (d,
J = 6.9 Hz, 1H), 2.19 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 157.12 (s), 155.69 (s), 149.81 (s), 148.56 (s),
147.44 (s), 138.11 (s), 137.44 (s), 136.13 (s), 130.08 (q, J = 32.3 Hz), 127.78 (s), 127.68 (s), 126.08 (s), 124.14
(s), 123.39 (q, J = 272.5 Hz), 122.01 (s), 120.48 (s), 117.87 (s), 111.83 (s), 105.67 (s), 51.55 (s), 24.13 (s);
HRMS (ESI) m/z calcd. for C24H17F6N3O [M + H]+: 478.1349, found: 478.1353.
7-((4-Fluoro-3-(trifluoromethyl)phenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (30): white solid,
◦
yield: 90% (231 mg), m.p.: 148–151 C, C23H17F4N3O; 1H-NMR (500 MHz, DMSO)
δ 10.10 (s, 1H), 8.83
(s, 1H), 8.27 (d, J = 8.1 Hz, 1H), 7.73 (d, J = 6.2 Hz, 1H), 7.65 (d, J = 8.7 Hz, 2H), 7.52 (dd, J = 8.0, 3.9 Hz,
1H), 7.45–7.36 (m, 3H), 7.27 (t, J = 7.7 Hz, 1H), 6.87 (d, J = 8.5 Hz, 1H), 6.44 (t, J = 9.4 Hz, 1H), 6.34
(t, J = 15.0 Hz, 1H), 2.19 (s, 3H); 13C-NMR (126 MHz, DMSO)
δ 159.53–156.77 (m), 157.71 (s), 156.16
(s), 150.13 (s), 148.90 (s), 141.39 (d, J = 3.4 Hz), 138.55 (s), 137.76 (d, J = 13.0 Hz), 136.55 (s), 134.27 (d,
J = 8.5 Hz), 129.47–121.35 (m), 128.10(s), 126.68 (s), 125.77 (q, J = 4.7 Hz), 125.26 (s), 122.31 (s), 118.12 (s),
117.48 (d, J = 20.4 Hz), 116.78–116.78 (m), 112.03 (s), 105.88 (s), 51.42 (s), 24.65 (s); HRMS (ESI) m/z
calcd. for C23H17F4N3O [M + H]+: 428.1381, found: 428.1385.
7-((2,4-bis(Trifluoromethyl)phenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (31): light rose solid,
yield: 22% (63 mg), m.p.: decomposed 230 ◦C, C24H17F6N3O; 1H-NMR (500 MHz, DMSO)
δ 9.83 (s,
1H), 8.87 (d, J = 2.9 Hz, 1H), 8.33 (d, J = 8.0 Hz, 1H), 8.16 (d, J = 8.2 Hz, 1H), 8.11 (d, J = 8.2 Hz, 1H), 8.01
(s, 1H), 7.63 (dd, J = 8.6, 4.1 Hz, 1H), 7.59 (d, J = 7.8 Hz, 1H), 7.36 (d, J = 7.6 Hz, 1H), 7.25 (t, J = 7.7 Hz,
1H), 6.92 (d, J = 8.0 Hz, 1H), 6.63 (d, J = 8.0 Hz, 1H), 6.37 (d, J = 7.2 Hz, 1H), 2.17 (s, 3H); HRMS (ESI)
m/z calcd. for C24H17F6N3O [M + H]+: 478.1349, found: 478.1356.

Molecules 2018, 23, 1934
18 of 25
7-((3,4-Difluorophenyl)(6-methylpyridin-2-ylamino)methyl)quinolin-8-ol (32): white solid, yield: 53%
◦
1
(120 mg), m.p.: 175–178 C, C22H17F2N3O; H-NMR (500 MHz, DMSO)
δ 10.10 (s, 1H), 8.86 (dd,
J = 4.0, 1.2 Hz, 1H), 8.30 (dd, J = 8.2, 1.1 Hz, 1H), 7.63 (d, J = 8.5 Hz, 1H), 7.55 (dd, J = 8.3, 4.2 Hz,
1H), 7.42 (d, J = 8.6 Hz, 1H), 7.40–7.27 (m, 4 H), 7.24–7.15 (m, 1H), 6.83 (d, J = 8.8 Hz, 1H), 6.46 (d,
J = 8.3 Hz, 1H), 6.38 (d, J = 7.2 Hz, 1H), 2.26 (d, J = 40.6 Hz, 3H); 13C-NMR (126 MHz, CDCl3)
δ 157.32
(s), 155.72 (s), 149.61 (s), 149.19 (dd, J = 245.7, 13.0 Hz), 148.38 (s), 148.09 (dd, J = 244.0, 13.1 Hz), 141.68
(s), 138.14 (s), 137.30 (s), 136.07 (s),127.59 (s), 126.43 (s), 125.08 (s), 123.70 (s), 121.80 (s), 117.58 (s), 117.16
(d, J = 16.9 Hz), 115.74 (d, J = 17.3 Hz), 111.50 (s), 105.33 (s), 50.96 (s), 24.22 (s); HRMS (ESI) m/z calcd.
for C22H17F2N3O [M + H]+: 378.1412, found: 378.1413.
7-((Pyrimidin-2-ylamin◦o)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (33): white solid, yield: 32%
(76 mg), m.p.: 160–163 C, C21H15F3N4O; 1H-NMR (500 MHz, DMSO)
δ 10.10 (s, 1H), 8.83 (d, J = 2.3 Hz,
1H), 8.33–8.23 (m, 3H), 8.18 (d, J = 9.1 Hz, 1H), 7.70 (d, J = 8.5 Hz, 1H), 7.64 (d, J = 7.9 Hz, 2H), 7.57
(d, J = 7.8 Hz, 2H), 7.52 (dd, J = 8.0, 3.9 Hz, 1H), 7.39 (d, J = 8.5 Hz, 1H), 7.04 (d, J = 9.1 Hz, 1H), 6.60
(t, J = 4.3 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
δ 162.48 (s), 158.95 (s), 150.50 (s), 149.22 (s), 148.76
(s), 138.91 (s), 136.90 (s), 128.58 (s), 128.51 (s), 128.14 (q, J = 31.7 Hz), 127.53 (s), 126.01 (q, J = 3.7 Hz),
125.23 (s), 125.17 (q, J = 272.1 Hz), 122.68 (s), 118.42 (s), 111.75 (s), 52.59 (s); HRMS (ESI) m/z calcd. for
C21H15F3N4O [M + H]+: 397.1271, found: 397.1273.
7-((4-Methylpyrimidin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (34): white solid, yield:
46% (113 mg), m.p.: 147–149 ◦C, C22H17F3N4O; 1H-NMR (500 MHz, DMSO)
δ 10.12 (s, 1H), 8.86 (dd,
J = 4.1, 1.5 Hz, 1H), 8.31 (dd, J = 8.3, 1.3 Hz, 1H), 8.16 (d, J = 5.0 Hz, 1H), 8.11 (d, J = 9.4 Hz, 1H), 7.75
(d, J = 8.6 Hz, 1H), 7.66 (d, J = 8.3 Hz, 2H), 7.60 (d, J = 8.2 Hz, 2H), 7.55 (dd, J = 8.3, 4.2 Hz, 1H), 7.42
(d, J = 8.6 Hz, 1H), 7.09 (d, J = 9.4 Hz, 1H), 6.52 (d, J = 5.0 Hz, 1H), 2.26 (s, 3H); 13C-NMR (126 MHz,
DMSO)
δ 167.94 (s), 162.02 (s), 158.11 (s), 150.04 (s), 148.83 (s), 148.65 (s), 138.53 (s), 136.53 (s), 128.15 (s),
128.10 (s), 127.67 (q, J = 31.5 Hz), 127.22 (s), 125.61 (q, J = 3.5 Hz), 125.01 (s), 124.81 (q, J = 271.6 Hz),
122.29 (s), 118.03 (s), 110.84 (s), 52.09 (s), 24.11 (s).
7-((4-Methylpyrimidin-2-ylamino)(4-nitrophenyl)methyl)quinolin-8-ol (35): white solid, yield: 19% (44 mg),
m.p.: 136–138 ◦C, C21H17N5O3; 1H-NMR (500 MHz, DMSO)
δ 10.15 (s, 1H), 8.84 (d, J = 2.5 Hz, 1H),
8.28 (d, J = 7.9 Hz, 1H), 8.18–8.09 (m, 4H), 7.71 (d, J = 8.5 Hz, 1H), 7.62 (d, J = 8.4 Hz, 2H), 7.53 (dd,
J = 8.1, 4.0 Hz, 1H), 7.40 (d, J = 8.5 Hz, 1H), 7.09 (d, J = 9.2 Hz, 1H), 6.51 (d, J = 4.8 Hz, 1H), 2.24 (s, 3 H);
13C-NMR (126 MHz, CDCl3)
δ 168.00 (s), 161.51 (s), 158.09 (s), 151.33 (s), 149.69 (s), 148.45 (s), 146.26 (s),
138.10 (s), 136.10 (s), 128.10 (s), 127.75 (s), 126.73 (s), 124.09 (s), 123.53 (s), 121.94 (s), 117.68 (s), 110.53
(s), 51.69 (s), 23.69 (s); HRMS (ESI) m/z calcd. for C21H17N5O3 [M + H]+: 388.1404, found: 388.1409.
7-((4-Methylpyrimidin-2-ylamino)(4-(pentafluorothio)phenyl)methyl)quinolin-8-ol (36): white solid, yield:
68% (191 mg), m.p.: 164–165 ◦C, C21H17F5N4OS; 1H-NMR (500 MHz, DMSO)
δ 10.16 (s, 1H), 8.87 (dd,
J = 4.1, 1.5 Hz, 1H), 8.31 (dd, J = 8.3, 1.5 Hz, 1H), 8.17 (d, J = 5.0 Hz, 1H), 8.12 (d, J = 9.4 Hz, 1H), 7.84
(d, J = 8.9 Hz, 2H), 7.75 (d, J = 8.6 Hz, 1H), 7.59 (d, J = 8.5 Hz, 2H), 7.55 (dt, J = 12.4, 6.2 Hz, 1H), 7.43
(d, J = 8.6 Hz, 1H), 7.07 (d, J = 9.4 Hz, 1H), 6.52 (t, J = 6.2 Hz, 1H), 2.26 (s, 3H); 13C-NMR (126 MHz,
DMSO)
δ 168.2–167.74 (m), 161.98 (s), 158.28–157.83 (m), 152.05–151.32 (m), 150.08 (s), 148.86 (s), 148.60
(s), 138.53 (s), 136.54 (s), 128.25(s), 128.16 (s), 127.13 (s), 126.36–126.19 (m), 124.73 (s), 122.34 (s), 118.09
(s), 110.92 (s), 51.90 (s), 24.11 (s); HRMS (ESI) m/z calcd. for C21H17F5N4OS [M + H]+: 469.1116,
found: 469.1118.
7-((4-Fluorophenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (37): white solid, yield: 16% (35 mg),
◦
m.p.: 156–158 C, C21H17FN4O; 1H-NMR (500 MHz, DMSO)
δ 9.97 (s, 1H), 8.82 (d, J = 2.8 Hz, 1H), 8.27
(d, J = 8.2 Hz, 1H), 8.12 (d, J = 4.9 Hz, 1H), 7.98 (d, J = 9.5 Hz, 1H), 7.74 (d, J = 8.5 Hz, 1H), 7.51 (dd,
J = 8.2, 4.1 Hz, 1H), 7.42–7.31 (m, 3H), 7.12–7.03 (m, 2H), 6.98 (t, J = 12.1 Hz, 1H), 6.47 (d, J = 4.9 Hz,
1H), 2.22 (s, H); 13C-NMR (126 MHz, CDCl3)
δ
167.90 (s), 161.58 (s), 158.06 (s), 160.95 (d, J = 242.0 Hz),
149.37 (s), 148.30 (s), 139.53 (s), 138.07 (s), 136.05 (s), 128.87 (d, J = 8.1 Hz), 127.51 (s), 126.74 (s), 125.34

Molecules 2018, 23, 1934
19 of 25
(s), 121.71 (s), 117.43 (s), 114.85 (d, J = 21.2 Hz), 110.20 (s), 51.25 (s), 23.63 (s); HRMS (ESI) m/z calcd. for
C21H17FN4O [M + H]+: 361.1459, found: 361.1460.
7-((4-Iodophenyl◦)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (38): white solid, yield: 18% (51 mg),
1
m.p.: 139–142 C, C21H17IN4O; H-NMR (500 MHz, DMSO)
δ 9.99 (s, 1 H), 8.82 (s, 1 H), 8.27 (d,
J = 8.2 Hz, 1 H), 8.12 (d, J = 4.3 Hz, 1 H), 7.96 (d, J = 9.3 Hz, 1 H), 7.70 (d, J = 8.4 Hz, 1 H), 7.61 (d,
J = 7.8 Hz, 2 H), 7.52 (dd, J = 7.8, 3.8 Hz, 1 H), 7.37 (d, J = 8.4 Hz, 1 H), 7.15 (d, J = 7.6 Hz, 2 H), 6.91
(d, J = 9.3 Hz, 1 H), 6.48 (d, J = 4.5 Hz, 1 H), 2.22 (s, 3 H) 13C-NMR (126 MHz, DMSO)
δ 167.89 (s),
162.01 (s), 158.01 (s), 149.90 (s), 148.77 (s), 143.75 (s), 138.51 (s), 137.34 (s), 136.50 (s), 129.86 (s), 128.00
(s), 127.23 (s), 125.35 (s), 122.20 (s), 117.91 (s), 110.69 (s), 92.81 (s), 51.91 (s), 24.06 (s); HRMS (ESI) m/z
calcd. for C21H17IN4O [M + H]+: 469.0520, found: 469.0525.
7-((4-Bromophenyl)(4-m◦ethylpyrimidin-2-ylamino)methyl)quinolin-8-ol (39): ivory-white solid, yield: 29%
(73 mg), m.p.: 143–145 C, C21H17BrN4O; 1H-NMR (500 MHz, DMSO)
δ 10.00 (s, 1H), 8.82 (s, 1H), 8.27
(d, J = 7.9 Hz, 1H), 8.12 (d, J = 4.5 Hz, 1H), 7.98 (d, J = 9.2 Hz, 1H), 7.71 (d, J = 8.5 Hz, 1H), 7.52 (dd,
J = 7.8, 3.8 Hz, 1H), 7.44 (d, J = 8.1 Hz, 2H), 7.38 (d, J = 8.4 Hz, 1H), 7.30 (d, J = 8.0 Hz, 2H), 6.94 (d,
J = 9.3 Hz, 1H), 6.48 (d, J = 4.6 Hz, 1H), 2.22 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 167.85 (s), 161.57 (s),
149.46 (s), 148.34 (s), 142.86 (s), 138.07 (s), 136.06 (s), 131.04 (s), 129.24 (s), 127.57 (s), 126.77 (s), 124.91 (s),
121.77 (s), 119.59 (s), 117.48 (s), 110.27 (s), 51.39 (s), 24.39 (s); HRMS (ESI) m/z calcd. for C21H17BrN4O
[M + H]+: 421.0659, found: 421.0664.
7-((4-Chlorophenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (40): white solid, yield: 40% (90 mg),
m.p.: 139–141 ◦C, C21H17ClN4O; 1H-NMR (500 MHz, DMSO)
δ 10.04 (s, 1H), 8.86 (dd, J = 3.9, 1.3 Hz,
1H), 8.30 (d, J = 8.3 Hz, 1H), 8.15 (d, J = 4.9 Hz, 1H), 8.02 (d, J = 9.4 Hz, 1H), 7.75 (d, J = 8.5 Hz, 1H),
7.55 (dd, J = 8.2, 4.1 Hz, 1H), 7.44–7.37 (m, 3H), 7.34 (d, J = 8.5 Hz, 2H), 6.98 (d, J = 9.4 Hz, 1H), 6.51 (d,
J = 5.0 Hz, 1H), 2.25 (s, 3H); 13C-NMR (126 MHz, DMSO)
δ 167.90 (s), 162.01 (s), 158.05 (s), 149.90 (s),
148.78 (s), 142.86 (s), 138.51 (s), 136.51 (s), 131.53 (s), 129.29 (s), 128.57 (s), 128.00 (s), 127.19 (s), 125.43 (s),
122.21 (s), 117.92 (s), 110.70 (s), 51.74 (s), 24.09 (s); HRMS (ESI) m/z calcd. for C21H17ClN4O [M + H]+:
377.1164, found: 377.1167.
7-((4-Methylpyrimidin-2-ylamino)(3-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (41): white solid, yield:
31% (76 mg), m.p.: 160–163 ◦C, C22H17F3N4O; 1H-NMR (500 MHz, DMSO)
δ 10.08 (s, 1H), 8.91–8.73
(m, 1H), 8.27 (d, J = 8.2 Hz, 1H), 8.21–8.06 (m, 2H), 7.81–7.70 (m, 2H), 7.67 (d, J = 7.0 Hz, 1H), 7.59–7.44
(m, 3H), 7.40 (d, J = 8.5 Hz, 1H), 7.07 (d, J = 9.4 Hz, 1H), 6.49 (d, J= 4.7 Hz, 1H), 2.23 (s, 3H); 13C-NMR
(126 MHz, DMSO) δ 168.00 (s), 161.96 (s), 149.96 (s), 148.87 (s), 145.32 (s), 138.50 (s), 136.54 (s), 131.70
(s), 129.79 (s), 129.36 (q, J = 31.4 Hz), 128.07 (s), 126.93 (s), 125.18 (s), 124.74 (q, J = 272.43 Hz), 123.87 (q,
J = 3.6 Hz), 123.68 (q, J = 3.7 Hz), 122.30 (s), 118.09 (s), 110.85 (s), 51.95 (s), 24.16 (s); HRMS (ESI) m/z
calcd. for C22H17F3N4O [M + H]+: 411.1427, found: 411.1428.
7-((3,5-bis(Trifluoromethyl)phenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (42): white solid,
yield: 59% (169 mg), m.p.: 128–130 ◦C, C23H16F6N4O; 1H-NMR (500 MHz, DMSO)
δ 10.24 (s, 1H),
8.84 (d, J = 2.8 Hz, 1H), 8.36–8.23 (m, 2H), 8.15 (d, J = 4.8 Hz, 1H), 8.08 (s, 2H), 7.93 (s, 1H), 7.77 (d,
J = 8.5 Hz, 1H), 7.53 (dd, J = 8.2, 4.1 Hz, 1H), 7.42 (d, J = 8.5 Hz, 1H), 7.13 (d, J = 9.4 Hz, 1H), 6.52 (d,
J = 4.9 Hz, 1H), 2.24 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ 167.63 (s), 161.38 (s), 157.64 (s), 149.65 (s),
148.57 (s), 146.83 (s), 138.06 (s), 136.14 (s), 130.19 (q, J = 32.9 Hz), 127.80 (s), 127.63 (s), 125.96 (s), 123.97
(s), 123.35 (q, J = 272.8 Hz), 122.02 (s), 120.80–120.55 (m), 117.93 (s), 110.72 (s), 51.60 (s), 23.62 (s); HRMS
(ESI) m/z calcd. for C23H16F6N4O [M + H]+: 479.1301, found: 479.1304.
7-((2,4-bis(Trifluoromethyl)phenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (43): white solid,
◦
1
yield: 16% (46 mg), m.p.: 199–201 C, C23H16F6N4O; H-NMR (500 MHz, DMSO)
δ 9.97 (s, 1H),
8.81 (d, J = 2.4 Hz, 1H), 8.28 (d, J = 7.8 Hz, 1H), 8.08 (s, 1H), 8.03 (d, J = 6.0 Hz, 1H), 7.99–7.95 (m,
2H), 7.80 (bs, 1H), 7.52 (dd, J = 8.1, 3.9 Hz, 1H), 7.33 (dd, J = 11.7, 9.2 Hz, 2H), 7.21 (d, J = 4.7 Hz,
1H), 6.47 (d, J = 4.7 Hz, 1H), 2.19 (s, 3H); 13C-NMR (126 MHz, DMSO)
δ
169.04 (s), 161.45 (s), 158.49
(s), 150.79 (s), 148.79 (s), 138.45 (s), 136.53 (s), 131.63 (s), 129.90–129.72 (m), 128.66 (q, J = 31.4 Hz),

Molecules 2018, 23, 1934
20 of 25
128.55 (q, J = 32.7 Hz), 128.26 (s), 127.05–126.81 (m), 124.01 (q, J = 275.4 Hz), 123.97 (q, J = 272.2 Hz),
123.57–123.27 (m), 122.34 (s), 117.30 (s), 116.90 (s), 110.80 (s), 49.76 (s), 24.05 (s); HRMS (ESI) m/z calcd.
for C23H16F6N4O [M + H]+: 479.1301, found: 479.1307.
7-((4-Fluoro-3-(trifluoromethyl)phenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (44): white solid,
yield: 25% (64 mg), m.p.: 89–92 ◦C, C22H16F4N4O; 1H-NMR (500 MHz, DMSO)
δ
10.10 (s, 1H), 8.82
(bs, 1H), 8.26 (d, J = 5.6 Hz, 1H), 8.19–8.08 (m, 2H), 7.83–7.64 (m, 3H), 7.51 (dd, J = 5.6, 3.6 Hz, 1 H),
7.43–7.31 (m, 2H), 7.01 (d, J = 7.7 Hz, 1H), 6.49 (bs, 1H), 2.22 (s, 3H); 13C-NMR (126 MHz, CDCl3)
δ
167.49 (bs), 161.44 (s), 157.95–157.18 (m), 157.63 (d, J = 252.6 Hz), 149.50 (s), 148.44 (s), 140.49 (s), 138.05
(s), 136.09 (s), 133.81 (d, J = 8.5 Hz), 127.67 (s), 126.23 (s), 125.27 (d, J = 3.4 Hz), 124.56 (s), 123.77 (s),
121.87 (s), 117.70 (s), 117.08 (d, J = 20.5 Hz), 110.49 (s), 51.15 (s), 23.62 (s); HRMS (ESI) m/z calcd. for
C22H16F4N4O [M + H]+: 429.1333, found: 429.1337.
7-((3-Fluoro-5-(trifluoromethyl)phenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (45): ivory-white
◦
solid, yield: 15% (39 mg), m.p.: decomposed 92 C, C22H16F4N4O; 1H-NMR (500 MHz, DMSO)
δ 10.22
(s, 1H), 8.87 (d, J = 3.0 Hz, 1H), 8.31 (d, J = 8.1 Hz, 1H), 8.21 (d, J = 9.5 Hz, 1H), 8.18 (d, J = 4.8 Hz, 1H),
7.77 (d, J = 8.5 Hz, 1H), 7.65 (s, 1H), 7.58–7.52 (m, 3H), 7.44 (d, J = 8.5 Hz, 1H), 7.09 (d, J = 9.4 Hz, 1H),
6.55 (d, J = 4.9 Hz, 1H), 2.27 (s, 3H); 13C-NMR (126 MHz, DMSO) δ 162.39 (d, J = 246.5 Hz), 161.86 (s),
150.03 (s), 148.97 (s), 148.74 (d, J = 6.8 Hz), 138.51 (s), 136.57 (s), 131.72–131.06 (m), 128.19 (s), 126.64 (s),
124.61 (s), 123.80 (dq, J = 272.7, 4.2 Hz), 122.42 (s), 120.28–119.83 (m), 118.40 (d, J = 22.0 Hz), 118.26 (s),
111.74–111.36 (m), 111.08 (s), 51.86 (s), 24.10 (s); HRMS (ESI) m/z calcd. for C22H16F4N4O [M + H]+:
429.1333, found: 429.1336.
7-((5-Bromopyrimidin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (46): white solid, yield:
15% (43 mg), m.p.: 146–148 ◦C, C21H14BrF3N4O; 1H-NMR (500 MHz, DMSO)
δ
10.12 (s, 1H), 8.84 (d,
J = 2.2 Hz, 1H), 8.50 (d, J = 8.9 Hz, 1H), 8.41 (s, 2H), 8.28 (d, J = 7.9 Hz, 1H), 7.70–7.61 (m, 3H), 7.59–7.49
(m, 3H), 7.39 (d, J = 8.4 Hz, 1H), 6.96 (d, J = 8.8 Hz, 1H); 13C-NMR (126 MHz, CDCl3)
160.07 (s),
δ
149.81 (s), 148.45 (s), 147.38 (s), 138.07 (s), 136.11 (s), 127.82 (s), 127.75 (s), 127.19 (q, J = 31.8 Hz), 126.52
(s), 125.26 (q, J = 4.0 Hz), 124.77 (q, J = 272.0 Hz), 123.91 (s), 121.93 (s), 117.62 (s), 106.09 (s), 52.12 (s);
HRMS (ESI) m/z calcd. for C21H14BrF3N4O [M + H]+: 475.0376, found: 475.0384.
7-((2-Hydroxyphenyl)(4-methylpyrimidin-2-ylamino)methyl)quinolin-8-ol (47): caesious solid, yield: 15%
(32 mg), m.p.: decomposed 179 ◦C, C21H18N4O2; 1H-NMR (500 MHz, DMSO)
δ 9.81 (s, 1 H), 9.49 (s,
1 H), 8.82 (d, J = 2.9 Hz, 1 H), 8.28 (d, J = 7.7 Hz, 1 H), 8.11 (d, J = 4.9 Hz, 1H), 7.59 (d, J = 8.5 Hz, 1H),
7.51 (dd, J = 8.3, 4.2 Hz, 1H), 7.49 (d, J = 9.2 Hz, 1H), 7.34 (d, J = 8.5 Hz, 1H), 7.24 (d, J = 7.2 Hz, 1H),
7.04 (t, J = 7.1 Hz, 1H), 6.99 (d, J = 9.0 Hz, 1H), 6.77 (d, J = 7.9 Hz, 1H), 6.72 (t, J = 7.4 Hz, 1H), 6.46 (d,
J = 4.9 Hz, 1H), 2.23 (s, 3H); 13C-NMR (126 MHz, DMSO)
δ 167.64 (s), 161.85 (s), 157.94 (s), 155.36 (s),
150.18 (s), 148.47 (s), 138.47(s), 136.39 (s), 129.22 (s), 128.76 (s), 128.12 (s), 127.85 (s), 127.80 (s), 125.59
(s), 121.89 (s), 119.01 (s), 116.93 (s), 115.63 (s), 110.29 (s), 48.89 (s), 24.13 (s); HRMS (ESI) m/z calcd. for
C21H18N4O2 [M + H]+: 359.1503, found: 359.1509.
2-Methyl-7-((4-methylpyrimidin-2-ylamino)(4-(trifluoromethyl)phenyl)methyl)quinolin-8-ol (48): white solid,
◦
1
yield: 25% (64 mg), m.p.: 123–125 C, C23H19F3N4O; H-NMR (500 MHz, DMSO)
δ 9.59 (s, 1H),
8.19–8.15 (m, 2H), 8.09 (d, J = 9.4 Hz, 1H), 7.69–7.64 (m, 3H), 7.59 (d, J = 8.3 Hz, 2H), 7.42 (d, J = 8.4 Hz,
1H), 7.36 (d, J = 8.6 Hz, 1H), 7.07 (d, J = 9.4 Hz, 1H), 6.52 (d, J = 5.0 Hz, 1H), 2.70 (s, 3H), 2.26 (s, 3H);
13C-NMR (126 MHz, DMSO)
δ 167.96 (s), 162.04 (s), 158.23 (s), 157.51 (s), 149.14 (s), 148.73 (s), 137.80
(s), 136.56 (s), 128.09 (s), 127.52 (q, J = 31.6 Hz), 126.17 (s), 126.09 (s), 125.57 (q, J = 3.5 Hz), 124.81 (q,
J = 271.9 Hz), 124.77 (s), 123.09 (s), 117.87 (s), 110.83 (s), 52.08 (s), 25.14 (s), 24.12 (s); HRMS (ESI) m/z
calcd. for C23H19F3N4O [M + H]+: 425.1584, found: 425.1585.
3.2. Cell Culture
U251 MG cell line was a gift from Szabolcs Bellyei, the University of Pecs (originally obtained
from American Type Culture Collection, Manassas, VA, USA). Cells were grown at 37 ◦C under 5%

Molecules 2018, 23, 1934
21 of 25
CO2 and 100% humidity in Roswell Park Memorial Institute (RPMI) medium supplemented with 10%
fetal calf serum (FCS) (Sigma-Aldrich, Budapest, Hungary), and penicillin-streptomycin antibiotics.
3.3. End Point Cytoprotection Assay
For cytoprotection assays, 104 cells were seeded into each well of 96-well cell culture plates (Costar,
Corning Inc., Corning, NY, USA) in culture medium containing 10% FCS. The following day, cells
were treated with an increasing concentration of test compounds in the presence of 250 µM H2O2
(Sigma-Aldrich, Budapest, Hungary). The H2O2 concentration to elicit cell injury was predetermined
in a pilot experiment (data not shown) and was set to induce a decrease in viability of 65–75% after 24 h
Plate-to-plate variation was monitored using a dilution series of a known cytoprotective compound
that was tested on each plate. Cell viability was recorded 24 h after treatment. Resazurin reagent
(Sigma-Aldrich) was dissolved in phosphate buffered saline (PBS, pH 7.4) at 0.15 mg/mL concentration,
◦
◦
sterile filtered (0.22
were treated with a final concentration of 25
µ
m, Merck Millipore, Budapest, Hungary), aliquoted and stored at
−
20 C. Samples
µ
g/mL resazurin. After 2 h of incubation at 37 C 5% CO2,
fluorescence (530 nm excitation/580 nm emission) was recorded on a multimode microplate reader
(Cytofluor4000, PerSeptive Biosystems, Foster City, CA, USA). Viability was calculated in relation to
untreated control cells and blank wells containing media without cells. The presented IC50 values
(half maximal inhibitory concentration) were determined based on dose-response curves plotted in
GraphPad Prism® 5.
3.4. Real-Time Cell Electronic Sensing (RT-CES) Cytoprotection Assay
A RT cytoprotection assay was performed as previously described [42
E-plate (Roche, Hungary) was coated with gelatin solution (0.2% in PBS) for 20 min at 37 ◦C, then
gelatin was washed twice with PBS solution. Growth media (50 L) was then gently dispensed into
each well of the 96-well E-plate for background readings by the RT-CES system prior to addition of
50
L of the cell suspension containing 104 U251 MG cells. Plates were kept at room temperature in
,48]. Briefly, RT-CES 96-well
µ
µ
a tissue culture hood for 30 min prior to insertion into the RT-CES device in the incubator to allow
cells to settle. Cell growth was monitored overnight by measurements of electrical impedance every
15 min. Continuous recording of impedance in cells was reflected by cell index value. Next day, cells
were co-treated with 250 µM H2O2 and test compounds. Treated and control wells were dynamically
monitored over 48 h by measurements of electrical impedance every 5 min. The raw plate reads for
each titration point were normalized relative to the cell index status right before treatment. Each
treatment was repeated in three wells per plate during the experiments.
3.5. Detection of Mitochondrial Membrane Potential
Mitochondrial membrane potential was measured as described previously [49] U251 cells (6
were plated in 24-well tissue culture plates (Corning Life Sciences, Corning, NY, USA) in RPMI 10%
FCS and were treated in 500 L media containing 500 M H2O2 with or without test compounds.
Untreated controls cells were supplemented with 500 L cell culture media. After 2 h, the supernatants
were harvested. Cells were washed with PBS, trypsinized, pooled with the corresponding supernatant,
×
104)
µ
µ
µ
and centrifuged (2000 rpm, 5 mi0n). The pellet was resuspended and incubated for 15 min in 5
µg/mL
0
0
0
JC-1 (5,5 ,6,6 -tetrachloro-1,1 ,3,3 -tetraethylbenzimidazolocarbocyanine iodide, Chemodex) containing
media in final volume 300
the red–green fluorescence intensity of 6
µ
L at 37 ◦C. Finally, using FL2 (585/42 nm) -FL1 (530/30 nm) channels,
×
103 events was acquired immediately on a FACSCalibur
flow cytometer. Data were analyzed using CellQuestTM software (CellQuest Pro v5.1, Becton Dickinson,
Franklin Lakes, NJ, USA) gating out debris. Bar graphs show the percentage of FL1 positive cells
visualized by GraphPad Prism® 5. For significance analysis, a Student’s t-test was applied in
Microsoft Excel.

Molecules 2018, 23, 1934
22 of 25
3.6. Gene Expression Analysis
The day before measurement, U-251 MG cells were seeded in 24-well microtiter plates with
100,000 cells/well density. Cells were treated with either vehicle (solvent control; 0.01% DMSO)
or with 8-HQ analogues: 21 34 47, and 48 at two different concentrations: 100 nM or 300 nM.
≤
,
,
After 6 hours of incubation the medium was removed, and cells were rinsed with PBS. Cells were
collected for RNA isolation in RA1 Lysis Buffer (Macherey-Nagel, Germany) supplemented with 1%
beta-mercaptoethanol. Total RNA was purified with the Direct-zol kit (Zymo Research, Irvine, CA,
USA) according to the manufacturer’s protocol. Total RNA was converted into complementary DNA
(cDNA) using the High-Capacity cDNA Archive Kit (Applied Biosystems, Foster City, CA, USA) in a
volume of 10 µL. 0.75 µL cDNA template was used (19 ng) in each PCR reaction. Quantitative real-time
PCR was performed on the LightCycler 96 instrument (Roche) with gene-specific primers and the
SYBRGreen protocol. NormFinder software [50] was used to calculate the most suitable housekeeping
genes (TUBB and PPIA) for relative expression ratio calculation. For significance analysis, a Student’s
t-test was applied in Microsoft Excel. Table 4 lists the primer sequences used.
Table 4. Primer sequences for Quantitative real-time PCR (qRT-PCR) analysis.
Gene Name
Abbreviation
Forward_Sequence
Reverse_Sequence
Tubulin beta class I
Peptidylprolyl isomerase A
Heme oxygenase 1
TUBB
PPIA
HMOX1
VEGF
ataccttgaggcgagcaaaa
atgctggacccaacacaaat
ggcagagggtgatagaagagg
gcagcttgagttaaacgaacg
ccccatcccatggttcatc
ctgatcacctcccagaacttg
tctttcactttgccaaacacc
agctcctgcaactcctcaaa
ggttcccgaaaccctgag
tgaggtccagttggagaagc
Vascular endothelial growth factor
Solute carrier family 2 member 1
GLUT1
4. Conclusions
Our synthesized 8HQ analogs were tested for cytoprotective activity in different assays and a
handful of compounds were selected for further test. As expected, maintenance of mitochondrial
membrane potential in oxidative stress was a key factor for their activity. Induction of hypoxia related
genes under the regulation of HIF1A may be a crucial mechanistic step for cytoprotective activity.
Based on our results, lead compounds will be further tested in animal models of different CNS diseases
where oxidative stress is involved.
5. Patents
Compounds described in the current study are protected by patent #WO2011148208.
Supplementary Materials: The following are available online (1H, 13C-NMR and HRMS spectra of 1–48).
Author Contributions: Conceptualization: L.G.P., I.K., L.H.J.; Writing—Original Draft Preparation: I.K., L.H.J.;
Chemical synthesis and analytical studies: I.K., R.M., M.G.; Biological evaluation: L.H.J. (screening), G.J.S. (FACS
based MMP studies), O.H. (gene expression analysis).
Funding: This study was supported by a grant from the National Development Agency of Hungary
(TÀMOP-4.2.2-08/1/KMR-2008-004). Gábor J. Szebeni was supported by János Bolyai Research Scholarship of the
Hungarian Academy of Sciences (BO/00139/17/8).
Conflicts of Interest: László G. Puskás is the owner of Avidin Ltd and Avicor Ltd. Other authors declare no
conflict of interest.
References
1.
Oliveri, V.; Vecchio, G. 8-Hydroxyquinolines in medicinal chemistry: A structural perspective. Eur. J. Med.
Chem. 2016, 120, 252–274. [CrossRef] [PubMed]
2.
Phillips, J.P.; Keown, R.; Fernand, Q. The reaction of anils with 8-quinolinol. J. Org. Chem. 1954, 19, 907–909.
[CrossRef]

Molecules 2018, 23, 1934
23 of 25
3.
4.
Phillips, J.P.; Keown, R.; Fernand, Q. The reaction of aldehydes and aromatic amines with 8-Quinolinol.
J. Am. Chem. Soc. 1953, 75, 4306–4307. [CrossRef]
Sosicˇ, I.; Mirkovic´, B.; Arenz, K.; Štefane, B.; Kos, J.; Gobec, S. Development of new cathepsin B
inhibitors: Combining bioisosteric replacements and structure-based design to explore the structure–activity
relationships of nitroxoline derivatives. J. Med. Chem. 2013, 56, 521–533. [CrossRef] [PubMed]
Swale, D.R.; Kurata, H.; Kharade, S.V.; Sheehan, J.H.; Raphemot, R.R.; Voigtritter, K.R.; Figueroa, E.; Meiler, J.;
Flobaum, A.L.; Lindsley, C.W.; et al. ML418: The first selective, sub-micromolar pore blocker of Kir7.1
potassium channels. ACS Chem. Neurosci. 2016, 7, 1013–1023. [CrossRef] [PubMed]
5.
6.
Mirkovic, B.; Renko, M.; Turk, S.; Sosic, I.; Jevnikar, Z.; Obermajer, N.; Turk, D.; Gobec, S.; Kos, J. Novel
mechanism of cathepsin B inhibition by antibiotic nitroxoline and related compounds. ChemMedChem 2011
6, 1351–1356. [CrossRef] [PubMed]
,
7.
8.
9.
Zeng, G.Z.; Pan, X.L.; Tan, N.H.; Xiong, J.; Zhang, Y.M. Natural biflavones as novel inhibitors of cathepsin B
and K. Eur. J. Med. Chem. 2006, 41, 1247–1252. [CrossRef] [PubMed]
Schenker, P.; Alfarano, P.; Kolb, P.; Caflisch, A.; Baici, A. A double-headed cathepsin B inhibitor devoid of
warhead. Protein Sci. 2008, 17, 2145–2155. [CrossRef] [PubMed]
Thinnes, C.C.; Tumber, A.; Yapp, C.; Scozzafava, G.; Yeh, T.; Chan, M.C.; Tran, T.A.; Hsu, K.; Tarhonskaya, H.;
Walport, L.J.; et al. Betti reaction enables efficient synthesis of 8-hydroxyquinoline inhibitors of 2-oxoglutarate
oxygenases. Chem. Commun. 2015, 51, 15458–15461. [CrossRef] [PubMed]
10. Kenyon, V.; Rai, G.; Jadhav, A.; Schultz, L.; Armstrong, M.; Jameson, J.B.; Perry, S.II.; Joshi, N.; Bougie, J.M.;
Leister, W.; et al. Discovery of potent and selective inhibitors of human platelet type 12-lipoxygenase.
J. Med. Chem. 2011, 54, 5485–5497. [CrossRef] [PubMed]
11. Enquist, P.-A.; Gylfe, Å.; Hägglund, U.; Lindström, P.; Norberg-Scherman, H.; Sundin, C.; Elofsson, M.
Derivatives of 8-hydroxyquinoline-antibacterial agents that target intra- and extracellular Gram-negative
pathogens. Bioorg. Med. Chem. Lett. 2012, 22, 3550–3553. [CrossRef] [PubMed]
12. Chen, H.-L.; Chang, C.-Y.; Lee, H.-T.; Lin, H.-H.; Lu, P.-J.; Yang, C.-N.; Shiau, C.-W.; Shawb, A.Y. Synthesis and
pharmacological exploitation of clioquinol-derived copper-binding apoptosis inducers triggering reactive
oxygen species generation and MAPK pathway activation. Bioorgan. Med. Chem. 2009, 17, 7239–7247.
[CrossRef] [PubMed]
13. Shaw, A.J.; Chang, C.-Y.; Hsu, M.-Y.; Lu, P.-J.; Yang, C.-N.; Chen, H.-L.; Lo, C.-W.; Shiau, C.-W.; Chern, M.-K.
Synthesis and structure-activity relationship study of 8-hydroxyquinoline-derived Mannich bases as
anticancer agents. Eur. J. Med. Chem. 2010, 45, 2860–2867. [CrossRef] [PubMed]
14. Bhat, S.; Shim, J.S.; Zhang, F.; Chong, C.R.; Jun, O.; Liu, J.O. Substituted oxines inhibit endothelial cell
proliferation and angiogenesis. Org. Biomol. Chem. 2012, 10, 2979–2992. [CrossRef] [PubMed]
15. Ibach, B.; Haen, E.; Marienhagen, J.; Hajak, G. Clioquinol treatment in familiar early onset of Alzheimer’s
disease: A case report. Pharmacopsychiatry 2005, 38, 178–179. [CrossRef] [PubMed]
16. Regland, B.; Lehmann, W.; Abedini, I.; Blennow, K.; Jonsson, M.; Karlsson, I.; Sjogren, M.; Wallin, A.;
Xilinas, M.; Gottfries, C.G. Treatment of Alzheimer’s disease with clioquinol. Dement. Geriatr. Cogn. 2001, 12,
408–414. [CrossRef] [PubMed]
17. Ritchie, C.W.; Bush, A.I.; Masters, C.L. Metal-protein attenuating compounds and Alzheimer’s disease.
Expert Opin. Inv. Drug 2004, 13, 1585–1592.
18. Raman, B.; Ban, T.; Yamaguchi, K.; Sakai, M.; Kawai, T.; Naiki, H.; Goto, Y. Metal Ion-dependent effects of
clioquinol on the fibril growth of an amyloid
[PubMed]
β PEPTIDE. J. Biol. Chem. 2005, 280, 16157–16162. [CrossRef]
19. Faux, N.G.; Ritchie, C.W.; Gunn, A.; Rembach, A.; Tsatsanis, A.; Bedo, J.; Harrison, J.; Lannfelt, L.; Blennow, K.;
Zetterberg, H.; et al. PBT2 rapidly improves cognition in alzheimer’s disease: Additional phase II analyses.
J. Alzheimers Dis. 2010, 20, 509–516. [CrossRef] [PubMed]
20. Adlard, P.A.; Cherny, R.A.; Finkelstein, D.I.; Gautier, E.; Robb, E.; Cortes, M.; Volitakis, I.; Liu, X.; Smith, J.P.;
Perez, K.; et al. Rapid restoration of cognition in Alzheimer’s transgenic mice with 8-hydroxy quinoline
analogs is associated with decreased interstitial Abeta. Neuron 2008, 59, 48–55. [CrossRef] [PubMed]
21. Barnham, K.J.; Gautier, E.C.L.; Kok, G.B.; Krippner, G. 8-Hydroxy Quinoline Derivatives. U.S. Patent
2015335635, 26 November 2015.

Molecules 2018, 23, 1934
24 of 25
22. Liang, S.H.; Southon, A.G.; Fraser, B.H.; Krause-Heuer, A.M.; Zhang, B.; Shoup, T.M.; Lewis, R.; Volitakis, I.;
Han, Y.; Greguric, I.; et al. Novel fluorinated 8-Hydroxyquinoline based metal ionophores for exploring the
metal hypothesis of Alzheimer’s disease. ACS Med. Chem. Lett. 2015, 6, 1025–1029. [CrossRef] [PubMed]
23. Prachayasittikul, V.; Prachayasittikul, S.; Ruchirawat, S.; Prachayasittikul, V. 8-Hydroxyquinolines: A review
of their metal chelating properties and medicinal applications. Drug. Des. Dev. Ther. 2013, 7, 1157–1178.
[CrossRef] [PubMed]
24. Zheng, H.; Gal, S.; Weiner, L.M.; Bar-Am, O.; Warshawsky, A.; Fridkin, M.; Youdim, M.B. Novel
multifunctional neuroprotective iron chelator-monoamine oxidase inhibitor drugs for neurodegenerative
diseases: In vitro studies on antioxidant activity, prevention of lipid peroxide formation and monoamine
oxidase inhibition. J. Neurochem. 2005, 95, 68–78. [CrossRef] [PubMed]
25. Zheng, H.; Youdim, M.B.H.; Fridkin, M. Selective acetylcholinesterase inhibitor activated by
acetylcholinesterase releases an active chelator with neurorescuing and anti-amyloid activities. ACS Chem.
Neurosci. 2010, 1, 737–746. [CrossRef] [PubMed]
26. Wu, M.Y.; Esteban, G.; Brogi, S.; Shionoya, M.; Wang, L.; Campiani, G.; Unzeta, M.; Inokuchi, T.; Butini, S.;
Marco-Contelles, J. Donepezil-like multifunctional agents: Design, synthesis, molecular modelling and
biological evaluation. Eur. J. Med. Chem. 2015, 121, 864–879. [CrossRef] [PubMed]
27. Wang, L.; Esteban, G.; Ojima, M.; Bautista-Aguilera, O.M.; Inokuchi, T.; Moraleda, I.; Iriepa, I.; Samadi, A.;
Youdim, M.B.H.; Romero, A.; et al. Donepezil + propargylamine + 8-hydroxyquinoline hybrids as new
multifunctional metal-chelators, ChE and MAO inhibitors for the potential treatment of Alzheimer’s disease.
Eur. J. Med. Chem. 2014, 80, 543–561. [CrossRef] [PubMed]
28. Unzeta, M.; Esteban, G.; Bolea, I.; Fogel, W.A.; Ramsay, R.R.; Youdim, M.B.H.; Tipton, K.F.; Marco-Contelles, J.
Multi-target directed donepezil-like ligands for Alzheimer’s disease. Front. Neurosci. Switz. 2016, 10, 205.
[CrossRef] [PubMed]
29. Fernandez-Bachiller, M.I.; Perez, C.; Gonzalez-Munoz, G.C.; Conde, S.; Lopez, M.G.; Villarroya, M.;
Garcıa, A.G.; Rodrıguez-Franco, M.I. Novel tacrine 8-hydroxyquinoline hybrids as multifunctional
−
agents for the treatment of Alzheimer’s disease, with neuroprotective, cholinergic, antioxidant, and
copper-complexing properties. J. Med. Chem. 2010, 53, 4927–4937. [CrossRef] [PubMed]
30. Song, Y.; Xu, H.; Chen, W.; Zhan, P.; Liu, X. 8-Hydroxyquinoline: A privileged structure with a broad-ranging
pharmacological potential. MedChemComm 2015, 6, 61–74. [CrossRef]
31. Warshawsky, A.; Youdim, M.B.H.; Ben-Shachar, D. Pharmaceutical Compositions Comprising Iron Chelators
for the Treatment of Neurodegenerative Disorders and Some Novel Iron Chelators. U.S. Patent 6855711,
15 February 2005.
32. Youdim, M.B.H. The path from anti parkinson drug selegiline and rasagiline to multifunctional
neuroprotective anti alzheimer drugs ladostigil and M30. Curr. Alzheimer Res. 2006, 3, 541–550. [CrossRef]
[PubMed]
33. Gal, S.; Zheng, H.; Fridkin, M.; Youdim, M.B.H. Restoration of nigrostriatal dopamine neurons in post-mptp
treatment by the novel multifunctional brain-permeable iron chelator-monoamine oxidase inhibitor drug,
M30. Neurotox. Res. 2010, 17, 15–27. [CrossRef] [PubMed]
34. Weinreb, O.S.; Mandel, O.; Bar-Am, M.; Yogev-Falach, Y.; Avramovich-Tirosh, T.; Amit, M.B. Youdim,
multifunctional neuroprotective derivatives of rasagiline as anti-Alzheimer’s disease drugs. Neurotherapeutics
2009, 6, 163–174. [CrossRef] [PubMed]
35. Wang, Q.; Zhang, X.; Chen, S.; Zhang, S.; Youdium, M.; Le, W. prevention of motor neuron degeneration by
novel iron chelators in sod1g93a transgenic mice of amyotrophic lateral sclerosis. Neurodegener. Dis. 2011, 8,
310–321. [CrossRef] [PubMed]
36. Benkler, C.; Offen, D.; Melamed, E.; Kupershmidt, L.; Amit, T.; Mandel, S.; Youdim, M.B.H.; Weinreb, O.
Recent advances in amyotrophic lateral sclerosis research: Perspectives for personalized clinical application.
EPMA J. 2010, 1, 343–361. [CrossRef] [PubMed]
37. Prati, F.; Bergamini, C.; Fato, R.; Soukup, O.; Korabecny, J.; Andrisano, V.; Bartolini, M.; Bolognesi, M.L.
Novel 8-hydroxyquinoline derivatives as multitarget compounds for the treatment of alzheimer’s disease.
ChemMedChem. 2016, 11, 1284–1295. [CrossRef] [PubMed]
38. Gomes, L.M.F.; Vieira, R.P.; Jones, M.R.; Wang, M.C.P.; Dyrager, C.; Souza-Fagundes, E.M.; Da Silva, J.G.;
Storr, T.; Beraldo, H. 8-hydroxyquinoline schiff-base compounds as antioxidants and modulators of
copper-mediated Aβ peptide aggregation. J. Inorg. Biochem. 2014, 139, 106–116. [CrossRef] [PubMed]

Molecules 2018, 23, 1934
25 of 25
39. Cukierman, D.S.; Pinheiro, A.B.; Castiñeiras-Filho, S.L.P.; da Silva, A.S.; Miotto, M.C.; De Falco, A.; de
Ribeiro, T.P.; Maisonette, S.; da Cunha, A.L.M.P.; Hauser-Davis, R.A.; et al. A moderate metal-binding
hydrazone meets the criteria for a bioinorganic approach towards Parkinson’s disease: Therapeutic potential,
blood-brain barrier crossing evaluation and preliminary toxicological studies. J. Inorg. Biochem. 2017, 17,
160–168.
40. Tardiff, D.F.; Tucci, M.L.; Caldwell, K.A.; Caldwell, G.A.; Lindquist, S. Different 8-hydroxyquinolines protect
models of TDP-43 protein, α-synuclein, and polyglutamine proteotoxicity through distinct mechanisms.
J. Biol. Chem. 2012, 287, 4107–4120. [CrossRef] [PubMed]
41. Youdim, M.B.H.; Fridkin, M.; Zheng, H. Novel bifunctional drugs targeting monoamine oxidase inhibition
and iron chelation as an approach to neuroprotection in Parkinson’s disease and other neurodegenerative
diseases. J. Neural Transm. 2004, 111, 1455–1471. [CrossRef] [PubMed]
42. Ózsvári, B.; Puskás, L.G.; Nagy, L.I.; Kanizsai, I.; Gyuris, M.; Madácsi, R.; Fehér, L.Z.; Gero˝, D.; Szabó, C.
A cell-microelectronic sensing technique for the screening of cytoprotective compounds. Int. J. Mol. Med.
2010, 25, 525–530. [PubMed]
43. Korkmaz, S.; Barnucz, E.; Loganathan, S.; Li, S.; Radovits, T.; Hegedu˝s, P.; Zubarevich, A.; Hirschberg, K.;
Weymann, A.; Puskás, L.G.; et al. Q50, an Iron-Chelating and zinc-complexing agent, improves cardiac
function in rat models of ischemia/reperfusion-induced myocardial injury. Circ. J. 2013, 77, 1817–1826.
[CrossRef] [PubMed]
44. Darvas, F.; Dorman, G.; Krajcsi, P.; Puskas, L.G.; Kovari, Z.; Lorincz, Z.; Urge, L. Recent advances in chemical
genomics. Curr. Med. Chem. 2004, 11, 3119–3145. [CrossRef] [PubMed]
45. Vayssier-Taussat, M.; Kreps, S.E.; Adrie, C.; Dall’Ava, J.; Christiani, D.; Polla, B.S. Mitochondrial membrane
potential: A novel biomarker of oxidative environmental stress. Environ. Health Persp. 2002, 110, 301–305.
[CrossRef]
46. Ogunshola, O.O.; Antoniou, X. Contribution of hypoxia to Alzheimer’s disease: Is HIF-1alpha a mediator of
neurodegeneration? Cell. Mol. Life Sci. 2009, 22, 3555–3563. [CrossRef] [PubMed]
47. Ryou, M.G.; Liu, R.; Ren, M.; Sun, J.; Mallet, R.T.; Yang, S.H. Pyruvate protects the brain against
ischemia-reperfusion injury by activating the erythropoietin signaling pathway. Stroke 2012, 43, 1101–1107.
[CrossRef] [PubMed]
48. Antal, O.; Hackler, L.J.; Shen, J.; Mán, I.; Hideghéty, K.; Kitajka, K.; Puskás, L.G. Combination of unsaturated
fatty acids and ionizing radiation on human glioma cells: Cellular, biochemical and gene expression analysis.
Lipids Health Dis. 2014, 13, 142. [CrossRef] [PubMed]
49. Szebeni, G.J.; Balázs, Á.; Madarász, I.; Pócz, G.; Ayaydin, F.; Kanizsai, I.; Fajka-Boja, R.; Alföldi, R.;
Hackler, L., Jr.; Puskás, L.G. Achiral mannich-base curcumin analogs induce unfolded protein response
and mitochondrial membrane depolarization in PANC-1 cells. Int. J. Mol. Sci. 2017, 18, 2105. [CrossRef]
[PubMed]
50. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative RT-PCR data: A model
based variance estimation approach to identify genes suited for normalization applied to bladder- and
colon-cancer data-sets. Cancer Res. 2004, 64, 5245–5250. [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors.
©
2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).